ID: 1019664790

View in Genome Browser
Species Human (GRCh38)
Location 7:2246427-2246449
Sequence GACATTTGCAGAAGCACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 706
Summary {0: 1, 1: 0, 2: 6, 3: 68, 4: 631}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019664782_1019664790 18 Left 1019664782 7:2246386-2246408 CCTGACGTTGGCTGGGAGAGTGT 0: 1
1: 0
2: 0
3: 13
4: 85
Right 1019664790 7:2246427-2246449 GACATTTGCAGAAGCACAGAGGG 0: 1
1: 0
2: 6
3: 68
4: 631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019664790 Original CRISPR GACATTTGCAGAAGCACAGA GGG Intronic
900082730 1:870487-870509 GATATTCCCAGAAGCCCAGATGG + Intergenic
901451607 1:9339621-9339643 GACCTTTGGAGAAGCTGAGAGGG + Intronic
901727564 1:11253949-11253971 CACATTTGAAGAAGCAGAGAAGG - Exonic
903354516 1:22738167-22738189 GATTTATACAGAAGCACAGATGG + Intronic
903670634 1:25033539-25033561 GACACTGGCAGAAACACAAAAGG - Intergenic
904233023 1:29092854-29092876 GTCCTTTGCAGGAACACAGATGG - Intronic
904986797 1:34557433-34557455 GTCCTTTGCAGGAACACAGATGG + Intergenic
905938055 1:41840439-41840461 GAAATTAGAAGAGGCACAGAAGG + Intronic
905939878 1:41854439-41854461 GGCATGGGCAGAAGCTCAGAGGG - Intronic
906346142 1:45015805-45015827 GACATTTGCAGAAAAACGGGTGG + Intergenic
907144931 1:52223160-52223182 GACATTTGAAGAAGAATAGCGGG - Intronic
908491900 1:64653077-64653099 GTCCTTTGCAGAAACACAGATGG + Intronic
908944361 1:69475822-69475844 GACTCTTGCAGAGTCACAGAAGG - Intergenic
909239089 1:73190013-73190035 GACATTTTCAGAAAAACAAATGG + Intergenic
909270165 1:73613759-73613781 GTCATTTGCAAAAACACAGATGG - Intergenic
909442848 1:75717117-75717139 GTCATTTGCAGCAACACAGATGG + Intergenic
909520355 1:76561036-76561058 GTCATTTGCAGCAACACGGATGG + Intronic
909592324 1:77364673-77364695 GTCATTTGCAGCAATACAGATGG - Intronic
909775500 1:79479555-79479577 GGCTTTTTCAGAAGTACAGAAGG - Intergenic
910104890 1:83621430-83621452 ATCATTTGCAGCAACACAGATGG + Intergenic
910524285 1:88159996-88160018 GACATTTGAAGAGGCACATAAGG + Intergenic
910541323 1:88361311-88361333 GGCATTTGCAGCAGCCCGGATGG - Intergenic
910741657 1:90525706-90525728 GTCATTTGCAGCAACATAGATGG + Intergenic
910958106 1:92729789-92729811 TGCATTTGCAGAACCACAGATGG - Intronic
911043555 1:93610315-93610337 GGCATTTGCAGGAGTGCAGAAGG - Intronic
911926111 1:103834973-103834995 GAAATTTGCATAAGTAAAGAAGG + Intergenic
912234845 1:107838787-107838809 GTCCTTTGCAGCAGCATAGATGG + Intronic
912857743 1:113186425-113186447 GTCATTTGCAGCAACACGGATGG + Intergenic
915049658 1:153055147-153055169 GTCATTGGCAGCAACACAGATGG + Intergenic
915247250 1:154565221-154565243 GACAGGTCCAGAACCACAGAGGG - Intergenic
915880050 1:159660243-159660265 GTCATTTGCAGCAGCATGGATGG - Intergenic
916364485 1:164009100-164009122 AATATATGCAGAAGAACAGAGGG - Intergenic
916633763 1:166645469-166645491 GTCATTTGCAGAAACATGGATGG + Intergenic
916841119 1:168601969-168601991 GACATTTTCAAAAGCAAAAAGGG + Intergenic
918199349 1:182252740-182252762 GTCACTTGCAGCAACACAGATGG + Intergenic
918395434 1:184109595-184109617 GACATTTGCAGTAGGAAATAAGG + Intergenic
918439753 1:184555357-184555379 GACATTGGCAGCAGCTCACAGGG - Intronic
918693080 1:187507074-187507096 GACCCTTTCAGAAGAACAGAAGG - Intergenic
918758194 1:188364648-188364670 GACATCTCCAGAATCACAGTAGG - Intergenic
918855450 1:189749578-189749600 GTCCTTTGCAGAAACACAGATGG - Intergenic
918948641 1:191105625-191105647 GTCCTTTGCAGTAACACAGATGG - Intergenic
919252462 1:195074674-195074696 GATATTTGTAAAAGTACAGAAGG - Intergenic
919607499 1:199703575-199703597 GAGATTTGCTGAAGCTGAGATGG - Intergenic
919644671 1:200082816-200082838 GACCTTTGTAGATGCACAGCAGG - Intronic
919775787 1:201193161-201193183 GACATTGGCTGATGCACTGATGG + Intronic
920326177 1:205166181-205166203 GACAAGTGCAGAAGAACATATGG + Intronic
921021560 1:211240383-211240405 GCCATTTGCAGAAAGAGAGAAGG - Intergenic
921180212 1:212626017-212626039 GACAGCTGCAGAAGCAGACATGG + Exonic
922773101 1:228200004-228200026 GTCATTTGCAGTAACACGGATGG + Intergenic
922929810 1:229380325-229380347 CAAATTTGCAGAAGGAAAGAGGG + Intergenic
923896493 1:238275950-238275972 GAGATCTCCAGAAGCAGAGAGGG - Intergenic
923915522 1:238499530-238499552 GACTTTTGCAGGAACATAGATGG + Intergenic
924141759 1:241031269-241031291 GTCTTTTACAGCAGCACAGATGG - Intronic
1063147841 10:3312539-3312561 GACCTTTTCAGCAGCACGGAGGG + Intergenic
1063795984 10:9515058-9515080 CACATCTGCAGCATCACAGAGGG - Intergenic
1064523892 10:16232723-16232745 GGTCTTAGCAGAAGCACAGAAGG - Intergenic
1064635491 10:17362013-17362035 GACATTTGCAAAAACACCTATGG + Intronic
1065428346 10:25628808-25628830 GTCCTTTGCAGCAACACAGATGG - Intergenic
1065819085 10:29508767-29508789 CACAGCTGCAGAAGCACAGTGGG + Intronic
1066191787 10:33062640-33062662 GTCATTTGCAAAAACACAGATGG + Intergenic
1067152495 10:43748429-43748451 GACATGTGCAGAAGAAAATATGG + Intergenic
1067304872 10:45053687-45053709 GTCATTTGCAGCAACATAGATGG - Intergenic
1068318690 10:55381710-55381732 GATATACACAGAAGCACAGATGG + Intronic
1069163407 10:65118126-65118148 GACAAATCCAGAGGCACAGAAGG - Intergenic
1069197932 10:65576287-65576309 AACATTTGCAAAAGTACAGGAGG + Intergenic
1069327983 10:67254432-67254454 GACAATAACAGAAACACAGAAGG + Intronic
1069597122 10:69679473-69679495 GGCAGTTGCAGAAGCAAAGGTGG - Intergenic
1070457913 10:76635253-76635275 GGCCTTTGCAGCAGGACAGATGG + Intergenic
1070547012 10:77460603-77460625 GTCTTTTGCAGCAACACAGAGGG + Intronic
1071007845 10:80903204-80903226 GTCATTTGCAACAACACAGATGG - Intergenic
1072091183 10:92129180-92129202 GTCCTTTGCAGGAACACAGATGG + Intronic
1072865855 10:99060785-99060807 GTCATTTGCAAAAACACAAATGG + Intronic
1073184333 10:101606723-101606745 GACCCTTCCAGAAGCACAGTGGG + Intronic
1073226184 10:101921670-101921692 GTCATTTGCAACAACACAGATGG + Intronic
1073826737 10:107332405-107332427 GTCATTTGCAGCAACACAGTTGG - Intergenic
1073851499 10:107624259-107624281 GTCATTTGCAGCAACACACATGG - Intergenic
1074127228 10:110538541-110538563 GTCATTTGCAGCAACATAGATGG + Intergenic
1074312979 10:112338422-112338444 GACATTTCCATCATCACAGAAGG + Intergenic
1074854920 10:117466499-117466521 GATATTTGCATATACACAGAGGG - Intergenic
1077988523 11:7380130-7380152 GTCATTTGCAACAACACAGATGG + Intronic
1079354888 11:19722657-19722679 AATATTTGCAGAAGAAAAGAAGG + Intronic
