ID: 1019664778

View in Genome Browser
Species Human (GRCh38)
Location 7:2246366-2246388
Sequence AGGCCCTCAGAGCATTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 171}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019664778_1019664781 -10 Left 1019664778 7:2246366-2246388 CCAGGAAAATGCTCTGAGGGCCT 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1019664781 7:2246379-2246401 CTGAGGGCCTGACGTTGGCTGGG 0: 1
1: 0
2: 1
3: 25
4: 166
1019664778_1019664786 7 Left 1019664778 7:2246366-2246388 CCAGGAAAATGCTCTGAGGGCCT 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1019664786 7:2246396-2246418 GCTGGGAGAGTGTGGAAGGAGGG 0: 1
1: 0
2: 7
3: 90
4: 831
1019664778_1019664785 6 Left 1019664778 7:2246366-2246388 CCAGGAAAATGCTCTGAGGGCCT 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1019664785 7:2246395-2246417 GGCTGGGAGAGTGTGGAAGGAGG No data
1019664778_1019664788 14 Left 1019664778 7:2246366-2246388 CCAGGAAAATGCTCTGAGGGCCT 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1019664788 7:2246403-2246425 GAGTGTGGAAGGAGGGAGGAAGG 0: 1
1: 7
2: 209
3: 1626
4: 5490
1019664778_1019664787 10 Left 1019664778 7:2246366-2246388 CCAGGAAAATGCTCTGAGGGCCT 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1019664787 7:2246399-2246421 GGGAGAGTGTGGAAGGAGGGAGG No data
1019664778_1019664783 -1 Left 1019664778 7:2246366-2246388 CCAGGAAAATGCTCTGAGGGCCT 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1019664783 7:2246388-2246410 TGACGTTGGCTGGGAGAGTGTGG 0: 1
1: 0
2: 0
3: 21
4: 228
1019664778_1019664784 3 Left 1019664778 7:2246366-2246388 CCAGGAAAATGCTCTGAGGGCCT 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1019664784 7:2246392-2246414 GTTGGCTGGGAGAGTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019664778 Original CRISPR AGGCCCTCAGAGCATTTTCC TGG (reversed) Intronic
900346937 1:2214569-2214591 AGGCCCCCAGAGCTTCTCCCGGG - Intergenic
901215315 1:7551691-7551713 TGGCCCTCAGAGCCTGTCCCTGG + Intronic
902138206 1:14329263-14329285 AAGCCAACAGAACATTTTCCTGG - Intergenic
902191965 1:14770042-14770064 AGGACCTCAGAGAATAGTCCAGG + Intronic
903588701 1:24438028-24438050 AGGCCCCCAGAGCATGTTAGAGG - Intronic
903722068 1:25413112-25413134 AGGCCCTGAGCGCATATACCTGG - Intronic
906529590 1:46515887-46515909 ACTCCCTCAGAGCATGGTCCAGG + Intergenic
907328242 1:53654693-53654715 GGACCCTCAGTGCATTTGCCAGG - Intronic
908776633 1:67647147-67647169 ATGCCCTCATAGAAATTTCCTGG - Intergenic
912452037 1:109773241-109773263 AGGCCCTCAGAGAAAATGCCGGG + Intronic
912526786 1:110289537-110289559 AGGCCCTCACAGCACTTGCCTGG - Intergenic
913113876 1:115679413-115679435 AGCCCCTCAGAGCAAAGTCCTGG - Intronic
914312426 1:146478530-146478552 AGTACCTCTGTGCATTTTCCAGG + Intergenic
914501924 1:148254806-148254828 AGTACCTCCGTGCATTTTCCAGG - Intergenic
916033041 1:160895051-160895073 AGGCCTCCAGTCCATTTTCCAGG + Intergenic
918202473 1:182280069-182280091 AGGCACACAGAGCATTCTCCTGG + Intergenic
