ID: 1019664782

View in Genome Browser
Species Human (GRCh38)
Location 7:2246386-2246408
Sequence ACACTCTCCCAGCCAACGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 85}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019664782_1019664791 22 Left 1019664782 7:2246386-2246408 CCTGACGTTGGCTGGGAGAGTGT 0: 1
1: 0
2: 0
3: 13
4: 85
Right 1019664791 7:2246431-2246453 TTTGCAGAAGCACAGAGGGCTGG No data
1019664782_1019664787 -10 Left 1019664782 7:2246386-2246408 CCTGACGTTGGCTGGGAGAGTGT 0: 1
1: 0
2: 0
3: 13
4: 85
Right 1019664787 7:2246399-2246421 GGGAGAGTGTGGAAGGAGGGAGG No data
1019664782_1019664788 -6 Left 1019664782 7:2246386-2246408 CCTGACGTTGGCTGGGAGAGTGT 0: 1
1: 0
2: 0
3: 13
4: 85
Right 1019664788 7:2246403-2246425 GAGTGTGGAAGGAGGGAGGAAGG 0: 1
1: 7
2: 209
3: 1626
4: 5490
1019664782_1019664790 18 Left 1019664782 7:2246386-2246408 CCTGACGTTGGCTGGGAGAGTGT 0: 1
1: 0
2: 0
3: 13
4: 85
Right 1019664790 7:2246427-2246449 GACATTTGCAGAAGCACAGAGGG 0: 1
1: 0
2: 6
3: 68
4: 631
1019664782_1019664789 17 Left 1019664782 7:2246386-2246408 CCTGACGTTGGCTGGGAGAGTGT 0: 1
1: 0
2: 0
3: 13
4: 85
Right 1019664789 7:2246426-2246448 AGACATTTGCAGAAGCACAGAGG No data
1019664782_1019664792 25 Left 1019664782 7:2246386-2246408 CCTGACGTTGGCTGGGAGAGTGT 0: 1
1: 0
2: 0
3: 13
4: 85
Right 1019664792 7:2246434-2246456 GCAGAAGCACAGAGGGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019664782 Original CRISPR ACACTCTCCCAGCCAACGTC AGG (reversed) Intronic
901898123 1:12332609-12332631 ACCCTCTCCCACCCAACTCCAGG - Intronic
902175611 1:14647984-14648006 CAACTATCCCAGCCAAGGTCAGG + Intronic
910194455 1:84625630-84625652 ACCCTCCCCCAGCCAGGGTCAGG + Intergenic
914764310 1:150624511-150624533 CCACTTTCCCAGCCTACCTCTGG - Intronic
915092770 1:153438150-153438172 AAGCTCTCCCAGCCAAGGGCGGG + Intronic
916465994 1:165075291-165075313 ACCCTCTCCCTGCCAAAGCCTGG - Intergenic
917951354 1:180040211-180040233 ACCCTCTACCAGGCAACATCTGG - Intronic
919697367 1:200591628-200591650 ACACTCTCCCAGTCTTCCTCTGG + Intronic
920230497 1:204466803-204466825 AGACTCCCCCAGCCAGCATCGGG - Intronic
920541008 1:206778009-206778031 ACACTATCAAAGCCAATGTCAGG - Intergenic
1066429449 10:35337249-35337271 ACAGTCGCACAGCCAACGTCGGG + Intronic
1067279487 10:44860647-44860669 ACAGTCTCCCAGCTGACCTCAGG + Intergenic
1068794398 10:61062433-61062455 CCACTCCCCCATCCAACGACAGG - Intergenic
1069980336 10:72248027-72248049 GCACAATCCCAGCCAACTTCTGG - Intergenic
1070685643 10:78478384-78478406 CCAGTCTCCCAGCCTAAGTCTGG - Intergenic
1071788108 10:88925720-88925742 TCATTCTGCCAGCCAAAGTCAGG - Intronic
1073081304 10:100862679-100862701 ACACTGTGCCAGCCAAGATCAGG - Intergenic
1077139662 11:1018563-1018585 ACACACTCCCCGCCTACGGCGGG - Exonic
1083657360 11:64235956-64235978 ACACACTCCAGGCCATCGTCAGG - Exonic