1079482488 11:20895862-20895884 GTCATTTGCAGCAACACGGATGG - Intronic
1079530054 11:21441037-21441059 AACATTTGCAAAAACACAGCAGG - Intronic
1079750749 11:24193081-24193103 GTCCTTTGCAGAAACACGGATGG - Intergenic
1080294350 11:30708439-30708461 GTCATTTGCAGCAACACGGATGG + Intergenic
1080717947 11:34822365-34822387 GAAATTTGGAGAAGGACACAAGG + Intergenic
1081212160 11:40349371-40349393 GTCATTTGCAGCAACATAGACGG - Intronic
1082654188 11:55833184-55833206 GACATTCGCAGTAACCCAGAAGG + Intergenic
1084307935 11:68298863-68298885 GACATCTCCAGCAGCACGGATGG - Intergenic
1086470646 11:87106075-87106097 GTCAGTTGCAGCAACACAGATGG - Intronic
1087698175 11:101404577-101404599 GCCATTTGCATAGGCACAGAAGG - Intergenic
1087816947 11:102669005-102669027 GTCTTTTGCAAAAGCCCAGATGG - Intergenic
1087892853 11:103554625-103554647 GTCTTTTGCAGAAACATAGATGG - Intergenic
1088161603 11:106878466-106878488 GTCCTTTGCAGGAACACAGATGG + Intronic
1088296276 11:108299145-108299167 GACATTTTCAGCAACCCAGAGGG - Intronic
1088979136 11:114845931-114845953 CAGCTTTGCAAAAGCACAGATGG + Intergenic
1089088541 11:115845704-115845726 GACCTTTGGAGAAGAACAGGAGG + Intergenic
1089410900 11:118241915-118241937 AGCATTTGCAAAGGCACAGAAGG - Intronic
1089532504 11:119139969-119139991 GTCATTTGCAGCAACATAGATGG - Intergenic
1089657930 11:119965244-119965266 TACAGAAGCAGAAGCACAGAGGG - Intergenic
1089901497 11:121990895-121990917 GATATTTTCAGAAACACAGATGG + Intergenic
1090219592 11:125007383-125007405 GTCATTTGCTGCAACACAGATGG - Intronic
1090798720 11:130157304-130157326 TGCGTTTGCAGCAGCACAGAAGG + Intergenic
1090811076 11:130244036-130244058 GACATTTGCCAAAACACAAATGG - Intronic
1091370502 11:135053694-135053716 GACATTCCCAGAAACACAAATGG - Intergenic
1091746062 12:2993873-2993895 GACACGTGCTGCAGCACAGACGG - Intronic
1091826783 12:3518783-3518805 AGCCTTTGCAGAAACACAGAGGG - Intronic
1092255423 12:6924518-6924540 GACCTTCGCAGAAGCAGAGCGGG - Exonic
1092437042 12:8457375-8457397 GCCATTTGCAACAGCACAGATGG - Intronic
1092624710 12:10314309-10314331 GAGATTTGCAGCATCACACAGGG + Intergenic
1093064083 12:14638554-14638576 GTCATTTGCAGCAACACATATGG + Intronic
1093575696 12:20727011-20727033 GCCCTTTGCAGCAACACAGATGG - Intronic
1093676747 12:21950086-21950108 TACATTTGCAGCAACACAGATGG + Intergenic
1093885166 12:24451097-24451119 GTCATTTGCAGCAACATAGATGG - Intergenic
1093970676 12:25373080-25373102 GACATTTTCAGAAGCAGAATAGG + Intergenic
1095045614 12:37500780-37500802 GACACTGGTAGAAGCATAGAGGG - Intergenic
1095639563 12:44472121-44472143 GTCCTTTGCAGAAACATAGATGG - Intergenic
1096412645 12:51388346-51388368 GACTGTGGCAGAAACACAGAGGG + Intronic
1096754715 12:53789533-53789555 AACTTTTGCAGAAGCAAGGATGG + Intergenic
1097618432 12:61910859-61910881 GAGCTTTGAAGAAACACAGATGG - Intronic
1098338896 12:69431623-69431645 GAAGTTTGAAGAAGCAAAGAAGG + Intergenic
1098341322 12:69454489-69454511 GTCATTTGCAGCAACATAGATGG - Intergenic
1098404994 12:70115890-70115912 GTCATTTGCAGCAACATAGATGG + Intergenic
1098807994 12:75044979-75045001 GAAATTTTCACATGCACAGAGGG + Intronic
1098902763 12:76130062-76130084 GATTTTTGCAGAAACATAGATGG - Intergenic
1099353622 12:81606121-81606143 GTCCTTTGCAGAAACATAGATGG - Intronic
1099696702 12:86032067-86032089 GTCCTTTGCAGCAACACAGATGG - Intronic
1099801124 12:87457584-87457606 GTCATTTGCAGCAGCATAGATGG + Intergenic
1100239359 12:92695706-92695728 AGCATTTTCAGAAGAACAGAAGG + Intergenic
1100402169 12:94241664-94241686 GTCATTTGCAACAACACAGATGG - Intronic
1100903899 12:99275493-99275515 GTCATTTGCAACAACACAGATGG - Intronic
1102607404 12:114078848-114078870 GACATTTGCAGAAGCCATGATGG + Intergenic
1102765025 12:115425301-115425323 GCCTTTTGCAGCAACACAGATGG + Intergenic
1104229258 12:126868329-126868351 GACATTTTCATGACCACAGATGG + Intergenic
1105421874 13:20260028-20260050 GTCATTTGCAGCAACATAGAGGG - Intergenic
1106465147 13:30006827-30006849 GACAGATGCATAAGCACACAGGG + Intergenic
1106818024 13:33430755-33430777 GTCATTTGCAGTAACATAGATGG + Intergenic
1106856215 13:33856175-33856197 GTCCTTTGCAGCAACACAGATGG + Intronic
1107485152 13:40819574-40819596 GTCTTTTGCAGCAACACAGATGG + Intergenic
1107694095 13:42983182-42983204 GACATTTACAGTTGCAGAGAGGG - Intronic
1107707954 13:43125539-43125561 GTCATTTGCAACAACACAGATGG + Intergenic
1107984823 13:45766647-45766669 GAAATGTGGAGAAGCAAAGATGG + Intergenic
1108136726 13:47371623-47371645 GTCATTTGCAGCAACATAGATGG + Intergenic
1109249140 13:59997348-59997370 GTCATTTGCAGCAACATAGATGG - Intronic
1109394595 13:61739668-61739690 GTCTCTTGCAGAAACACAGATGG + Intergenic
1109663234 13:65493315-65493337 GTCTTTTGCAGAAACACAGATGG + Intergenic
1110276486 13:73647040-73647062 GACATTGTCAGAAGCACGAAAGG - Intergenic
1110489060 13:76081068-76081090 GCCATTTGCAGCAACACAGATGG + Intergenic
1111671247 13:91333053-91333075 GTCATTTGCAGCAACACGGATGG - Intergenic
1111899624 13:94184981-94185003 GTCCTTTGCAGCAACACAGATGG + Intronic
1112446222 13:99466587-99466609 GTCCTTTGCAGAAGCACAGACGG - Intergenic
1112618337 13:101028286-101028308 GACATTTGCAGCAACATGGATGG - Intergenic
1113014590 13:105814276-105814298 GAGAATGGCAGAAGCACACAAGG + Intergenic
1113033726 13:106025013-106025035 GTCATTTGCAGCAACATAGATGG + Intergenic
1113247817 13:108418118-108418140 GTCCTTTGCAGGAACACAGATGG - Intergenic
1113662212 13:112115253-112115275 GGCACTTTCTGAAGCACAGATGG + Intergenic
1113699602 13:112374813-112374835 GACATTTACAGAAACCCAGTGGG - Intergenic
1114686896 14:24541617-24541639 GTCCTTTGCAGCAACACAGATGG + Intergenic
1114762885 14:25336663-25336685 GTCATTTGCAGCAACACAGATGG + Intergenic
1115025777 14:28744153-28744175 TTGATTTGCAGAAGAACAGAAGG + Intergenic
1115113404 14:29851920-29851942 GTCCTTTGCAGCAACACAGATGG + Intronic
1115196772 14:30809173-30809195 GACATTTGGAGAATCATACATGG + Intergenic
1115601280 14:34957985-34958007 GTCCTTTGCAGGAACACAGACGG + Intergenic
1115886736 14:37980595-37980617 GTCTTTTGCAGGAGCATAGATGG + Intronic
1115931313 14:38498592-38498614 GTCTTTTGCAGCAACACAGATGG - Intergenic
1117230708 14:53715423-53715445 GGTATCTGCACAAGCACAGATGG + Intergenic
1117533252 14:56679411-56679433 GTCATTTGCAGCAGCATGGATGG + Intronic
1117644698 14:57839421-57839443 GACCTTTGCAGAGACATAGATGG + Intronic
1118556439 14:67028176-67028198 GTCATTTGCAGCAACACAGATGG - Intronic