921701378 1:218272379-218272401 AGGGGCTCATTGCATTTTCCTGG + Intergenic
924389927 1:243543260-243543282 GGGCTCTCAGAGCTTTCTCCAGG + Intronic
924690285 1:246342730-246342752 ATGCCCTAAGACCATTTTCATGG - Intronic
1067810800 10:49425847-49425869 AGGGCCCCAGAGCTTTCTCCCGG - Intergenic
1069824705 10:71247890-71247912 AGGCCTTGAGAGGGTTTTCCAGG - Intronic
1070986788 10:80696356-80696378 AGGCCCTCAGAGCACTAAGCAGG - Intergenic
1071182079 10:82997962-82997984 AGGCACTCATAGCTTTCTCCAGG + Intergenic
1076319068 10:129564835-129564857 AGGCCCTCAGGCCAGTTCCCGGG + Intronic
1079193833 11:18306264-18306286 TGGCCCCCAGAACATCTTCCAGG + Exonic
1079892182 11:26069852-26069874 GGGCCCTTAGATCATTTTACAGG + Intergenic
1080228249 11:29985343-29985365 AGCCCCTTAGAGCATCTTCATGG - Intergenic
1082061882 11:47867944-47867966 AGGCCCCCATAGCATTTCCTCGG + Intergenic
1082768662 11:57188362-57188384 TGGCCCACAGTGCACTTTCCTGG - Exonic
1083541594 11:63515422-63515444 AGGCCCTCAGTGCTTGTTTCTGG + Intronic
1089771966 11:120809364-120809386 CGGCCCTCTGAGCAGTTTGCAGG - Intronic
1089908543 11:122071789-122071811 AGGCCCACAGAGCAACTTCCGGG + Intergenic
1091772727 12:3163614-3163636 TGCCACTCAGAGGATTTTCCTGG + Intronic
1095817421 12:46440036-46440058 TGGCCCTTAAAGCATTTGCCTGG - Intergenic
1096738911 12:53677349-53677371 AAGCCCACGGAGCAATTTCCCGG + Intronic
1099496467 12:83353037-83353059 AGGGCCTCAGAGTGTTTTTCAGG + Intergenic
1102466690 12:113134609-113134631 AGGCCCTCAGAGCCCCTTCTGGG + Intronic
1102503985 12:113372440-113372462 AGGCTCTCAGGGCAACTTCCAGG + Intronic
1102774139 12:115504376-115504398 AGGCCTTCAGAGCAGCTTCTCGG + Intergenic
1108723528 13:53156923-53156945 GGGCCCTGAGCGTATTTTCCTGG - Intergenic
1109082659 13:57925510-57925532 AGGACCTAAGAGCCTTTTACAGG - Intergenic
1111093868 13:83483754-83483776 AGTCCCTCATAGAATTTGCCTGG + Intergenic
1114019969 14:18469361-18469383 AGACCCTCGGAGCCTTTTTCTGG + Intergenic
1115378585 14:32706848-32706870 AGGCCATAAGAGCATTAGCCTGG - Intronic
1121042060 14:90757803-90757825 AAGCCCAAAGAGGATTTTCCTGG - Intronic
1202838198 14_GL000009v2_random:94527-94549 AGACCCTCATAGCAGTTTTCTGG - Intergenic
1202888401 14_KI270722v1_random:131158-131180 AGGTCCTCTGAGCATCATCCAGG - Intergenic
1123948521 15:25250443-25250465 AGGCCCTGAGAGCACCTTCACGG - Intergenic
1125520145 15:40343916-40343938 AGGCCCGCAGAGCACTTGCTGGG + Intergenic
1128615373 15:69104792-69104814 AGGCTTTCAAGGCATTTTCCAGG + Intergenic
1128639752 15:69327621-69327643 AGGACCTAAAAGCATCTTCCTGG - Intronic
1130934019 15:88453757-88453779 AGCCCCACAGAGCTTCTTCCAGG + Intergenic
1131525188 15:93146930-93146952 TGGCCCTCAGACCCTTATCCTGG + Intergenic
1137655598 16:50154956-50154978 AGGCCCTGATAGAACTTTCCAGG + Intronic
1140268233 16:73439122-73439144 AGACCCTCAGAGAGTTTTCCAGG - Intergenic
1142212603 16:88815650-88815672 TGGCCCTGAGGGCACTTTCCGGG + Intronic
1145796297 17:27657276-27657298 AGGCCCTGTGTGCATTTTACAGG - Intergenic
1146675682 17:34772338-34772360 ACTCCCTCAGAGCATTTCCTGGG + Intergenic
