ID: 1019664930

View in Genome Browser
Species Human (GRCh38)
Location 7:2247141-2247163
Sequence CACGGGCCTGGGGTTGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 311}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019664930_1019664947 28 Left 1019664930 7:2247141-2247163 CCTGGGGCAACCCCAGGCCCGTG 0: 1
1: 0
2: 2
3: 21
4: 311
Right 1019664947 7:2247192-2247214 CGTCGGCAGCCCGGTCTCTGGGG No data
1019664930_1019664945 26 Left 1019664930 7:2247141-2247163 CCTGGGGCAACCCCAGGCCCGTG 0: 1
1: 0
2: 2
3: 21
4: 311
Right 1019664945 7:2247190-2247212 AGCGTCGGCAGCCCGGTCTCTGG No data
1019664930_1019664941 0 Left 1019664930 7:2247141-2247163 CCTGGGGCAACCCCAGGCCCGTG 0: 1
1: 0
2: 2
3: 21
4: 311
Right 1019664941 7:2247164-2247186 CTGCTCAGGAGCGGGAGGCAGGG 0: 1
1: 0
2: 5
3: 182
4: 3168
1019664930_1019664944 19 Left 1019664930 7:2247141-2247163 CCTGGGGCAACCCCAGGCCCGTG 0: 1
1: 0
2: 2
3: 21
4: 311
Right 1019664944 7:2247183-2247205 AGGGAGGAGCGTCGGCAGCCCGG 0: 1
1: 0
2: 1
3: 17
4: 264
1019664930_1019664939 -5 Left 1019664930 7:2247141-2247163 CCTGGGGCAACCCCAGGCCCGTG 0: 1
1: 0
2: 2
3: 21
4: 311
Right 1019664939 7:2247159-2247181 CCGTGCTGCTCAGGAGCGGGAGG No data
1019664930_1019664935 -9 Left 1019664930 7:2247141-2247163 CCTGGGGCAACCCCAGGCCCGTG 0: 1
1: 0
2: 2
3: 21
4: 311
Right 1019664935 7:2247155-2247177 AGGCCCGTGCTGCTCAGGAGCGG 0: 1
1: 0
2: 0
3: 22
4: 206
1019664930_1019664936 -8 Left 1019664930 7:2247141-2247163 CCTGGGGCAACCCCAGGCCCGTG 0: 1
1: 0
2: 2
3: 21
4: 311
Right 1019664936 7:2247156-2247178 GGCCCGTGCTGCTCAGGAGCGGG 0: 1
1: 0
2: 3
3: 22
4: 205
1019664930_1019664943 11 Left 1019664930 7:2247141-2247163 CCTGGGGCAACCCCAGGCCCGTG 0: 1
1: 0
2: 2
3: 21
4: 311
Right 1019664943 7:2247175-2247197 CGGGAGGCAGGGAGGAGCGTCGG 0: 1
1: 0
2: 4
3: 87
4: 836
1019664930_1019664940 -1 Left 1019664930 7:2247141-2247163 CCTGGGGCAACCCCAGGCCCGTG 0: 1
1: 0
2: 2
3: 21
4: 311
Right 1019664940 7:2247163-2247185 GCTGCTCAGGAGCGGGAGGCAGG 0: 1
1: 2
2: 77
3: 4536
4: 97794
1019664930_1019664946 27 Left 1019664930 7:2247141-2247163 CCTGGGGCAACCCCAGGCCCGTG 0: 1
1: 0
2: 2
3: 21
4: 311
Right 1019664946 7:2247191-2247213 GCGTCGGCAGCCCGGTCTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1019664930_1019664942 3 Left 1019664930 7:2247141-2247163 CCTGGGGCAACCCCAGGCCCGTG 0: 1
1: 0
2: 2
3: 21
4: 311
Right 1019664942 7:2247167-2247189 CTCAGGAGCGGGAGGCAGGGAGG 0: 1
1: 0
2: 8
3: 110
4: 1121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019664930 Original CRISPR CACGGGCCTGGGGTTGCCCC AGG (reversed) Intronic
