ID: 1019659436

View in Genome Browser
Species Human (GRCh38)
Location 7:2215782-2215804
Sequence CCAGCTGCTCACCTACAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019659436_1019659442 10 Left 1019659436 7:2215782-2215804 CCATGTTGTAGGTGAGCAGCTGG 0: 1
1: 0
2: 2
3: 21
4: 191
Right 1019659442 7:2215815-2215837 CACAATACCGAGGCTCCTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 66
1019659436_1019659446 21 Left 1019659436 7:2215782-2215804 CCATGTTGTAGGTGAGCAGCTGG 0: 1
1: 0
2: 2
3: 21
4: 191
Right 1019659446 7:2215826-2215848 GGCTCCTCCAGGCAGGGCAGAGG 0: 1
1: 0
2: 6
3: 60
4: 515
1019659436_1019659440 0 Left 1019659436 7:2215782-2215804 CCATGTTGTAGGTGAGCAGCTGG 0: 1
1: 0
2: 2
3: 21
4: 191
Right 1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 17
1019659436_1019659444 15 Left 1019659436 7:2215782-2215804 CCATGTTGTAGGTGAGCAGCTGG 0: 1
1: 0
2: 2
3: 21
4: 191
Right 1019659444 7:2215820-2215842 TACCGAGGCTCCTCCAGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 154
1019659436_1019659443 14 Left 1019659436 7:2215782-2215804 CCATGTTGTAGGTGAGCAGCTGG 0: 1
1: 0
2: 2
3: 21
4: 191
Right 1019659443 7:2215819-2215841 ATACCGAGGCTCCTCCAGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019659436 Original CRISPR CCAGCTGCTCACCTACAACA TGG (reversed) Intronic
900529892 1:3148010-3148032 CCTGCTGCTCACCTGCAACTTGG + Intronic
902610051 1:17591908-17591930 TCAGCTGCTCATCTGCAAAATGG - Intronic
903356133 1:22748959-22748981 CCAGCAGCTCACAGACAAGAGGG - Intronic
904614987 1:31744720-31744742 CCGGCTCCTCACCTGGAACACGG + Exonic
905480919 1:38261460-38261482 CCAGCTGCTCTCCCAGAACTGGG - Intergenic
905656595 1:39689979-39690001 CCAGCTGGCCACCTACAATTTGG + Intronic
905942449 1:41874893-41874915 CCAGCTGCTCACACACAACTTGG + Intronic
906128581 1:43442444-43442466 ACAGCTGCTGACCTACAACTGGG + Exonic
906804741 1:48769795-48769817 CCAGGTGCTCATCTATAGCATGG - Intronic
912321221 1:108715414-108715436 CCAGCTTCTCATCTACTAAAGGG + Intronic
913997781 1:143665622-143665644 GCAGCTACTCACCTAGAGCAAGG - Intergenic
915145026 1:153791754-153791776 CCATCTGCTCACCTGTAAGAGGG - Intergenic
916662291 1:166934045-166934067 CCAGCGGCTCATCTACATCTAGG + Intronic
917102904 1:171463282-171463304 CCATCTCCTCACCTGCAAAATGG + Intergenic
918098020 1:181350344-181350366 GCAGCTGCTCCCCAAGAACAGGG + Intergenic
922171277 1:223157655-223157677 CCTGCTGCTCACCTGCTATATGG + Intergenic
922323717 1:224509894-224509916 CCAGCTGTCCACCTAGAAAAAGG + Intronic
922482390 1:225948013-225948035 CCAGGTGCTCCCATACAGCACGG + Intergenic
922541431 1:226423217-226423239 CCATCTGCTCACCTGTAAAATGG + Intergenic
922751779 1:228073476-228073498 CCAGCTACACACCTACACCCGGG - Intergenic
