ID: 1019664788

View in Genome Browser
Species Human (GRCh38)
Location 7:2246403-2246425
Sequence GAGTGTGGAAGGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7333
Summary {0: 1, 1: 7, 2: 209, 3: 1626, 4: 5490}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019664782_1019664788 -6 Left 1019664782 7:2246386-2246408 CCTGACGTTGGCTGGGAGAGTGT 0: 1
1: 0
2: 0
3: 13
4: 85
Right 1019664788 7:2246403-2246425 GAGTGTGGAAGGAGGGAGGAAGG 0: 1
1: 7
2: 209
3: 1626
4: 5490
1019664778_1019664788 14 Left 1019664778 7:2246366-2246388 CCAGGAAAATGCTCTGAGGGCCT 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1019664788 7:2246403-2246425 GAGTGTGGAAGGAGGGAGGAAGG 0: 1
1: 7
2: 209
3: 1626
4: 5490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019664788 Original CRISPR GAGTGTGGAAGGAGGGAGGA AGG Intronic
Too many off-targets to display for this crispr