1119630802 14:76230191-76230213 GCCCTTTGCTGAAACACAGATGG + Intronic
1119774436 14:77239687-77239709 AGCACTTGCAGAAGCACAGGCGG - Exonic
1119858511 14:77919390-77919412 GACATTTGCAGCAACGTAGATGG - Intronic
1119932992 14:78566221-78566243 GGCATTGGCAGCAGCCCAGAAGG + Intronic
1121729030 14:96173638-96173660 GAGATGCGTAGAAGCACAGAGGG + Intergenic
1122250818 14:100438444-100438466 GAGAATGGCAGGAGCACAGAGGG - Intronic
1122266767 14:100550310-100550332 GACAGATGCAGAGGCCCAGAAGG - Intronic
1122403196 14:101479658-101479680 GTCCTTTGCAGCAGCACGGATGG + Intergenic
1122808392 14:104274197-104274219 GTCATTTGCAATAACACAGATGG - Intergenic
1122935416 14:104953797-104953819 CACACATGCAGAAGCACAGGGGG - Exonic
1123024639 14:105419078-105419100 GACCTGTGCACAAGCACACACGG + Intronic
1123152389 14:106195688-106195710 GACATTTGCAACAACACGGATGG + Intergenic
1123172551 14:106388385-106388407 GACATTTGCAACAACACGGATGG + Intergenic
1123179577 14:106456646-106456668 GACATTTGCAACAACACGGATGG + Intergenic
1123400786 15:19983643-19983665 GACATTTGCAACAACACGGATGG + Intergenic
1124073937 15:26423843-26423865 GTCATTTGCAGTAACATAGATGG - Intergenic
1124134180 15:27019596-27019618 GACATTAGCAGAGGGAGAGAAGG + Intronic
1125294348 15:38186102-38186124 GAGATTTCCAGAGGCAGAGAAGG + Intergenic
1126714798 15:51503410-51503432 GTCATTTGCAGCAACACAGTTGG + Intronic
1127196878 15:56596637-56596659 GTCATTTGCAGCAACATAGATGG + Intergenic
1127827566 15:62718438-62718460 GAGATTTGAAGAAGCAGAGAGGG - Intronic
1127972930 15:63976007-63976029 AACATTTCCAGAAGCACACCTGG + Intronic
1128006370 15:64245793-64245815 GTCATTTGCAGCAACACAGATGG + Intronic
1128900435 15:71416152-71416174 GTCATTTGCAACAGCATAGATGG - Intronic
1129315130 15:74738035-74738057 GTCATTTGCAGCAACACGGATGG + Intergenic
1129893048 15:79084548-79084570 GGCATGTGCAGAAGCTCAGCAGG - Intronic
1129923959 15:79345450-79345472 GTCATTTGCAGGAACACGGATGG - Intronic
1130398447 15:83526504-83526526 GTCATTTGCAGGAGCATAAATGG + Intronic
1130399886 15:83541089-83541111 GTCATTTGCAACAACACAGATGG - Intronic
1130780097 15:87027722-87027744 GTCATTTGCAGAGACACAAATGG + Intronic
1132107969 15:99077990-99078012 GCCATTTGCAGAAACATGGATGG - Intergenic
1133082363 16:3332653-3332675 GTCATTTGTAGCATCACAGATGG - Intergenic
1133559195 16:6934583-6934605 GTCATTTGCAGCAGCACAGATGG + Intronic
1133833568 16:9346712-9346734 GTCATTTGCAACAACACAGATGG - Intergenic
1134296409 16:12950171-12950193 GTCATTTGCAGCAACATAGATGG - Intronic
1134302203 16:13001595-13001617 AACATTTGCATCAGCCCAGAAGG - Intronic
1135803918 16:25524764-25524786 GTCATTTGCAGCAGCATGGATGG - Intergenic
1136626772 16:31466421-31466443 CAGCTTTGCAGAAGCCCAGATGG + Exonic
1137226258 16:46513537-46513559 GTCATTTGCAACAGCATAGATGG + Intergenic
1137361406 16:47819493-47819515 GTCCTTTGCAGCAACACAGATGG - Intergenic
1137912177 16:52388762-52388784 GTCCTTTGCAGGAACACAGATGG - Intergenic
1139162120 16:64522791-64522813 GTCCTTTGCAGAAGCATGGATGG + Intergenic
1140741663 16:77947121-77947143 CCCATTTGCAGAGGCACGGAAGG - Intronic
1141236381 16:82221612-82221634 GTCATTTGCAGAAACATGGATGG - Intergenic
1141311689 16:82919511-82919533 GACCTTTTCAGGAACACAGATGG - Intronic
1141620333 16:85233935-85233957 CACATGGGCAGGAGCACAGAAGG + Intergenic
1143129912 17:4671726-4671748 GACACCTGCAGAAGAAGAGATGG - Exonic
1144399053 17:14876905-14876927 AACATTCCCAGAAACACAGATGG - Intergenic
1144734993 17:17550367-17550389 GAGCTTTGCAGATGCACAGCTGG + Intronic
1146784100 17:35703519-35703541 GTCCTTTGCAGGAGCATAGATGG + Intronic
1147005558 17:37400668-37400690 GTCATTTGCAGCAACATAGATGG - Intronic
1147116812 17:38306814-38306836 GAAATTCCCAGAAGCAGAGAGGG - Intronic
1147529119 17:41257160-41257182 GTCCTTTGCAGCAACACAGATGG - Intergenic
1147951875 17:44112001-44112023 GACCTTGGGAGAGGCACAGATGG + Intronic
1148169038 17:45504104-45504126 GTCTTTTGCAGGAACACAGATGG - Intergenic
1148279781 17:46338904-46338926 GTCTTTTGCAGGAACACAGATGG + Intronic
1148301999 17:46556760-46556782 GTCTTTTGCAGGAACACAGATGG + Exonic
1148412864 17:47482788-47482810 GAAATTCCCAGAAGCAGAGAGGG + Intergenic
1148475297 17:47924838-47924860 GTCATGTGCAGAAGGGCAGAAGG + Intronic
1150368613 17:64614957-64614979 ACCATTTGCAGAAGTACAGATGG + Intronic
1150400231 17:64850570-64850592 GTCTTTTGCAGGAACACAGATGG - Intergenic
1150723060 17:67629633-67629655 GAGATTTGCAGAAAGAAAGAAGG + Intronic
1150944828 17:69733616-69733638 GGGATTTGCAGATGCACAGTGGG + Intergenic
1151021257 17:70619900-70619922 GTCTTTTGCAGAAACACGGATGG - Intergenic
1151175218 17:72282473-72282495 AGCATCTGCAGAAGCACAAAAGG - Intergenic
1151205408 17:72502752-72502774 GACATTGGCAGATGCTGAGAAGG - Intergenic
1151392021 17:73793703-73793725 GGGAATCGCAGAAGCACAGAGGG - Intergenic
1152840971 17:82567982-82568004 GCCAGTTGCTGAAGCACAGTAGG + Intronic
1155184353 18:23374013-23374035 GACATCTGCAAAACCACAGCTGG + Intronic
1155662024 18:28260627-28260649 GTCATTTGCAGCAGCATAGATGG + Intergenic
1155775875 18:29760389-29760411 GAAATTTGGAGAAGCAAAGGAGG - Intergenic
1155844832 18:30693102-30693124 GTCTTTTGCAGAAACACGGATGG - Intergenic
1158131761 18:54159848-54159870 GAAATTGGAAGAAGCACTGATGG - Exonic
1158375295 18:56856718-56856740 GACATTTTAGGAAGTACAGAAGG - Intronic
1158667638 18:59447331-59447353 GACATGTGCACATGGACAGAAGG + Intronic
1159060338 18:63507962-63507984 GTCATTTGCAGAAACATGGATGG + Intergenic
1159538966 18:69750945-69750967 GACATTTGCAGCAACATAGATGG + Intronic
1159814858 18:73060339-73060361 GACATTTGCAGAAGTGCCAAGGG + Intergenic
1159824076 18:73184135-73184157 GACATTTGCCACAGCAGAGATGG + Intronic
1159836127 18:73337621-73337643 GAAATTTGCAGATACACTGAGGG - Intergenic
1159986916 18:74853653-74853675 GAAATGGGCAGAAGTACAGATGG - Intronic
1160138865 18:76300849-76300871 GTCCTTTGCAGGAACACAGATGG + Intergenic
1160882577 19:1328244-1328266 GACATCTGCAGAATCACAGACGG - Intergenic
1161667578 19:5586444-5586466 GACATTTCCAGAAGAACGGAGGG + Intergenic
1162337690 19:10071668-10071690 GACATCTGCAGATGTGCAGAGGG + Intergenic
1162505093 19:11078947-11078969 GACATTGGCAGCAGCCAAGATGG - Intergenic
1162969098 19:14169563-14169585 GAAAATTACGGAAGCACAGAAGG + Intronic
1163071968 19:14851024-14851046 GACATTTGCAGCAACATGGATGG - Intergenic
1163313180 19:16526024-16526046 GGCAGGTGCAGAGGCACAGACGG + Intronic