1147310225 17:39591665-39591687 AGACCCTTAGAGCAGTTGCCTGG + Intergenic
1148131492 17:45265004-45265026 AGGACCTCAAAGCATTTCCCAGG - Intronic
1149441077 17:56674468-56674490 AGGTCCTCAGGCCATTTTCTGGG - Intergenic
1149691886 17:58584101-58584123 TGGCCCTTAGAGGATATTCCAGG + Intronic
1152535338 17:80947608-80947630 AGGCTGTCAGAGGCTTTTCCTGG - Intronic
1152648073 17:81479360-81479382 GGGCCCTCAGATCATTCTCCAGG - Intergenic
1203156817 17_GL000205v2_random:12018-12040 AGACCCTCAGAGCAGTGTTCTGG + Intergenic
1203156869 17_GL000205v2_random:12498-12520 AGACCCTCGGAGCATTGTTCTGG + Intergenic
1154522597 18:15245966-15245988 AGACCCTCATAGCATTGTTCCGG - Intergenic
1156359927 18:36376107-36376129 TGGCCCTCTGAACATTTTTCTGG - Intronic
1156362878 18:36399798-36399820 GGGAGCTCAGAGCATCTTCCTGG - Intronic
1157522288 18:48353640-48353662 AGGCCCTGAGAACCTTTTTCTGG - Intronic
1161076005 19:2286095-2286117 AGGCACTCAGAGCATTGCACAGG + Intronic
1161770822 19:6229921-6229943 AGGGCCACAGAGCCTTTGCCTGG - Intronic
1161801886 19:6420957-6420979 AGGCCCTCCTAGCCTCTTCCAGG + Intronic
1163577565 19:18119617-18119639 AGGCCCTGTGAGCATTGTCTAGG + Intronic
1164222109 19:23204057-23204079 AGGCCAACAGAGCATTTCCTGGG - Intergenic
1164329996 19:24245094-24245116 AGGCCCTCAAACTTTTTTCCAGG - Intergenic
1165456158 19:35911986-35912008 AGGCCCTCAGCTCAGCTTCCAGG - Intergenic
1165501772 19:36195078-36195100 AGTCCCTCTGAGCAGGTTCCAGG + Exonic
1166048626 19:40244729-40244751 AGCCCTTCACAGCATCTTCCAGG + Intronic
1167741171 19:51325754-51325776 ACGCGCTCACAGCATTCTCCTGG + Intronic
1168450393 19:56462145-56462167 AGGCTCGCTGAGCAGTTTCCTGG + Intronic
925576469 2:5365962-5365984 AGGCCACCAGAGCTTTCTCCAGG - Intergenic
926370692 2:12176007-12176029 AGGCACACAGCCCATTTTCCAGG + Intergenic
926881089 2:17543891-17543913 AGGCACTCAGAGAATTTTTATGG - Intronic
927019652 2:19003280-19003302 AGGACCTCAGAGAACTTTGCAGG - Intergenic
928400107 2:30971659-30971681 AGCATCTCAGAGCACTTTCCTGG - Intronic
930587878 2:53291224-53291246 GGGCACTCAGATCATTCTCCAGG - Intergenic
937375628 2:121333956-121333978 AGGCCCACTGAGCAGTTGCCCGG + Intergenic
938521399 2:132074016-132074038 AGGTCCTCATAGCAGTTTTCTGG - Intergenic
938822881 2:134976655-134976677 TGGCCACCAGATCATTTTCCAGG + Intronic
940109732 2:150138302-150138324 AGGCCTTAAGGGCATTTTACAGG + Intergenic
947025348 2:225731866-225731888 TTGCCCTCAGAGCATTTTGCTGG + Intergenic
1169131076 20:3166664-3166686 AGACCCTCACAGCCTTTTTCTGG - Intronic
1170890816 20:20373844-20373866 AGACCCTCAGGGCATCTGCCAGG - Intergenic
1174446395 20:50593971-50593993 CGGCCGCCAGAGCATTTTTCTGG - Intronic
1174713466 20:52731417-52731439 GGGCCCTCAGGGCATTTCCCAGG + Intergenic
1175912251 20:62410544-62410566 GGGGCCGCAGAGCATTTCCCAGG + Exonic
1177253395 21:18626564-18626586 AGGCCCTCAGTGAATATTTCTGG - Intergenic
1180330521 22:11474834-11474856 AGGTCCTCTGAGCATCATCCAGG - Intergenic
1180444476 22:15400186-15400208 AGACCCTCGGAGCCTTTTTCTGG + Intergenic
