ID: 1019659440

View in Genome Browser
Species Human (GRCh38)
Location 7:2215805-2215827
Sequence TGGGCGTGACCACAATACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 17}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019659435_1019659440 3 Left 1019659435 7:2215779-2215801 CCTCCATGTTGTAGGTGAGCAGC 0: 1
1: 0
2: 0
3: 24
4: 168
Right 1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 17
1019659429_1019659440 21 Left 1019659429 7:2215761-2215783 CCCACCCCATCACAGCAACCTCC 0: 1
1: 0
2: 5
3: 51
4: 449
Right 1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 17
1019659431_1019659440 17 Left 1019659431 7:2215765-2215787 CCCCATCACAGCAACCTCCATGT 0: 1
1: 2
2: 1
3: 25
4: 349
Right 1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 17
1019659428_1019659440 24 Left 1019659428 7:2215758-2215780 CCTCCCACCCCATCACAGCAACC 0: 1
1: 1
2: 9
3: 114
4: 2641
Right 1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 17
1019659433_1019659440 15 Left 1019659433 7:2215767-2215789 CCATCACAGCAACCTCCATGTTG 0: 1
1: 0
2: 3
3: 24
4: 271
Right 1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 17
1019659430_1019659440 20 Left 1019659430 7:2215762-2215784 CCACCCCATCACAGCAACCTCCA 0: 1
1: 0
2: 3
3: 64
4: 509
Right 1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 17
1019659436_1019659440 0 Left 1019659436 7:2215782-2215804 CCATGTTGTAGGTGAGCAGCTGG 0: 1
1: 0
2: 2
3: 21
4: 191
Right 1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 17
1019659432_1019659440 16 Left 1019659432 7:2215766-2215788 CCCATCACAGCAACCTCCATGTT 0: 1
1: 0
2: 0
3: 28
4: 373
Right 1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019659440 Original CRISPR TGGGCGTGACCACAATACCG AGG Intronic