1163651417 19:18520553-18520575 GACATGGGAAGAAGCACGGAAGG + Intronic
1163744516 19:19037290-19037312 GGCATCTGCAGGAACACAGATGG + Intronic
1164176191 19:22777238-22777260 GTCATTTGCAGCAACATAGATGG + Intronic
1164549796 19:29200046-29200068 GACATTGGCATGAGGACAGATGG - Intergenic
1167192203 19:47998986-47999008 GACATGTTCTGACGCACAGAAGG - Intronic
1167747952 19:51363891-51363913 CACAGTGGCAGAAGCACAAAGGG + Intronic
1168383928 19:55946863-55946885 GACCTTTGCAGGAACATAGATGG - Intergenic
926336764 2:11869164-11869186 AACATTTGCAGAAGGATAAACGG - Intergenic
926481320 2:13399519-13399541 GTCCTTTGCAGAAACATAGATGG + Intergenic
926896398 2:17694037-17694059 GTCATTTACAGCAACACAGATGG + Intronic
927524430 2:23723959-23723981 GCCATTTGCAGAAACATGGATGG + Intergenic
927604325 2:24472611-24472633 GTCCTTTGCAGCAGCATAGATGG + Intergenic
928336995 2:30406697-30406719 CACATTTGAAGACACACAGATGG + Intergenic
928354119 2:30593212-30593234 GTCATTTGCAGCAACATAGATGG - Intronic
928618530 2:33064770-33064792 AAGATATGCAGAAACACAGAAGG + Intronic
928695250 2:33842462-33842484 GATTTATACAGAAGCACAGATGG - Intergenic
928755102 2:34515187-34515209 GTCCTTTGCAGAAACACAGGTGG + Intergenic
928851478 2:35752821-35752843 GTCATTTGCAACAACACAGATGG - Intergenic
929231025 2:39560322-39560344 GTCATTTGCAAAAACACAGATGG - Intergenic
929279983 2:40066938-40066960 GTCCTTTGCAGGGGCACAGATGG - Intergenic
930296462 2:49560785-49560807 TATATTTGCAGGAGGACAGAAGG - Intergenic
930363829 2:50413868-50413890 GTCATTTGCAACAACACAGATGG + Intronic
930560387 2:52953035-52953057 GGCACTAGCAGAACCACAGAGGG - Intergenic
930878010 2:56241634-56241656 GTCATTTGCAAGAACACAGATGG - Intronic
931559760 2:63547636-63547658 GTCATTTGCAGCAACATAGATGG + Intronic
931590323 2:63875990-63876012 GACATTTACTCAAGCAAAGATGG - Intronic
931996718 2:67845811-67845833 GACATTTTCTTAAGCAGAGAAGG - Intergenic
932753521 2:74388480-74388502 AACATTTGCAGATGCATAAAGGG - Intronic
932873432 2:75426308-75426330 GTCCTTTGCAGAAACATAGATGG - Intergenic
933521833 2:83383642-83383664 GCCATTTGCAGCAACATAGATGG + Intergenic
933714394 2:85349577-85349599 GACACCTGCAGAAGCAAGGAAGG + Exonic
934948670 2:98560948-98560970 GACATTTCCAGAAGCACTGATGG + Intronic
935124285 2:100209340-100209362 GTCATTTGCAGCGGCATAGATGG - Intergenic
935505320 2:103893511-103893533 GGCATTTGGAAAAGCCCAGAAGG - Intergenic
936735340 2:115434979-115435001 GTCATTTGCAGAAACATGGATGG - Intronic
936778422 2:116002510-116002532 GTCTTTTGCAGGAGCATAGATGG - Intergenic
936887730 2:117333513-117333535 GTCCTTTGCAGGAACACAGATGG + Intergenic
937111669 2:119371414-119371436 CTCATTCGCAGAAGGACAGAGGG - Intronic
937304068 2:120860453-120860475 GTCCATTGCAGAAGCTCAGAGGG + Intronic
937441966 2:121923425-121923447 GTCTTTTGCAGGAACACAGATGG - Intergenic
938261662 2:129900875-129900897 GTCATTTGCAGCAACATAGATGG + Intergenic
939080012 2:137648526-137648548 GTCATTTGCAGAAACATAAATGG - Intronic
939550522 2:143609791-143609813 GGCATCTGCAGCAGAACAGAGGG + Intronic
940208703 2:151234210-151234232 GTCCTTTGCAGCAGCATAGATGG + Intergenic
940383932 2:153048324-153048346 CAAATTTGCTGAAGCTCAGATGG - Intergenic
942137944 2:172947410-172947432 GACATTTCCAGAATCGCTGAAGG + Intronic
942364233 2:175206213-175206235 GTCATTTGCAACAACACAGATGG + Intergenic
943137693 2:183936111-183936133 CACCTTTGGAGAAGTACAGAGGG - Intergenic
943170463 2:184391136-184391158 GTCATTTGCAACAACACAGATGG + Intergenic
943808996 2:192160789-192160811 GGCATTTGCAGCAGCAATGATGG + Intronic
943823470 2:192357660-192357682 AGCATTTGCAGAAGTAAAGATGG - Intergenic
944623072 2:201538968-201538990 GTCCTTTGCAGGAGCATAGATGG - Intronic
945059326 2:205894869-205894891 GAAATTTGCAGAAACTTAGATGG + Intergenic
945339091 2:208630340-208630362 GACAGTGGCAGAAGTACAAAAGG + Intronic
945474414 2:210264339-210264361 GACATTTTCAGAAGTCTAGATGG + Intergenic
946710297 2:222498420-222498442 GACATTTGAAGAAGCCAACATGG + Intronic
947063665 2:226195614-226195636 GTCATTTGCAGCAACACAGATGG - Intergenic
947262301 2:228237231-228237253 GTCATTTGCAACAACACAGATGG - Intergenic
947674296 2:231962886-231962908 GTCCTTTACAGCAGCACAGATGG - Intronic
947980057 2:234400842-234400864 GTCCTTTGCAGAAACACAGATGG - Intergenic
948245954 2:236486103-236486125 GCCATATGGAGAAGCACACATGG + Intronic
948550562 2:238769851-238769873 AACATTTACAGAAACACACAAGG - Intergenic
948606087 2:239136343-239136365 GACATTTGCAGCAACATAGATGG - Intronic
1169020968 20:2330541-2330563 GTCATCTGCAGAGGCAGAGAGGG - Intronic
1169642025 20:7763173-7763195 GACTTTTCCAGCATCACAGAAGG - Intergenic
1169813566 20:9633182-9633204 GATGTTGGCATAAGCACAGAGGG + Intronic
1169815594 20:9652840-9652862 GACATTCACAGAAGTAGAGAAGG - Intronic
1170073443 20:12393316-12393338 GACATTTGGAGGAGGAGAGATGG + Intergenic
1170415323 20:16133391-16133413 GTCATTTGCTGGAGCACAGCTGG + Intergenic
1170818889 20:19739416-19739438 GCCTTTGGCAGAATCACAGAGGG - Intergenic
1170871471 20:20210330-20210352 GACAGATGCAGAAGAACACATGG - Intronic
1173375222 20:42476927-42476949 AACATGTGCAAAATCACAGATGG + Intronic
1175956565 20:62612934-62612956 GTCATTTGCAGCAACACAGATGG - Intergenic
1176975756 21:15319606-15319628 GACATTTTCACAAGTAGAGATGG + Intergenic
1177441201 21:21127761-21127783 GTCATTTGCAGCAACATAGATGG - Intronic
1177512183 21:22102544-22102566 GTCATTTGCAGCAACACGGATGG - Intergenic
1177523521 21:22263235-22263257 GTCCTTTGCAGCAACACAGATGG + Intergenic
1177659448 21:24064009-24064031 GTCCTTTGCAGGAACACAGATGG + Intergenic
1177935663 21:27342593-27342615 GAAATTGGCAGCAGCACAAAGGG - Intergenic
1178506430 21:33166853-33166875 GAAATTTGGAGACACACAGAGGG + Intronic
1178679692 21:34663224-34663246 GTCATTTGCAGCAACACAAATGG + Intergenic
1178797505 21:35758502-35758524 GTCATTTGCAGCAACATAGATGG + Intronic
1180635974 22:17263308-17263330 CACTTCTGCAGAAGCACTGAGGG - Intergenic
1180930254 22:19585474-19585496 GTCATTTGCAGCAGCATGGATGG - Intergenic
1181016388 22:20071497-20071519 GACATTTGCTAAAGCACTGTAGG + Intergenic
1182065412 22:27428104-27428126 CACATTTTCAGAATCTCAGATGG - Intergenic
1182671892 22:32003073-32003095 GTCATTTGCACCAACACAGATGG - Intergenic
1183436712 22:37800347-37800369 GTCATTTGCAACAACACAGATGG - Intergenic
1185252271 22:49809964-49809986 CACATATTCACAAGCACAGATGG + Intronic
949826770 3:8173824-8173846 GAAATTATCAGAAGCACAGATGG + Intergenic