1184141982 22:42583060-42583082 AGGCTCCCAGAGAATGTTCCAGG + Intergenic
1184406731 22:44304724-44304746 ACTCCCACAGCGCATTTTCCAGG - Intronic
949895498 3:8765044-8765066 TGGTCCTCTGAGGATTTTCCTGG - Intronic
950449711 3:13058828-13058850 TGGGACACAGAGCATTTTCCTGG + Intronic
951736880 3:25875903-25875925 AGGCCCTCACAGCTTTTTTAGGG + Intergenic
953261769 3:41346240-41346262 AGCCCCACAGATCATTTGCCAGG - Intronic
953617118 3:44501255-44501277 TGGCCCTCAGAGCACTGGCCCGG + Intronic
955434146 3:58883201-58883223 TGGCCCTGAGAGCAATTGCCAGG - Intronic
956287425 3:67625701-67625723 AAGGCCTCAGTTCATTTTCCCGG - Intronic
961905604 3:130260003-130260025 AGGGCCTCAAAGCCTTTTTCTGG + Intergenic
964429766 3:156592816-156592838 AGTGCCTCAGAGCCCTTTCCAGG - Intergenic
967340027 3:188386800-188386822 AGCCCATCAAAGCATTTTGCAGG + Intronic
967825743 3:193876038-193876060 AGGCCACCAGACAATTTTCCAGG + Intergenic
968578754 4:1380008-1380030 AGGCCCTCATAGCATCTGCAGGG - Intronic
968968572 4:3781783-3781805 AGGCCCTGAAAGCTTCTTCCAGG + Intergenic
973946274 4:55959393-55959415 AGTACCTCAAAGAATTTTCCTGG + Intronic
975789850 4:77937418-77937440 TGGCCCCCAGTGCCTTTTCCAGG + Intronic
977897956 4:102385047-102385069 GGGCCCTCAGAGCAGTTGGCTGG + Intronic
983514974 4:168646130-168646152 AGGCCATCACAGCCTCTTCCTGG + Intronic
989601768 5:43206777-43206799 AGGCCTCCAGTCCATTTTCCAGG + Intronic
992124462 5:73626319-73626341 AGTCCCAAAGAGCATTTACCTGG - Exonic
992364585 5:76078737-76078759 AGGCCTCCAGTCCATTTTCCAGG + Intergenic
993393286 5:87349240-87349262 AGGCCCTCAGATAATACTCCTGG + Exonic
994135660 5:96283441-96283463 AGGAACTCAGATCACTTTCCTGG + Intergenic
997588496 5:135058730-135058752 AGGCCCTCACAGCCTCTTGCTGG + Intronic
998281538 5:140813070-140813092 GCACACTCAGAGCATTTTCCAGG - Intronic
1000374166 5:160563996-160564018 TGGCCCTCTGACCATCTTCCTGG - Exonic
1001312352 5:170620276-170620298 AGCCCATCAGAGCCTATTCCTGG - Intronic
1002828021 6:791432-791454 AGCCCCCAAGAGCATTTTGCAGG - Intergenic
1009969251 6:70609241-70609263 AGGCCTCCAGTCCATTTTCCAGG - Intergenic
1012553908 6:100489602-100489624 AAGCCCTCAGAGCAGGTGCCAGG - Intergenic
1012674262 6:102095162-102095184 ATGCCCTCAGATCATTTTGTGGG + Intergenic
1013179877 6:107708661-107708683 GGGCTGTCAGAGCATTTGCCCGG + Intronic
1013916076 6:115338597-115338619 AGGCCCTGACAGCATTTTTCTGG - Intergenic
1014605471 6:123468814-123468836 AGACCCTCATTGGATTTTCCTGG + Intronic
1015896935 6:138026553-138026575 AGGCCCTCACAGCTCTTGCCAGG + Intergenic
1018801737 6:167227957-167227979 AGGCCTGCTGAGCATTTTTCAGG - Intergenic
1018816666 6:167337459-167337481 AGGCCCTAAAAGCCTATTCCAGG + Intronic
1019189723 6:170244842-170244864 TGGGCCTCAGAGCATCTTCCAGG - Intergenic
1019481407 7:1268570-1268592 AGGCCCTCAGAACACCCTCCTGG + Intergenic
1019664778 7:2246366-2246388 AGGCCCTCAGAGCATTTTCCTGG - Intronic
1020817318 7:12921990-12922012 ACACCCTGAGACCATTTTCCAGG + Intergenic
1026775240 7:73227126-73227148 AGCCCGCAAGAGCATTTTCCAGG + Intergenic