1084634035 11:70378118-70378140 AGACTCTCCCTGCAAACTTCCGG + Exonic
1085823351 11:79816983-79817005 ACATGCTCCCAGCCAATGTCTGG + Intergenic
1088379155 11:109173916-109173938 ACACTATCCCAGCCAACACCAGG - Intergenic
1089182694 11:116594001-116594023 TCACTCTCCCAGCTAATGGCAGG + Intergenic
1090981115 11:131723300-131723322 ACACTCTCCCATCCATCATCAGG - Intronic
1093376069 12:18429472-18429494 ACCCTCTCCCAGCCACCATCTGG + Intronic
1096515621 12:52153611-52153633 ACACTCTCCTGGCCATGGTCTGG + Intergenic
1102173968 12:110862461-110862483 ACATTCTCCAAGGCAACGGCTGG - Intronic
1102436127 12:112925355-112925377 CCCCTCTCCCAGCCAACCGCAGG + Intronic
1103043635 12:117717111-117717133 CCACTCTCCCAGCCCACCTTGGG + Intronic
1114667017 14:24384042-24384064 CCACTCTCCAAGCCTATGTCAGG - Intergenic
1117068880 14:52038539-52038561 ACAGTGTCCCTGCCAAAGTCAGG - Intronic
1118329605 14:64805121-64805143 ACACTGACCCTGCCAACCTCAGG - Intronic
1120299751 14:82691571-82691593 CCACTTTCCCAGCCTACCTCTGG - Intergenic
1130696417 15:86136148-86136170 AGAATCTCCCAGCCAAGTTCTGG + Intergenic
1131831857 15:96359718-96359740 ACAGTCTCCTCGCCAACTTCGGG - Intergenic
1134756822 16:16674565-16674587 CCACTTTCCCTGCCAACGTCAGG - Intergenic
1134989246 16:18684598-18684620 CCACTTTCCCTGCCAACGTCAGG + Intergenic
1142166888 16:88595970-88595992 ACACACTTCCAGCAGACGTCAGG - Intronic
1142685064 17:1572784-1572806 TCACTCTCCCACCCACCCTCAGG - Intronic
1142687857 17:1588010-1588032 TCACTCTCCCACCCACCCTCAGG - Intronic
1149840058 17:59954541-59954563 ACATTCAACCAGCCAACCTCTGG - Intronic
1149988546 17:61367056-61367078 ACACACTCCCTGCCAATGACAGG - Intronic
1150335370 17:64326748-64326770 ACACGCTCACATCCAAGGTCTGG + Intronic
1151892558 17:76959198-76959220 ACACTCACGCAGCCACCGTCTGG + Intergenic
1164370253 19:27637482-27637504 AGAGACTCCCAGCCAACCTCTGG - Intergenic
1164383526 19:27754784-27754806 ACAAACTACCAGCCAACCTCAGG - Intergenic
926426469 2:12743105-12743127 ACACTCTCCCTGAGAACATCTGG - Intergenic
929889431 2:45906887-45906909 ACACTGTCCCAGCCAAGCGCAGG - Intronic
934551678 2:95266806-95266828 AGACGCTCCCTGCCAAGGTCTGG - Intergenic
937296565 2:120813032-120813054 ACCCTTTCACAGCCATCGTCTGG - Intronic
939261292 2:139813486-139813508 ACATTCTCTCAGCCAAAGTGTGG + Intergenic
946236315 2:218326643-218326665 ATACTCTCCCACCCAACTCCAGG - Intronic
1170470308 20:16661976-16661998 CCACTCTCCCAGCCAAGGGGGGG - Intergenic
1170525127 20:17228712-17228734 CCTCTCTCCCAGCCACCGCCAGG + Intronic
1171286371 20:23942301-23942323 ACACTTTCCCATCCAATGTAAGG + Intergenic
1171374284 20:24681709-24681731 ACACTGACCCAGCCAGCCTCAGG + Intergenic
1179213486 21:39347877-39347899 ACAGTTTCCAAGCCAACTTCGGG - Intronic
1180800568 22:18630037-18630059 ACACCCTCCCAGCCAGCCGCTGG + Intergenic