950152476 3:10698330-10698352 GACAATGGCAGAAAGACAGAAGG + Intronic
950598361 3:14006843-14006865 GTCATTTGCAGCAACACAGATGG - Intronic
951219047 3:20050403-20050425 GACATTTTCAGCATCTCAGAGGG + Intronic
951343661 3:21520019-21520041 GACATTGGGAGTAGCAGAGAGGG - Intronic
951548950 3:23857741-23857763 ACCATTTCCATAAGCACAGAAGG - Intronic
951797455 3:26556412-26556434 GTCATTTGCAGCAACACAGATGG + Intergenic
953395909 3:42569651-42569673 AACATTTGCAGAAATTCAGAAGG - Intronic
953541090 3:43818844-43818866 GTCATTTGCAGAAACATGGATGG - Intergenic
954277353 3:49551301-49551323 GACACTTGTAGAAGACCAGAGGG - Intergenic
954881635 3:53839902-53839924 GTCATTTGCAGCAACACTGATGG + Intronic
954998430 3:54903357-54903379 GTCCTTTGCAGGAACACAGATGG - Intronic
955174075 3:56595549-56595571 GTCATTTACAGCAACACAGATGG - Intronic
955658693 3:61273175-61273197 GTCATTTGCAACAACACAGATGG - Intergenic
955851666 3:63226540-63226562 GTCATTTGCAGAAACATGGATGG + Intergenic
956012042 3:64842405-64842427 GACATTGGAAGAAATACAGATGG - Intergenic
956916708 3:73879529-73879551 GACAGTTGTAGAAGCTAAGAAGG - Intergenic
957614335 3:82508149-82508171 GTCCTTTACAGGAGCACAGATGG - Intergenic
957692216 3:83586505-83586527 GTCATTTGCAGGAGCATAAATGG - Intergenic
958888856 3:99760793-99760815 GACATTTGGCTCAGCACAGAGGG + Intronic
959160492 3:102718211-102718233 GTCATTTGCAGCAGCATAGATGG - Intergenic
959636771 3:108583430-108583452 GCCATTTGCAGCAACACGGATGG + Intronic
959665225 3:108913478-108913500 GATATTTGCAGAAGTACAAAAGG - Intronic
959687673 3:109165304-109165326 GATACATGCAGAAGCACATAAGG + Intergenic
960947820 3:122978906-122978928 GACATTTGAGGTTGCACAGAAGG - Intronic
961089631 3:124099363-124099385 GTCATTTGCAGCAACATAGATGG - Intronic
961448406 3:126991743-126991765 GTCATGGGCAGAGGCACAGAGGG - Intronic
962548445 3:136462376-136462398 GTCATTTGCAGTGACACAGATGG + Intronic
963351973 3:144163004-144163026 GACATTTGCAGAGGCAAGAAAGG - Intergenic
963699296 3:148604341-148604363 CACATGTGCATAAGCCCAGAAGG + Intergenic
963817416 3:149847424-149847446 GCAATGTGCAGAAGCACAGCTGG - Intronic
963970646 3:151425949-151425971 AACATCTGCAAAGGCACAGAGGG + Intronic
963995642 3:151705380-151705402 GACAATTGCAAAAGCAGAAAGGG + Intergenic
965042628 3:163530374-163530396 GTCATTTGCAGTAACATAGATGG + Intergenic
965121918 3:164570483-164570505 GTCATTTGCAGCAGCATGGATGG + Intergenic
965234429 3:166097594-166097616 GTCATTTGCAATAGCATAGATGG + Intergenic
965442703 3:168735490-168735512 GTCATTTGCAGCAGCATGGAAGG + Intergenic
965603068 3:170473600-170473622 GACATTTGCCGAAGCAGAAAGGG + Intronic
965743411 3:171900409-171900431 GAGAGTTGGAGAAGCAGAGAGGG + Intronic
965892056 3:173526897-173526919 GACATTTGCAACAGTATAGATGG - Intronic
965978874 3:174661866-174661888 ATCTTTTGCAGAAACACAGATGG + Intronic
966054080 3:175660809-175660831 GTCATTTGCAGCAACACGGATGG - Intronic
966630785 3:182072137-182072159 ATCATTTGCAGAATCATAGAAGG - Intergenic
966810254 3:183837515-183837537 GACATTAGCAGAGGCACACTAGG + Intronic
967114477 3:186324153-186324175 CACACCTTCAGAAGCACAGAGGG + Intronic
967132259 3:186482621-186482643 GTCATTTGCAGCAACACAGATGG + Intergenic
967440869 3:189507184-189507206 GACATTTGCAACAACACAGATGG + Intergenic
967535329 3:190595336-190595358 AACATTAGCAGAAGCCCTGATGG - Intronic
967768647 3:193310170-193310192 GACTTCTGCAGGAACACAGATGG - Intronic
967777421 3:193399068-193399090 AACATTTCCATAAGCACATAAGG + Intergenic
968312777 3:197697746-197697768 AACATTTCCAGGACCACAGAAGG + Intronic
970821994 4:20228078-20228100 GGAAATTGCAGAAGCACAGGAGG + Intergenic
971147044 4:23989060-23989082 GACATTTCCAGATGCAGACATGG + Intergenic
971246126 4:24929682-24929704 AACATAAGCAGAGGCACAGAGGG - Intronic
971448312 4:26776564-26776586 GACATTGACACAAGTACAGATGG - Intergenic
971568688 4:28181376-28181398 GTCATTTGCAGCAAAACAGATGG - Intergenic
971821807 4:31566747-31566769 GTCTTTTGCAGCAACACAGATGG + Intergenic
972007627 4:34131066-34131088 GTCATTTGCAACAACACAGATGG + Intergenic
972022346 4:34331478-34331500 GTCATTTGCAACAGCATAGATGG + Intergenic
972434970 4:39024515-39024537 GTCCTTTGCAGAAACATAGATGG + Intronic
972869209 4:43275567-43275589 GACAATTGCAGAATCACTGATGG - Intergenic
972920651 4:43937207-43937229 GTCTTTTGCAGCAACACAGATGG + Intergenic
973326054 4:48863258-48863280 GGCATTAGCAGAAGCCCAAAGGG - Intergenic
973765635 4:54159256-54159278 GACATTTGCACAAGGGCAGAAGG - Intronic
974390964 4:61267457-61267479 GAAAGTTGAGGAAGCACAGATGG + Intronic
974405269 4:61460386-61460408 GTCATTTGCAGCAACATAGATGG + Intronic
974826201 4:67134009-67134031 GAACTTTGCAGGAACACAGATGG + Intergenic
975364450 4:73512432-73512454 GTCATTTGCAACAACACAGATGG - Intergenic
975391130 4:73818592-73818614 GCCATTTGCAGCAACATAGATGG + Intergenic
975417926 4:74127551-74127573 GTCATTTGCAGCAACATAGATGG - Intronic
975440112 4:74400418-74400440 GACACCTGTAGAAGGACAGAGGG + Intergenic
976074408 4:81280694-81280716 GACATGTGCAAAAGCACACGTGG + Intergenic
976498116 4:85754231-85754253 GTCATTTGCAGCAGCATGGATGG - Intronic
977029689 4:91865810-91865832 GACATTTGTTAAAGCAGAGAAGG - Intergenic
977033557 4:91919521-91919543 GTCATTTGCAGCAACATAGATGG - Intergenic
977254050 4:94720552-94720574 GTCATTTGCGGCAACACAGATGG + Intergenic
977307936 4:95348804-95348826 GTCATTTGCAAAAACACAGGTGG + Intronic
977587731 4:98793001-98793023 AATATTTGTAGTAGCACAGATGG - Intergenic
978008026 4:103642496-103642518 GTCATTTGCAGCAACATAGATGG + Intronic
978095839 4:104776196-104776218 GTCATTTGCAGCAACAGAGAGGG - Intergenic
978154903 4:105478248-105478270 GTCCTTTGCAGCAACACAGATGG + Intergenic
978614258 4:110577995-110578017 GTCTTTTGCAGTAACACAGATGG - Intergenic
978674508 4:111294937-111294959 GTCATTTGCAGCATCATAGATGG + Intergenic
978764250 4:112388079-112388101 GTCTTTTGCAGGAACACAGATGG - Intronic
980295483 4:130909655-130909677 GCCACTTGCAAAAACACAGATGG + Intergenic
980440613 4:132839440-132839462 GAGATTTTCAGAAGAAGAGATGG + Intergenic
980499837 4:133634972-133634994 GAGATTTCCAGAAAAACAGAAGG - Intergenic
980868275 4:138579803-138579825 GTCATTTTCAGCAGCACGGATGG - Intergenic
981414821 4:144480540-144480562 GTCATTTGCAGCAACATAGATGG + Intergenic
982729436 4:158940206-158940228 GAAATTTGGACAAGTACAGAGGG - Intronic
982797215 4:159660811-159660833 GACCTTTGCAGGAACATAGAAGG - Intergenic
