ID: 1019660258

View in Genome Browser
Species Human (GRCh38)
Location 7:2220068-2220090
Sequence CCACCCCAATGCTACCATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019660246_1019660258 27 Left 1019660246 7:2220018-2220040 CCATCACTTCGGTCTTCCCTCCA 0: 1
1: 0
2: 0
3: 24
4: 346
Right 1019660258 7:2220068-2220090 CCACCCCAATGCTACCATGACGG No data
1019660252_1019660258 -5 Left 1019660252 7:2220050-2220072 CCTGTCATCCCTCCCTAGCCACC 0: 1
1: 0
2: 1
3: 23
4: 320
Right 1019660258 7:2220068-2220090 CCACCCCAATGCTACCATGACGG No data
1019660251_1019660258 3 Left 1019660251 7:2220042-2220064 CCGTGGCTCCTGTCATCCCTCCC 0: 1
1: 0
2: 2
3: 76
4: 850
Right 1019660258 7:2220068-2220090 CCACCCCAATGCTACCATGACGG No data
1019660248_1019660258 11 Left 1019660248 7:2220034-2220056 CCCTCCAACCGTGGCTCCTGTCA 0: 1
1: 0
2: 0
3: 12
4: 120
Right 1019660258 7:2220068-2220090 CCACCCCAATGCTACCATGACGG No data
1019660250_1019660258 7 Left 1019660250 7:2220038-2220060 CCAACCGTGGCTCCTGTCATCCC 0: 1
1: 0
2: 0
3: 21
4: 173
Right 1019660258 7:2220068-2220090 CCACCCCAATGCTACCATGACGG No data
1019660249_1019660258 10 Left 1019660249 7:2220035-2220057 CCTCCAACCGTGGCTCCTGTCAT 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1019660258 7:2220068-2220090 CCACCCCAATGCTACCATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019660258 Original CRISPR CCACCCCAATGCTACCATGA CGG Intronic
No off target data available for this crispr