ID: 1019662497

View in Genome Browser
Species Human (GRCh38)
Location 7:2232634-2232656
Sequence CTCCCCCTTTGGGCTGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 219}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019662497_1019662508 -5 Left 1019662497 7:2232634-2232656 CCCAGCACAGCCCAAAGGGGGAG 0: 1
1: 0
2: 2
3: 18
4: 219
Right 1019662508 7:2232652-2232674 GGGAGTGGGGACAGGGGAGTGGG 0: 1
1: 1
2: 34
3: 552
4: 1959
1019662497_1019662513 6 Left 1019662497 7:2232634-2232656 CCCAGCACAGCCCAAAGGGGGAG 0: 1
1: 0
2: 2
3: 18
4: 219
Right 1019662513 7:2232663-2232685 CAGGGGAGTGGGGAGAGGAGGGG 0: 1
1: 2
2: 38
3: 534
4: 3279
1019662497_1019662512 5 Left 1019662497 7:2232634-2232656 CCCAGCACAGCCCAAAGGGGGAG 0: 1
1: 0
2: 2
3: 18
4: 219
Right 1019662512 7:2232662-2232684 ACAGGGGAGTGGGGAGAGGAGGG 0: 1
1: 3
2: 21
3: 264
4: 1989
1019662497_1019662511 4 Left 1019662497 7:2232634-2232656 CCCAGCACAGCCCAAAGGGGGAG 0: 1
1: 0
2: 2
3: 18
4: 219
Right 1019662511 7:2232661-2232683 GACAGGGGAGTGGGGAGAGGAGG 0: 1
1: 3
2: 40
3: 282
4: 2108
1019662497_1019662507 -6 Left 1019662497 7:2232634-2232656 CCCAGCACAGCCCAAAGGGGGAG 0: 1
1: 0
2: 2
3: 18
4: 219
Right 1019662507 7:2232651-2232673 GGGGAGTGGGGACAGGGGAGTGG 0: 1
1: 4
2: 303
3: 817
4: 4535
1019662497_1019662514 20 Left 1019662497 7:2232634-2232656 CCCAGCACAGCCCAAAGGGGGAG 0: 1
1: 0
2: 2
3: 18
4: 219
Right 1019662514 7:2232677-2232699 GAGGAGGGGAGAGCACAGAGAGG 0: 1
1: 0
2: 20
3: 626
4: 1901
1019662497_1019662509 -4 Left 1019662497 7:2232634-2232656 CCCAGCACAGCCCAAAGGGGGAG 0: 1
1: 0
2: 2
3: 18
4: 219
Right 1019662509 7:2232653-2232675 GGAGTGGGGACAGGGGAGTGGGG 0: 1
1: 1
2: 35
3: 476
4: 2036
1019662497_1019662510 1 Left 1019662497 7:2232634-2232656 CCCAGCACAGCCCAAAGGGGGAG 0: 1
1: 0
2: 2
3: 18
4: 219
Right 1019662510 7:2232658-2232680 GGGGACAGGGGAGTGGGGAGAGG 0: 1
1: 7
2: 310
3: 818
4: 3766

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019662497 Original CRISPR CTCCCCCTTTGGGCTGTGCT GGG (reversed) Intronic