983102688 4:163644832-163644854 GACTTTTGAAGATGCACAGTGGG - Intronic
983188013 4:164722858-164722880 GAGTTTTCCAGAAGCAGAGAAGG - Intergenic
984139325 4:175983411-175983433 GACATTTTAAAAATCACAGAGGG - Intronic
984212163 4:176863293-176863315 GTCCTTTGCAGGAACACAGATGG + Intergenic
984457679 4:179991654-179991676 GTCATTTGCAGAAACATGGATGG + Intergenic
985059607 4:186063961-186063983 GCCAGATGCAGAAGGACAGAAGG + Intergenic
985775826 5:1841231-1841253 GACCTTTGGAGAAGCCGAGAGGG + Intergenic
985952441 5:3233321-3233343 ATCATTTGCAGCAACACAGATGG - Intergenic
986263660 5:6173574-6173596 GTCATATGCAACAGCACAGATGG + Intergenic
986264049 5:6177422-6177444 GTCCTTTGCAGAAACATAGATGG + Intergenic
986562503 5:9076243-9076265 GTCATTTGCAGCAACACAAATGG + Intronic
987439449 5:17938584-17938606 GTCATTTGCAGCAACATAGATGG + Intergenic
987864315 5:23520639-23520661 GAAATGTAGAGAAGCACAGAGGG - Intronic
987872121 5:23633840-23633862 GTCATTTGCAGCAGCATGGATGG + Intergenic
988012606 5:25509421-25509443 GACATTTCCAGAGGCACAGCCGG + Intergenic
988641708 5:33048080-33048102 GTCATTTGCAGTAGCATGGATGG + Intergenic
988791992 5:34617251-34617273 TACATTTGCAGAACAAAAGATGG - Intergenic
988810197 5:34777359-34777381 GTCATTTGCAGCAACATAGATGG + Intronic
989709048 5:44374226-44374248 GACATACGTAGAAGCACAGAAGG - Intronic
989760546 5:45011028-45011050 GCCATTTGCAAAAACACTGATGG + Intergenic
990227708 5:53674423-53674445 GGCATTTGAAGAAACAGAGAAGG - Intronic
990648511 5:57871081-57871103 GTCATTTGCAACAACACAGATGG - Intergenic
990975157 5:61553601-61553623 GTCATTTGCAGCAACACAGCTGG - Intergenic
991093415 5:62714791-62714813 GACATTTGCAGAAGCACTGGTGG - Intergenic
991106269 5:62845752-62845774 GTCATTTGCAGCAACACAGATGG - Intergenic
991455842 5:66803249-66803271 GACATTGGCACAGGGACAGATGG - Intronic
992453707 5:76896339-76896361 GTCATTTGCAACAACACAGATGG - Intronic
993206547 5:84888768-84888790 GTCATTTGCAACAACACAGATGG - Intergenic
993208527 5:84918757-84918779 GACCTTTGCAGGGACACAGATGG + Intergenic
993331149 5:86601931-86601953 ATCATTTGCAGCAACACAGATGG + Intergenic
993950207 5:94165690-94165712 GTCATTTGCAACAGCACGGATGG + Intronic
994567674 5:101472352-101472374 GAGAATGGCAGAAGCACAGAGGG + Intergenic
995575065 5:113521064-113521086 GTCCTTTGCAGGAACACAGATGG - Intronic
995637540 5:114211400-114211422 GACCTTTGCAGAAACATGGATGG + Intergenic
995711242 5:115037984-115038006 GACAATTGCAAAAGCAAAAAGGG - Intergenic
996388080 5:122929931-122929953 CAGATATGCAGAAGCACAAATGG - Intronic
996591191 5:125149536-125149558 CACATTTGAAGAACCACAAAAGG + Intergenic
996750550 5:126884307-126884329 GACAGCTGAAGATGCACAGAAGG + Intronic
996759554 5:126973552-126973574 GACAATTGCAGAAGTGCAGAGGG + Intronic
997041102 5:130255676-130255698 GTCATTTGCAACAACACAGATGG - Intergenic
997059554 5:130484997-130485019 GCCATTTGCAAAAGCATGGATGG - Intergenic
998486697 5:142509175-142509197 AACAATTGCAAAAGCAAAGAAGG - Intergenic
998926622 5:147133651-147133673 GCCTTTTGCAGGAACACAGATGG - Intergenic
999455317 5:151710877-151710899 GTCATTTGCAGCAACACAGATGG - Intergenic
999503185 5:152167131-152167153 CACATTTGCAGCAGCCCAGAAGG + Intergenic
999983705 5:156982996-156983018 GTCCTTGGCAGGAGCACAGATGG + Intergenic
1000107263 5:158071939-158071961 GTCATTTGCAACAACACAGATGG + Intergenic
1000521187 5:162296543-162296565 GTCCTTTGCAGCAACACAGATGG - Intergenic
1000567803 5:162872171-162872193 GACATTAGCAAAAACACAAAAGG - Intergenic
1000613025 5:163396256-163396278 GACTTTTGCAGCAACACTGATGG + Intergenic
1003711321 6:8594016-8594038 ATCATTTGCAGCAACACAGATGG + Intergenic
1003747772 6:9022454-9022476 GACATTCCCAGAGACACAGAAGG - Intergenic
1004491763 6:16124409-16124431 TTCATTTGTAGAAGCACTGAGGG - Intergenic
1007169146 6:39850217-39850239 GGCATAAGCAGAGGCACAGAAGG - Intronic
1007886852 6:45239845-45239867 AACAATTGCAAAAGCACAAAGGG + Intronic
1009329228 6:62395141-62395163 GTCATTTGCAAAAACATAGATGG - Intergenic
1009619988 6:66063476-66063498 GAAATTTGCATAAGTACAAAAGG + Intergenic
1009672749 6:66777667-66777689 GTCCTTTGCAGGAACACAGATGG + Intergenic
1010432137 6:75790039-75790061 GTCATTTGCAGGAACACAGATGG - Intronic
1010841454 6:80652203-80652225 GGCATTTGCAGAAGAAAATAAGG + Intergenic
1011176272 6:84564302-84564324 GTCATCTGCAGCAACACAGATGG + Intergenic
1011294717 6:85813914-85813936 GTCATTTGCAGCAACACGGATGG - Intergenic
1011385480 6:86793097-86793119 GTCATTTGCAACAACACAGATGG - Intergenic
1011429480 6:87269967-87269989 GTCCTTTGCAGGAACACAGATGG - Intergenic
1012470285 6:99565119-99565141 GAAATTTTCAGAAGAATAGAAGG - Intronic
1012666661 6:101979489-101979511 GACATTTGCTGAATGCCAGAGGG + Intronic
1012765872 6:103366096-103366118 GCCATTTGCAGCAACATAGATGG + Intergenic
1013519619 6:110921152-110921174 GACAATTGCAAAAGCAGAAAGGG + Intergenic
1014059637 6:117056049-117056071 GGCATTTGCAGCAACATAGATGG - Intergenic
1014095376 6:117454157-117454179 CACATTTTCAGAAGTACACAAGG - Intronic
1014511799 6:122331628-122331650 GTCCTTTGCAGCAACACAGATGG + Intergenic
1015594626 6:134854618-134854640 GTCATTTGCAGCAACACGGATGG - Intergenic
1015598055 6:134884975-134884997 GTCATTTACAGCATCACAGATGG + Intergenic
1015907692 6:138134791-138134813 GTCATTTGCAGCAACATAGATGG + Intergenic
1015931121 6:138360698-138360720 GTCCTTTGCAGCAGCATAGAGGG - Intergenic
1016060964 6:139629511-139629533 GTCATTTGCAACAACACAGATGG - Intergenic
1017061046 6:150485309-150485331 GTCATTTGCAGCAACACAGATGG - Intergenic
1017132722 6:151121909-151121931 GAAATTTGGAGAGGCCCAGAGGG + Intergenic
1017525449 6:155237933-155237955 GACATTTGCATAAGTAAAGAGGG - Intronic
1019168645 6:170116280-170116302 GACATTTGCAGAAATAGAGCTGG - Intergenic
1019391914 7:793039-793061 GACTTTTGCAGCAACATAGATGG + Intergenic
1019664790 7:2246427-2246449 GACATTTGCAGAAGCACAGAGGG + Intronic
1019860518 7:3654149-3654171 GACATTTACAGAAGCACGGTGGG - Intronic
1019899270 7:4007296-4007318 GGCAGTTGCAGAACCCCAGAAGG + Intronic
1021016673 7:15544060-15544082 GGCATTTGCAGCAACCCAGATGG + Intronic
1021312959 7:19116127-19116149 GACATCTGCAAAAACCCAGAGGG + Exonic
1021381966 7:19978687-19978709 GTCATTTGCAACAGCATAGATGG - Intergenic
1021519623 7:21526517-21526539 GAAATTTGCATAAGTAAAGAGGG + Intergenic
1022029294 7:26477794-26477816 GTCAGTTTCTGAAGCACAGAGGG + Intergenic
1022754572 7:33272080-33272102 GTCATTTGCAGAAACATGGATGG + Intronic
