ID: 1019664791

View in Genome Browser
Species Human (GRCh38)
Location 7:2246431-2246453
Sequence TTTGCAGAAGCACAGAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019664782_1019664791 22 Left 1019664782 7:2246386-2246408 CCTGACGTTGGCTGGGAGAGTGT 0: 1
1: 0
2: 0
3: 13
4: 85
Right 1019664791 7:2246431-2246453 TTTGCAGAAGCACAGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019664791 Original CRISPR TTTGCAGAAGCACAGAGGGC TGG Intronic
No off target data available for this crispr