922823814 1:228503317-228503339 CCATCTCCTCACCTATAACATGG - Intergenic
924372024 1:243360959-243360981 GCATCTGCTGACCTACAACTGGG + Intronic
924372221 1:243362899-243362921 GCATCTGCTGACCTACAACTGGG + Intronic
1062979344 10:1708879-1708901 CCCTCTGCTCACATACAGCAAGG - Intronic
1065961616 10:30738473-30738495 CCAGTAACTCACCTACAACCTGG + Intergenic
1067205366 10:44207854-44207876 CTAGCTGCACACCTACGCCAAGG - Intergenic
1067683642 10:48455007-48455029 CCAGCTGCTCACCAAGGACGAGG - Exonic
1073272837 10:102280796-102280818 CCAGCTGCACTCCTGCCACATGG - Intronic
1076947245 10:133659758-133659780 CCAGCTGCACACCTGCAATGTGG + Intergenic
1077081477 11:726413-726435 CCAGCCGCTCACCTACGAGTCGG + Exonic
1080750974 11:35149932-35149954 TCATCTGCTCACCTTCCACATGG - Intronic
1084191593 11:67501850-67501872 CTGGGTGCTCACCTACATCATGG + Exonic
1085013573 11:73157988-73158010 CCAGCAGCTCACCTGGACCACGG - Intergenic
1086189131 11:84057268-84057290 CCAGCTGCTCAGCTAGAAGAAGG + Intronic
1088693219 11:112345402-112345424 TCAGCTGTTCACCCACATCAGGG - Intergenic
1091035333 11:132227987-132228009 CCAGATGCTCACCTGAAGCAGGG + Intronic
1092427006 12:8382867-8382889 CCAGCTGCTGGTCTACAAGATGG - Intergenic
1092733203 12:11553936-11553958 CCAGTTTCTCAGCCACAACAAGG - Intergenic
1102172528 12:110853073-110853095 CCAGCCTCCCACCTACAAAATGG - Intronic
1102678267 12:114673139-114673161 CCACCTGCCCACCTAGGACAGGG + Intronic
1104245131 12:127032321-127032343 CCAGCTGCTCCCTTTCAACAGGG + Intergenic
1104427200 12:128687574-128687596 CCAGGTGCACACCTGCCACAGGG - Intronic
1104730706 12:131103879-131103901 CCAGCTGCTCACGTGCAGGAGGG - Intronic
1105045730 12:133001753-133001775 TCAGCAGCTCACCTCAAACAGGG - Intronic
1108187755 13:47905375-47905397 CCACCTGCTCACCCAGAAGATGG + Intergenic
1112501595 13:99947264-99947286 CCACCTGCTCATCTAAAACGTGG + Intergenic
1112967695 13:105218341-105218363 CCATCTCCTCAACTACAAAATGG + Intergenic
1114680675 14:24481722-24481744 CCAGCTGGCCACCTGGAACATGG - Intergenic
1114946860 14:27693214-27693236 CCAGCTGGTCTCCTCCAGCAGGG - Intergenic
1117669919 14:58096216-58096238 CCAACTGCTCACCCACAAGCAGG + Intronic
1118324882 14:64773999-64774021 CCACCTGCACTCCTACATCATGG + Intronic
1118527410 14:66661617-66661639 ACAGCTGCTCTAATACAACATGG + Intronic
1121449778 14:93999757-93999779 CGAGCTGCTCATCTACAGAATGG + Intergenic
1121762858 14:96460645-96460667 CCAGCTACTCACCTCCACCTGGG + Intronic
1122713064 14:103674813-103674835 CCAGCTGCTCAAGTAGCACAAGG - Intronic
1124806307 15:32886865-32886887 CAAGCTCCTCAACTTCAACAAGG + Intronic
1125658895 15:41381076-41381098 CTAGCTGCTCACCTAAATCTTGG - Intergenic
1128451367 15:67807561-67807583 TCAGCTCCTCACCTGCAAAATGG - Intergenic
1129732947 15:77942209-77942231 CCAGCCCCTCACCTACAGCCTGG + Intergenic