1180851800 22:19025594-19025616 ACACCCTCCCAGCCAGCCGCTGG + Intergenic
1181221151 22:21365225-21365247 ACACCCTCCCAGCCAGCCGCTGG - Intergenic
1182048397 22:27294876-27294898 ACATGCTCCCAAGCAACGTCAGG - Intergenic
1183929978 22:41230326-41230348 TCAGTCTCCAAGCCAAAGTCAGG - Exonic
1184778320 22:46634143-46634165 ACACTCCCCCAGCCCTCGGCAGG - Intronic
1185079190 22:48700369-48700391 ACACTCTCCCCGGCGAGGTCAGG - Intronic
952073495 3:29668585-29668607 ACACTTTTCCAGCTAACTTCTGG - Intronic
953540616 3:43814519-43814541 CCAATCTCCCAGCCAACTCCTGG - Intergenic
954396122 3:50294418-50294440 ACACTCACCCAGCCCAAGTAGGG + Intronic
954521311 3:51229113-51229135 AGACTCTCCCAGTCAAGGACAGG - Intronic
961482550 3:127193367-127193389 GCACTCTCCCACCCAACTCCTGG + Intronic
965561229 3:170063924-170063946 ACACTCTCCTCACCCACGTCTGG - Intronic
966505173 3:180692590-180692612 GTACTCTCCCAGCCAAACTCAGG - Intronic
970242400 4:14023086-14023108 ACACCCTTCCAGCCACAGTCTGG - Intergenic
970329526 4:14965245-14965267 AGACTCTTCTAGCCAACATCTGG - Intergenic
972883437 4:43454948-43454970 ACCCTCTCCCTGCCAGCCTCTGG + Intergenic
978137087 4:105275539-105275561 ACACTTTACCAGCCAAGGTTTGG + Exonic
980134866 4:128849076-128849098 ACACGCTGTCAGCCAGCGTCCGG - Exonic
990438704 5:55821957-55821979 ACGCTCTCCCAGCCAGCGGCGGG + Intergenic
990610674 5:57453899-57453921 ACCCTCTGCCAGCCAGGGTCTGG - Intergenic
1000236474 5:159366360-159366382 ACACTTTTCCATACAACGTCTGG - Intergenic
1003552170 6:7108959-7108981 ACACTCACCCCGCCAACGGAAGG - Intronic
1009221805 6:60992226-60992248 ACACTTTCCCAGGCACCATCTGG + Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1019831719 7:3336774-3336796 ACACTTTCCCAGCCAAAGTGTGG - Intronic
1023213971 7:37841019-37841041 ACACTCTCCCACCCCAGGACAGG + Intronic
1026323785 7:69290591-69290613 ACACTCTCCCTGCCAAAGGTAGG - Intergenic
1026912830 7:74101567-74101589 GCATTCGCCCAGCCAACATCTGG + Intronic
1045145754 8:99341922-99341944 AAACTCTCCCAGCCCCAGTCGGG - Intronic
1045872426 8:106941702-106941724 ACCTTCTCCCAGCTAAGGTCTGG + Intergenic
1048127679 8:131655542-131655564 ACATTCTCCAAGCCTACGTTGGG - Intergenic
1048176521 8:132157526-132157548 ACACTCTCCCAGCCAGCCACTGG - Intronic
1049949171 9:627707-627729 GCACTCTCCCATCCACCCTCTGG - Intronic
1056780214 9:89543607-89543629 AAAATCACCCAGCCAAGGTCTGG + Intergenic
1058259688 9:102813534-102813556 ACACTCTCCCAGCTCATCTCAGG + Intergenic
1058758097 9:108102430-108102452 ACTCCCTCCAAGCCAACCTCAGG - Intergenic
1061542043 9:131282823-131282845 ACAGTCTCCCAGCCCAGGTCCGG + Intergenic
1186604040 X:11070416-11070438 ACACTTTCCAAACCAATGTCTGG - Intergenic
1186611644 X:11143771-11143793 GGACCCTCCCAGCCAACGACTGG + Intronic
1189336611 X:40174352-40174374 AGACGCTCCCAGCCAGCCTCCGG + Intronic
1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG + Intergenic