1027016097 7:74780497-74780519 AGCCCGCAAGAGCATTTTCCAGG + Intronic
1027071931 7:75165440-75165462 AGCCCGCAAGAGCATTTTCCAGG - Intergenic
1027591640 7:80126250-80126272 AGGCTGGCAGAGCACTTTCCAGG - Intergenic
1029193984 7:98791511-98791533 AGGGCCTCTGAGGATGTTCCAGG - Intergenic
1030080723 7:105775510-105775532 AGGCCCTCGGAGTATTCTCAAGG - Intronic
1032020439 7:128404844-128404866 TGGGCCTCATAGCATTTTCTAGG + Intronic
1032407968 7:131671185-131671207 AGGCCTGCAGAGAATGTTCCAGG + Intergenic
1035109510 7:156469542-156469564 AGGCCCTCTGACCTTTTTGCAGG - Intergenic
1035786708 8:2266784-2266806 AGGCCCGCAGAGGATTTTCGTGG - Intergenic
1035806099 8:2454932-2454954 AGGCCCGCAGAGGATTTTCGTGG + Intergenic
1036235641 8:7037118-7037140 AGGTCCTCAGAGTATGTACCGGG - Intergenic
1036256749 8:7212447-7212469 TGTCCCTCAGAACATCTTCCTGG - Intergenic
1036308799 8:7671049-7671071 TGTCCCTCAGAACATCTTCCTGG - Intergenic
1036360742 8:8075062-8075084 TGTCCCTCAGAACATCTTCCTGG + Intergenic
1036808787 8:11853218-11853240 TGGCCCACAGAACATTGTCCTGG - Intronic
1036890226 8:12591910-12591932 GGTCCCTCAGAACATCTTCCTGG - Intergenic
1037796435 8:21999242-21999264 AGGTCTGCAGAGCATTGTCCAGG - Exonic
1038780606 8:30566035-30566057 AAGTCCTCAGTGCGTTTTCCTGG + Intronic
1040431819 8:47350217-47350239 AGCTGCTCAGAGCATTTTCTTGG - Intronic
1041379498 8:57239072-57239094 AGGGCCTCAGAGAAGCTTCCAGG + Intergenic
1043045708 8:75321408-75321430 AGGCCCTCAGATCATACTCAAGG + Intergenic
1045816636 8:106284170-106284192 TGGCCTTCAGAGCACCTTCCAGG - Intronic
1047468250 8:125140853-125140875 AGGCCACAAGAGCATTTCCCAGG - Intronic
1050506996 9:6358742-6358764 AGGCCCTAGGAGCATTTTTGAGG - Intergenic
1052333284 9:27293539-27293561 AGGCCCCCAGAGGATTGTCAGGG - Intronic
1052642646 9:31189168-31189190 AAGTCCTCCGAGCTTTTTCCAGG + Intergenic
1056752685 9:89363548-89363570 AGGCCCACAGAGCTTTGACCTGG - Intronic
1058228985 9:102402766-102402788 AGGCACTTTGATCATTTTCCTGG + Intergenic
1061729722 9:132604403-132604425 AGGCCATGAGAGCATGTTCTTGG + Intronic
1062193132 9:135257804-135257826 AGGCCCTCAGAGTACCTCCCAGG + Intergenic
1062607797 9:137355823-137355845 GGGGCCTCAGTGCATCTTCCCGG + Intronic
1203493831 Un_GL000224v1:132096-132118 AGACCCTCTTAGCATTTTTCTGG - Intergenic
1203506451 Un_KI270741v1:73971-73993 AGACCCTCTTAGCATTTTTCTGG - Intergenic
1187105662 X:16238909-16238931 TGGGCCTCAGAGAATTTTACAGG - Intergenic
1187679700 X:21754841-21754863 ACGTCCTCAGAGCATCTCCCAGG - Intronic
1187701352 X:21967218-21967240 AGGCCTCCAGTCCATTTTCCAGG + Exonic
1190287375 X:48970476-48970498 AGTCCCTCAGAACATTGCCCAGG - Exonic
1190434572 X:50410755-50410777 AGTGCCTCAGAGAATTTCCCTGG + Intronic
1191865605 X:65701289-65701311 AGACCCTCAGACCATTGTCCAGG - Intronic
1194668035 X:96697149-96697171 AGGCACTGACAGCATTTTACTGG - Intronic
1197161251 X:123324900-123324922 ATGCCCTTTGAGCATATTCCAGG - Intronic
1202047507 Y:20749559-20749581 TGAGCCTCAGAGCATCTTCCTGG - Intergenic