1129949503 15:79573432-79573454 CTAGCTGCTGACCTACATCAGGG + Intergenic
1130557841 15:84935383-84935405 CCAGCAGCTCAGCTACCACTGGG - Exonic
1130634798 15:85607496-85607518 TCAGTTTCTCACCTACAAAATGG - Intronic
1131052924 15:89360005-89360027 CCAGCTGCTCCCCCACAGCCCGG - Intergenic
1131446222 15:92499904-92499926 CCAGCTGCTCTCCCAGAGCAAGG + Intronic
1133371252 16:5247498-5247520 CCAGCTGCTGGTCTACAAGATGG + Intergenic
1134098149 16:11433207-11433229 CCAACTCCTGACCTACAACAAGG + Intronic
1136984285 16:35084653-35084675 CCAGCTGCACATCTAGAACAAGG - Intergenic
1137712494 16:50576017-50576039 CCAGATGCTCCCCTACGGCAGGG - Intronic
1137894368 16:52195098-52195120 CCCACTGCTCCCCTTCAACAAGG + Intergenic
1139361524 16:66402734-66402756 GCAGCTGGTCACCTACGACGAGG + Exonic
1141172402 16:81699791-81699813 CCAGCTCCTTACCTCCACCATGG - Exonic
1142288078 16:89179564-89179586 CCACCTGCTCACCTGAACCAGGG - Exonic
1143271253 17:5676692-5676714 CCAGTTTCTCATCTACAAAATGG - Intergenic
1143691925 17:8575200-8575222 CATGCTACTCACATACAACAGGG + Intronic
1143746164 17:8995770-8995792 CCAGCTGGTCATCTACAACATGG - Intergenic
1144543518 17:16169669-16169691 CCAGTTTCTCAACTATAACATGG + Intronic
1145070060 17:19797359-19797381 CCAGTTCCTGACCTACAAAAGGG + Intronic
1145349349 17:22066658-22066680 CCAGTTTCTCAACTATAACATGG + Intergenic
1148443262 17:47722619-47722641 CCAGCTTCTCATCTGCAAAATGG + Intergenic
1149751473 17:59149722-59149744 CCAACTGCTAATATACAACATGG + Intronic
1151413882 17:73948941-73948963 ACAGCACCTCACCCACAACAGGG - Intergenic
1151717038 17:75836188-75836210 CCAGCCCCTCACCTGCACCATGG + Exonic
1151747119 17:76017723-76017745 CCCGCTGCTCACCCACCTCATGG + Exonic
1152577668 17:81149909-81149931 TCAGCTGCTCACCTTCCTCAGGG - Intronic
1203171150 17_GL000205v2_random:148757-148779 CCAGCTGCACACCTGCAATATGG + Intergenic
1155518788 18:26648839-26648861 CCATCTCCTCATCTAAAACATGG + Intronic
1157297279 18:46455499-46455521 CCAGCTACTCTCCTGCAGCAAGG - Intronic
1158090654 18:53709029-53709051 TCAGCTGTTCCCCTACTACATGG - Intergenic
1165169336 19:33880090-33880112 GCAGCTGTTCAGCTCCAACAGGG + Intergenic
1165471398 19:36006749-36006771 CCAGCTGGTCAGCTACAGCCTGG - Exonic
1165485069 19:36090510-36090532 CCAACTCCTCACCTTCAGCAAGG - Exonic
1165876015 19:39007400-39007422 CCACCTGCTCACCTGCCACCTGG - Intronic
925548556 2:5043799-5043821 CCCCCTGCGCCCCTACAACATGG + Intergenic
925603132 2:5629215-5629237 CAAGTTGCTCAGCTACAACCTGG + Intergenic
926006752 2:9378669-9378691 CCACATGCTCAGCAACAACAGGG + Intronic
927171713 2:20375644-20375666 ACAGCTCCTCACCCACAACCAGG - Intergenic
928235049 2:29531958-29531980 CCAGCTGCTGCCCCACAACGAGG - Exonic
930339222 2:50091348-50091370 CCAGCTGTCCACCTGCAACGTGG + Exonic