1022874251 7:34512588-34512610 GTCAACTGCAGAAACACAGAGGG + Intergenic
1022986349 7:35658166-35658188 GTCATTTGCAGCAACACAAATGG + Intronic
1023044656 7:36200282-36200304 GTCCTTGGCAGAAACACAGACGG - Intronic
1023275457 7:38514695-38514717 GACATTGGCAGAAGGACAGAAGG - Intronic
1023505423 7:40895151-40895173 GACCTTTGCAGCAACATAGATGG + Intergenic
1023782845 7:43673833-43673855 GTCCTTTGCAGCAACACAGATGG + Intronic
1024285449 7:47753351-47753373 GTCATTTGTGGCAGCACAGATGG - Intronic
1024434540 7:49334778-49334800 GTCATTTGCAGCAACATAGATGG + Intergenic
1024923189 7:54582768-54582790 GTCATTTGCAGCAACATAGATGG + Intergenic
1026526496 7:71157928-71157950 GTCATTTGCAGCAACACGGATGG - Intronic
1027110854 7:75438488-75438510 GAGATTTGCAACAGCCCAGAGGG - Intronic
1027367848 7:77477088-77477110 GACATTTGCAACAACACGGATGG - Intergenic
1027377631 7:77568792-77568814 AATAGTTGCAGAAACACAGAGGG - Intronic
1027570184 7:79856404-79856426 GTCATTTGCAGCAACATAGATGG - Intergenic
1028127672 7:87132731-87132753 GTCATTTGCAAAAACACAGATGG + Intergenic
1028490131 7:91401855-91401877 GGCATTTGCAGCAACTCAGATGG - Intergenic
1030285193 7:107818866-107818888 GTCATTTGCAGCAACATAGATGG + Intergenic
1030294790 7:107912135-107912157 GTCATTTGCAACAGAACAGATGG - Intronic
1030668999 7:112314307-112314329 GACCCTTGCATAAGCAAAGATGG + Intronic
1030699992 7:112627579-112627601 GTCATTTGCAGAAGCATGGATGG - Intergenic
1030732419 7:113005866-113005888 GTCCTTTGCAGAAGCATGGATGG + Intergenic
1030807986 7:113939201-113939223 GCCATTTGCAGAAACATGGATGG - Intronic
1031174152 7:118328412-118328434 GTCATTTGCAGGAACATAGATGG + Intergenic
1031174872 7:118337769-118337791 GTCATTTGCAAAAACATAGATGG - Intergenic
1031204114 7:118732197-118732219 GCCATTTGCAAAGACACAGAAGG + Intergenic
1031234883 7:119162443-119162465 GTCATTTGCAACTGCACAGAGGG - Intergenic
1031683523 7:124704100-124704122 GTCATTTGCAGAAACATGGATGG - Intergenic
1032481136 7:132248143-132248165 GGCAATGACAGAAGCACAGAAGG - Intronic
1033824902 7:145177656-145177678 GACATTTGAATAAGATCAGAAGG - Intergenic
1034066287 7:148140090-148140112 GACAGGGGTAGAAGCACAGATGG + Intronic
1034362318 7:150511070-150511092 GAAATTTGAATAAGCACACAGGG + Intergenic
1034416265 7:150965781-150965803 GGCAGTTGCAGAAGAACTGAGGG + Intronic
1034587912 7:152112203-152112225 TACATTTGCAGAAATACAGAAGG - Intronic
1034628795 7:152514731-152514753 GACTGATGCAGAGGCACAGAAGG + Intergenic
1034683505 7:152949264-152949286 GTCCTTTGCAGCAACACAGATGG - Intergenic
1034773242 7:153800261-153800283 GTCATTTCCAGAAACACACATGG + Intergenic
1035214293 7:157353464-157353486 GACATTAGCAGAAAAACAGGTGG - Intronic
1035702870 8:1650671-1650693 GACAGTTGCTGGAGCAGAGATGG + Intronic
1035702891 8:1650821-1650843 GACAGTTGCTGGAGCAGAGATGG + Intronic
1035702897 8:1650871-1650893 GACAGTTGCTGGAGCAGAGATGG + Intronic
1035702903 8:1650921-1650943 GACAGTTGCTGGAGCAGAGATGG + Intronic
1035870555 8:3132899-3132921 GATATTTCCTGGAGCACAGAAGG - Intronic
1036054592 8:5237727-5237749 GACATATTTTGAAGCACAGAGGG + Intergenic
1037884948 8:22590965-22590987 GGCATTTGCAGAGGCACAGGGGG + Intronic
1038016166 8:23516987-23517009 GACAGTGACAGAAGGACAGAGGG + Intergenic
1038391796 8:27208741-27208763 ACCATTTGCATAAGCACAGAAGG + Intergenic
1038684269 8:29702186-29702208 GAAATTTGCATAAGCAAACAGGG + Intergenic
1038750448 8:30290159-30290181 GTCCTTTGCAGAGACACAGATGG - Intergenic
1038751690 8:30301985-30302007 GACATTTGCAGCTGGAGAGAAGG - Intergenic
1038922195 8:32097147-32097169 GTCATTTGCAGCAACATAGATGG - Intronic
1039244873 8:35597615-35597637 GACTTTGGCAGCAGCAGAGAGGG + Intronic
1040933386 8:52758605-52758627 GTCATTTGCAGAAACATGGATGG + Intergenic
1042017585 8:64332679-64332701 GACAGGTGTAGGAGCACAGAAGG - Intergenic
1043136961 8:76539852-76539874 CACATTTTTAGAAGCACACATGG + Intergenic
1043145556 8:76649106-76649128 GTCATTTGCAGCAGCATGGATGG + Intergenic
1043840750 8:85100858-85100880 GTCATTTGCAGAAACACGGATGG - Intergenic
1043988587 8:86723869-86723891 GTCCTTTGCAGCAACACAGATGG + Intronic
1044035490 8:87298366-87298388 CTCATTTTCAGAAGCAGAGAAGG - Intronic
1044047130 8:87450149-87450171 GTCATTTGCAGCAACATAGATGG + Intronic
1044645825 8:94442078-94442100 GACATTTGCAGCAACATGGATGG + Intronic
1044889691 8:96820614-96820636 GTCATTTGCAGCAACATAGATGG - Intronic
1045698815 8:104842016-104842038 GTCATTTGCAGTAACACGGATGG - Intronic
1045703781 8:104896977-104896999 GGCAATGGCAGAAGCACAAAAGG - Intronic
1046398938 8:113678078-113678100 GTCCTTTGCAGAAACATAGATGG + Intergenic
1046399728 8:113689231-113689253 GTCATTTGCAGCAACACGGATGG - Intergenic
1046460537 8:114528395-114528417 TACATTAGCTGAAGCACAGTAGG - Intergenic
1046711194 8:117513451-117513473 GACATTTGAAAAAGCAGAGTAGG - Intergenic
1047134597 8:122062107-122062129 CACAATTTCAGCAGCACAGATGG - Intergenic
1047316065 8:123734192-123734214 GATATGTGCAGAATGACAGAGGG - Intronic
1047654717 8:126964606-126964628 GACATTTGCATGTGCACAGCTGG + Intergenic
1048028270 8:130606721-130606743 GAGATTAGCAGAAGAAGAGAAGG + Intergenic
1048067083 8:130981150-130981172 GACATTTGCAAAAGATTAGAAGG + Intronic
1048705924 8:137153939-137153961 GCCATTTGCAACAACACAGATGG - Intergenic
1048855028 8:138679575-138679597 AACATTTGCAAAAAGACAGAAGG - Intronic
1049066011 8:140314743-140314765 GTCATTTGCAACAACACAGATGG - Intronic
1049121923 8:140747371-140747393 CACATATGCAGAAGGAAAGAAGG - Intronic
1049239014 8:141527298-141527320 AACATGTGCACAAGCACAGAGGG - Intergenic
1049660688 8:143818530-143818552 GCCATCTGCAGCAGGACAGAGGG + Exonic
1050087933 9:1985996-1986018 GTCATTTGCAACAGCATAGATGG - Intergenic
1050150151 9:2611785-2611807 GTCATTTGCAGTAACATAGATGG - Intergenic
1050713272 9:8490186-8490208 CACATTGGAAGAAGCAGAGAAGG + Intronic
1050728294 9:8677359-8677381 GTCCTTTGCAGTAACACAGATGG + Intronic
1050734166 9:8744487-8744509 GGCATTTGCAGCAACACAGATGG + Intronic
1051016816 9:12487525-12487547 GTCATTTGCAACAACACAGATGG + Intergenic
1051087826 9:13371401-13371423 GTCATTTGCAACAGCACGGATGG - Intergenic
1051921598 9:22273588-22273610 GTCCTTTGCAGTAACACAGATGG + Intergenic
1052256467 9:26462734-26462756 GACATTTGCAGAACAACATAGGG + Intergenic
1052400682 9:27996468-27996490 GTCATTTGCAGTAACATAGATGG + Intronic
1052733298 9:32314834-32314856 GTCATTTGCAGCAACATAGATGG + Intergenic