930380753 2:50624685-50624707 CCATCTGCTTAACTACACCAGGG - Intronic
932817290 2:74872152-74872174 TCATTTGCTCACCTACAAAAAGG - Intronic
934713440 2:96529929-96529951 CCAGCTGCCCACCTATGCCATGG - Intergenic
937472991 2:122189650-122189672 CCAGCTGCTCATCTGAAATATGG - Intergenic
938242584 2:129754862-129754884 TCAGTTCCTCACCTACAAAACGG + Intergenic
939455477 2:142429818-142429840 CTAGCTGCTGACCTACATCCAGG + Intergenic
941282418 2:163569715-163569737 CAAAGTGCTCACCTAAAACATGG + Intergenic
941471888 2:165898216-165898238 CCAGCTTCTCACCTAAAAAAGGG - Intronic
943378950 2:187119061-187119083 CCTGCTGCTCACCTCCAAAATGG - Intergenic
943514795 2:188871013-188871035 CCATCTGCTCATCTATAAAATGG - Intergenic
945415139 2:209561510-209561532 CGACCTGCTCACCTATAAAATGG + Intronic
948527636 2:238581525-238581547 CCAGGTACTCGCCCACAACAAGG - Intergenic
1171346989 20:24472922-24472944 AAAACTGCTCACCTACAAGATGG - Intronic
1171559251 20:26107665-26107687 CCAGTTTCTCAACTATAACATGG + Intergenic
1174283218 20:49454194-49454216 CCAGGTCCTCACCTACCCCAAGG - Intronic
1176140664 20:63543364-63543386 GGAGCTGCTCACCTACTACAAGG - Exonic
1176327134 21:5510587-5510609 CCAGCTGCACACCTGCAATATGG + Intergenic
1176400623 21:6310364-6310386 CCAGCTGCACACCTGCAATATGG - Intergenic
1176436534 21:6678740-6678762 CCAGCTGCACACCTGCAATATGG + Intergenic
1176460796 21:7005810-7005832 CCAGCTGCACACCTGCAATATGG + Intergenic
1176484357 21:7387588-7387610 CCAGCTGCACACCTGCAATATGG + Intergenic
1176616050 21:9028936-9028958 CCTGCTGCTCACCTACGGCCTGG + Intergenic
1176651700 21:9554413-9554435 CCAGTTTCTCAACTATAACATGG - Intergenic
1177466940 21:21496885-21496907 CAACCACCTCACCTACAACAAGG - Intronic
1183206638 22:36423890-36423912 CCAGCTGCTGACTTACGGCATGG + Intergenic
1184160411 22:42694150-42694172 CTGGCTGCTCACCTACGAAATGG + Intronic
1184254173 22:43277637-43277659 CCATTTGCTCACCTGCAAAATGG + Intronic
1184607670 22:45583380-45583402 ACAGCTGCTCACCTTAGACATGG + Intronic
1185199949 22:49495147-49495169 GCAGGTGCTCACCAGCAACAGGG + Intronic
949582421 3:5402020-5402042 CCATTTGCTCATCTACAAAATGG - Intergenic
950585588 3:13890141-13890163 CCAGAGGCTCACCCAGAACAAGG - Intergenic
954380927 3:50218609-50218631 GCTGCTGCACACCTACAGCAAGG + Exonic
954707315 3:52488000-52488022 CCAGCTGCTCACCTTCTACAAGG + Exonic
957080211 3:75630658-75630680 CCAGCTGCACACCTGCAATGTGG - Intergenic
961282432 3:125774523-125774545 CCAGCTGCTGGTCTACAAGATGG + Intergenic
961480642 3:127177589-127177611 CCAACTGGACACCTCCAACAGGG + Intergenic
961511553 3:127406850-127406872 TCCACTGCACACCTACAACAAGG + Intergenic
962904725 3:139791348-139791370 CCAGCTCCTCACCTAATCCATGG - Intergenic
964339953 3:155697878-155697900 ACCGCTGCTGACATACAACAGGG + Intronic
964837010 3:160950282-160950304 CCAGCTCTTCACCTACCAAAAGG - Intronic
966215021 3:177493094-177493116 ACAGATGCTCCCCTAAAACAAGG - Intergenic
968932468 4:3588504-3588526 CCAGGTGCTCACCTCCAAACAGG - Intronic
969015301 4:4099873-4099895 CCAGCTGCTGGTCTACAAGACGG - Intergenic
969697738 4:8744637-8744659 GCACCTGCTCACCAGCAACATGG + Intergenic
970104979 4:12571947-12571969 CAAGCTGCTCACCTGCATCTTGG + Intergenic
971286983 4:25300298-25300320 CCAACTCCTCACAGACAACATGG - Intergenic
971659955 4:29400691-29400713 CCACCTGTTTACCTATAACAAGG + Intergenic
975660171 4:76680718-76680740 GCAGTTTCTCACCTACAAAATGG - Intronic
976995469 4:91426963-91426985 CTAGCTCCTCACCTAGAAAATGG - Intronic
978229834 4:106385328-106385350 CCATCTCTTCACCCACAACATGG + Intergenic
978332613 4:107630811-107630833 CTAGATACTCACCTACAAAATGG + Intronic
978993143 4:115112333-115112355 CCACTTTCTCACCAACAACATGG - Intronic
979116328 4:116829326-116829348 CCAGCTGCTCTACCAGAACATGG + Intergenic
980401153 4:132287785-132287807 CCAGCTACTCACTTGCTACAAGG - Intergenic
982744074 4:159088078-159088100 CCAGCTGCTCAGGCAAAACAAGG - Intergenic
983471603 4:168162895-168162917 CCCAGTGCTGACCTACAACAAGG + Intronic
985450703 4:190060558-190060580 CCAGCTGCACACCTGCAATGTGG + Intergenic
990878840 5:60517889-60517911 CCCTCTTCTCACCTGCAACATGG - Intronic
991431239 5:66549692-66549714 CCATCTGGTCCTCTACAACATGG - Intergenic
1000108151 5:158080358-158080380 CCACCCCCTCACCTCCAACAGGG + Intergenic
1003291220 6:4780061-4780083 ACAGTTGATCACCTACAGCAGGG - Intronic
1003379302 6:5608719-5608741 CCATCAGTTCACCTACACCAAGG + Intronic
1005885847 6:30097127-30097149 CCAGCTTCTCCCACACAACATGG - Intergenic
1006034299 6:31199576-31199598 TCAGCTTCTCACCTCCAAAATGG + Intronic
1007037285 6:38687765-38687787 TCAGCTTCTCATCTACAACATGG - Intronic
1008498683 6:52158010-52158032 CCAGCTCATCATCTTCAACATGG - Intergenic
1011309855 6:85969779-85969801 CCAGCTGCTCAGTTAGACCAGGG + Intergenic
1011389836 6:86839461-86839483 CCAGATGGTCAGCTACAACATGG + Intergenic
1013401079 6:109796817-109796839 CCATCTGAGCACCTAGAACAGGG - Exonic
1014219848 6:118788886-118788908 CCACCTGCTCACAGACCACAGGG - Intergenic
1017284359 6:152657587-152657609 TCAGCTGCTCACTTTCAACTGGG + Intergenic
1017750144 6:157483729-157483751 CCATGTGCACACATACAACATGG - Intronic
1018370305 6:163162198-163162220 GCAGGTGCTGACCTACAAAAAGG + Intronic
1019126744 6:169845809-169845831 TCAGCTTCTCACCTGCAACCGGG + Intergenic
1019375660 7:690706-690728 CCAGCTGCACACCCAGAAGACGG + Intronic
1019659436 7:2215782-2215804 CCAGCTGCTCACCTACAACATGG - Intronic
1020711215 7:11607907-11607929 TCAGCTGCTGACCAGCAACATGG - Intronic
1023396600 7:39757529-39757551 CGAGCTGCTCACAGACACCAAGG + Intergenic