1052903007 9:33811056-33811078 GTCCTTTGCAGCAACACAGATGG + Intergenic
1052940795 9:34130576-34130598 GAAATTTCCAGAACCTCAGAAGG - Intergenic
1053115104 9:35493285-35493307 GTCTTTTGCAGAAACATAGATGG - Intronic
1053372986 9:37578048-37578070 GTCATTTGCAGCAACACAGATGG + Intronic
1055008304 9:71534830-71534852 GACCTTTGCAGCAACACAGATGG + Intergenic
1055330709 9:75180284-75180306 TACATTTTCAGAAACACAAAAGG - Intergenic
1055487606 9:76772495-76772517 GACTTTTGCAAAACTACAGAAGG - Intronic
1055662087 9:78514403-78514425 GTCATTTGCAGCAACACAGATGG + Intergenic
1055670746 9:78603635-78603657 GTCATTTGCAGCAACACAGATGG + Intergenic
1055874948 9:80931308-80931330 GTCCTTTGCAGGAACACAGATGG + Intergenic
1055910740 9:81347919-81347941 GTCATTTGCAGTAGCCTAGAAGG - Intergenic
1055931069 9:81560298-81560320 AACATTTCCAGAACCACAGAGGG - Intergenic
1056175680 9:84032861-84032883 GTCATTTGCAACAACACAGATGG - Intergenic
1056935956 9:90914847-90914869 AACATTACCAGAAGGACAGAGGG + Intergenic
1057453907 9:95190464-95190486 GTGAGTTGCAGAAGCAAAGAAGG - Intronic
1057556313 9:96090781-96090803 GTCCTTTGCAGGAACACAGATGG - Intergenic
1057895375 9:98904633-98904655 CACATGAGCAGATGCACAGAAGG - Intergenic
1058109131 9:101011866-101011888 GACATTTGCAACAACATAGATGG + Intergenic
1059214581 9:112548892-112548914 GAGATTTGTACAGGCACAGAGGG + Intronic
1059633064 9:116145532-116145554 GTCTTTTGTAGCAGCACAGATGG + Intergenic
1059722162 9:116970498-116970520 GACAGTTGAAGAAGAATAGAGGG - Intronic
1059999458 9:119944995-119945017 GGCATTTGTAAAAGCTCAGAGGG - Intergenic
1061288439 9:129637467-129637489 GGCATTTGCAGAAGCTGGGAAGG - Exonic
1062424727 9:136500843-136500865 GCCATCTGCAGAGGCAGAGACGG + Exonic
1185841608 X:3397190-3397212 GTCTTTTGCAGCAACACAGATGG - Intergenic
1185934980 X:4246244-4246266 GTCCTTTGCAGCAACACAGATGG - Intergenic
1186054934 X:5640271-5640293 GTCATTCACAGCAGCACAGATGG - Intergenic
1187119405 X:16389100-16389122 GTCATTAGCAGAAGCTCAGCTGG - Intergenic
1187238021 X:17486556-17486578 GGCAATGGCAGAAGCACAGGAGG + Intronic
1187604127 X:20864641-20864663 AACATTTGCTGAACCATAGACGG + Intergenic
1187653647 X:21442839-21442861 GTCCTTTGCAGCAACACAGATGG + Intronic
1187778152 X:22787312-22787334 GTCATTTGCAGCAACATAGATGG + Intergenic
1188020137 X:25148203-25148225 GTCATTTGCAGCAACATAGACGG - Intergenic
1188031371 X:25267913-25267935 GAGACTTCCAGAAGCACAGACGG - Intergenic
1188064490 X:25641755-25641777 GTCATTTGCAGCAACATAGATGG - Intergenic
1188634905 X:32417471-32417493 GACATCTTCAGAAGCAGAGTTGG - Intronic
1188724975 X:33571863-33571885 GTCCTTTGCAGCAACACAGATGG - Intergenic
1189247320 X:39573402-39573424 GTCTTTTGCAGCAACACAGATGG + Intergenic
1189854048 X:45205334-45205356 GTCATTTGCATCAACACAGATGG - Intergenic
1190107461 X:47570440-47570462 GACTATTCCAGAAGCACAAAGGG - Intronic
1190445309 X:50518031-50518053 GACACGTGCAGAATCACTGAGGG - Intergenic
1190488127 X:50950800-50950822 GTAATTTGCAGAATCACGGATGG + Intergenic
1190620991 X:52287002-52287024 GTCATTTGCAGTAACATAGATGG - Intergenic
1191164318 X:57371397-57371419 TTCATTTGCAGAAGCATGGATGG - Intronic
1191210641 X:57881658-57881680 AGCATTTGCAGGAACACAGATGG + Intergenic
1191592119 X:62898238-62898260 GTCATTTGCAACAACACAGATGG - Intergenic
1191680671 X:63836876-63836898 GACAATTCTAGAAGCACTGAAGG + Intergenic
1191752274 X:64555861-64555883 GTCCTTTGCAGCAGCACGGATGG + Intergenic
1191800365 X:65072822-65072844 GATGTTTGCAGAAGCAGAGGAGG + Intergenic
1192347193 X:70320512-70320534 GTCATTTGCAGCAACATAGATGG + Intronic
1193046153 X:77056864-77056886 GGTTTTTGCAGAAACACAGATGG + Intergenic
1193258126 X:79374171-79374193 GACATTTGCAGAGACATGGACGG - Intergenic
1193334062 X:80266559-80266581 GATATGTGGAGAATCACAGAGGG - Intergenic
1193529375 X:82637711-82637733 GTCCTTTGCAGGGGCACAGATGG - Intergenic
1193623966 X:83794156-83794178 GACATTTGCAGTGGCAGTGAGGG - Intergenic
1193870558 X:86792676-86792698 GTCATTTGCAGCAACATAGATGG - Intronic
1194260980 X:91695298-91695320 GTCATTTGCAGCAACACAGATGG - Intergenic
1194323799 X:92484571-92484593 GGCATTTGCAGCAGCCCGGATGG + Intronic
1194535188 X:95097225-95097247 GCCTTTTGCAGCATCACAGAGGG + Intergenic
1194563652 X:95454220-95454242 GTCCTTTGCAGGAGCATAGATGG - Intergenic
1195250786 X:103044545-103044567 GTCATTTGCAACAACACAGATGG - Intergenic
1195839896 X:109163147-109163169 GTCATTTGCAGTAACATAGATGG - Intergenic
1195929257 X:110057319-110057341 ATCATTTGCAGTAACACAGAAGG - Intronic
1196238235 X:113307979-113308001 GTCATTTGCAGCAGCATGGATGG + Intergenic
1196407690 X:115382273-115382295 GACATTTGCAACAACATAGATGG + Intergenic
1196505056 X:116432235-116432257 AACATTAGCAGAACCTCAGAAGG - Intergenic
1197329840 X:125140274-125140296 GTCATTTGCAGAAACATGGATGG + Intergenic
1197339390 X:125247217-125247239 GTCTTTTGCAAAAACACAGATGG + Intergenic
1197359939 X:125488707-125488729 GTCCTTTGCAGAAACACAGATGG + Intergenic
1197407279 X:126067594-126067616 GTCCTTTGCAGGAACACAGACGG + Intergenic
1197463848 X:126777109-126777131 GACATTTGCAGCAACCTAGATGG - Intergenic
1197463861 X:126779618-126779640 GACATTTGCAGCAACCTAGACGG + Intergenic
1197897742 X:131333441-131333463 GTCATTTGCAACAACACAGATGG - Intronic
1198585921 X:138122184-138122206 GTCATTTGCAACAGCATAGATGG - Intergenic
1198729870 X:139717579-139717601 GAAACTGGCAGAAGCAAAGAAGG + Intergenic
1198733216 X:139756658-139756680 GTCATTTGCAGCAACACGGATGG + Intronic
1199181287 X:144856884-144856906 GTCATTTGCAGCAACATAGATGG + Intergenic
1199886124 X:152023641-152023663 GCCATCTGCAGCAACACAGATGG - Intergenic
1199908422 X:152259610-152259632 GACATTTCTAGAAACACAGCGGG + Intronic
1200579630 Y:4934100-4934122 GTCATTTGCAGCAACACAGATGG - Intergenic
1200598482 Y:5177537-5177559 GACATTTGCAACAGCATGGATGG + Intronic
1201235070 Y:11901337-11901359 GTCTTTTGCAGCAACACAGATGG + Intergenic
1201269167 Y:12237628-12237650 GTCCTTTGCAGGAACACAGATGG - Intergenic
1201618019 Y:15923406-15923428 GTCTTTTGCAGGAACACAGATGG - Intergenic
1202088645 Y:21164947-21164969 GACAATAACAGAAGGACAGAGGG - Intergenic
1202276309 Y:23124152-23124174 GTCATTTGCAGCAACACGGATGG + Intergenic
1202289719 Y:23296538-23296560 GTCATTTGCAGCAACACGGATGG - Intergenic
1202429303 Y:24757877-24757899 GTCATTTGCAGCAACACGGATGG + Intergenic
1202441488 Y:24912213-24912235 GTCATTTGCAGCAACACGGATGG - Intergenic