1025223522 7:57136668-57136690 CCAGCTACTGAGCTACAGCATGG - Intronic
1026892897 7:73992701-73992723 CCAGCCACACACCCACAACAGGG - Intergenic
1027596708 7:80183523-80183545 CAGGCTGTTCAGCTACAACATGG - Intronic
1029073968 7:97921533-97921555 CCAGCTGCTGGTCTACAAGATGG - Intergenic
1029170223 7:98625145-98625167 CGAGCTGCTCATCAACGACAAGG + Exonic
1034694386 7:153041196-153041218 CCAGCTGTTCACCTTCACCTTGG + Intergenic
1035738506 8:1907337-1907359 CCAGCTCCTCACCTGCAAGTTGG + Intronic
1036243738 8:7099762-7099784 CCAGCTGCTGGTCTACAAGACGG + Intergenic
1036257064 8:7214295-7214317 CCAGCTGCTGGTCTACAAGATGG - Intergenic
1036309114 8:7672894-7672916 CCAGCTGCTGGTCTACAAGATGG - Intergenic
1036360421 8:8073225-8073247 CCAGCTGCTGGTCTACAAGATGG + Intergenic
1036898105 8:12651662-12651684 CCAGCTGCTGGTCTACAAGACGG - Intergenic
1037456878 8:19072625-19072647 CCAGCTGCTCAAATGCAACCAGG + Intronic
1037696756 8:21230328-21230350 CCACCTCCTCACCTCCAAGATGG + Intergenic
1039983072 8:42425506-42425528 CCATCTGCTCTCCAACTACACGG + Intronic
1041809381 8:61890434-61890456 ACAGCTGCTCTCCTGCAAAATGG - Intergenic
1045376051 8:101575160-101575182 CCAGATGCTCATATACAAGAGGG - Intronic
1046478597 8:114782992-114783014 CCACATTCTCACCTACAAAATGG + Intergenic
1050611120 9:7354886-7354908 GCAATTGCTCAGCTACAACATGG - Intergenic
1054457658 9:65443392-65443414 CCAGGTGCTCACCTCCAAACAGG + Intergenic
1057567336 9:96177280-96177302 GCAGCTGCTCGCCTAAGACAGGG + Intergenic
1057821165 9:98332153-98332175 CCAGGTGCTCCCCTGCAAAATGG + Intronic
1058454895 9:105129863-105129885 CTAGCTACTAACCTGCAACATGG - Intergenic
1059057611 9:111000496-111000518 CCAGCTGCTCACTTGCACAAAGG + Intronic
1060282217 9:122222220-122222242 GCAGCTGCTGCCCTACAATAGGG - Intronic
1060343955 9:122800710-122800732 CCAGCTGCTCATCTTCACCGAGG + Exonic
1062246046 9:135566687-135566709 CCTGCTGCACACCTGCACCACGG + Exonic
1062312719 9:135947830-135947852 CAACCTGCCCTCCTACAACATGG - Exonic
1203434979 Un_GL000195v1:129919-129941 CCAGCTGCACACCTGCAATATGG - Intergenic
1203629431 Un_KI270750v1:57968-57990 CCAGTTTCTCAACTATAACATGG - Intergenic
1186478383 X:9877163-9877185 CCAGCTTCTCAACGACCACAAGG - Intronic
1188237753 X:27750698-27750720 CCAGCTGCTGCCCCACACCAAGG - Intergenic
1189327284 X:40120531-40120553 ACAGCTTCTCACCTACGCCATGG + Intronic
1190260820 X:48795766-48795788 ACAGCTGCTTACCTATAATATGG - Intergenic
1193266619 X:79479284-79479306 AAAGCTGCACACCTACAGCAAGG - Intergenic
1195104751 X:101593366-101593388 ACAGCTGCTCAACAAAAACATGG - Intergenic
1196988070 X:121296516-121296538 CCTCCTGCTCACCTCCAAGATGG - Intergenic
1197830471 X:130637164-130637186 TCAGCTTCTCACCTATAAAAGGG - Intronic
1199478614 X:148273613-148273635 ACAGCTGCTCTACCACAACATGG + Intergenic