900032548 1:381708-381730 CAGGGGCCTGGGCCTGCTCCGGG + Intergenic
900053305 1:610770-610792 CAGGGGCCTGGGCCTGCTCCGGG + Intergenic
900376096 1:2355543-2355565 CACGGGCATGGAGGTGGCCCTGG + Intronic
900502340 1:3012612-3012634 CACGGGCCTGGGGAGGCGGCGGG - Intergenic
901207545 1:7505580-7505602 CAGGGACCTGGCGGTGCCCCAGG + Intronic
902349968 1:15847394-15847416 CCGGGGCCTGGGGTTGCCGCTGG + Intergenic
902537786 1:17131214-17131236 CATGGGGCTGGGGCTGCCCAAGG + Intergenic
904449032 1:30599186-30599208 CAGGGGGCAGGGGTTGTCCCTGG - Intergenic
904551743 1:31324759-31324781 CATGGGCCTGCAGGTGCCCCTGG + Intronic
905146881 1:35893833-35893855 CACTGGACTTGGGGTGCCCCTGG - Intronic
905169195 1:36099406-36099428 CCCGGGCCTCGGGGTCCCCCTGG - Exonic
905589821 1:39153600-39153622 CCCAGGCCTGGGGTGGCCACAGG + Intronic
906732645 1:48096454-48096476 CATGGGGCTGGGGATGCACCAGG - Intergenic
907310567 1:53536764-53536786 CCCAGGCCTGGCCTTGCCCCAGG - Intronic
907468026 1:54652438-54652460 CTAGGAGCTGGGGTTGCCCCAGG + Intronic
907744461 1:57198983-57199005 CAGTGGCCTGGGGGTGCCCATGG - Intronic
907890612 1:58632982-58633004 CATGGGGCTGGGGTTGCCATAGG + Intergenic
908903030 1:68978147-68978169 CACGGGTCTGGGGTAGAGCCAGG - Intergenic
914196118 1:145448886-145448908 CACTGGGGTGGGGTGGCCCCTGG - Intergenic
914947556 1:152080187-152080209 CAAGGGCCTGGGATTGTACCAGG + Intergenic
915361517 1:155288796-155288818 CATGGGCCTGGGCCTGCACCTGG - Exonic
915368137 1:155326734-155326756 CAGGGGCCTGAGGTGGGCCCAGG - Exonic
915980105 1:160415207-160415229 AAGAGGCCTGGGGTAGCCCCTGG + Intronic
919763132 1:201110854-201110876 CATGGGCCTGGGGTACCCTCTGG - Intronic
919782390 1:201229262-201229284 CACAGGGCTGGGGTTGCCTAGGG + Intergenic
922684634 1:227629651-227629673 CATGGGCCGGCGCTTGCCCCGGG + Intronic
922742185 1:228020289-228020311 GAGGGGCCTGGGGGTGCCCATGG - Intronic
1062834843 10:628876-628898 CCTGGGGCTGGGGGTGCCCCTGG - Intronic
1063439616 10:6062064-6062086 TAAGGGCCTGTGGGTGCCCCCGG - Intronic
1064852560 10:19725425-19725447 CACAGGCCTGGGGAGGCCTCAGG - Intronic
1065350482 10:24791313-24791335 CACTGGCCTGGCATTGCCTCGGG + Intergenic
1066026403 10:31363429-31363451 CAAGGGCCTGGGATTGTACCAGG + Intronic
1066489779 10:35883327-35883349 CATGGTCCTGGGGTTGACCCTGG + Intergenic
1066542112 10:36458609-36458631 CACAGGGCTGGGGAGGCCCCAGG + Intergenic
1067089418 10:43258975-43258997 CACTGGCCTGGGGCTGGCCCTGG + Intronic
1067474720 10:46557619-46557641 CCAGGGCCTGGGCTGGCCCCCGG - Intergenic
1069597368 10:69681145-69681167 CACGGCCCTGGGGATTCCCCAGG + Intergenic
1069823580 10:71242084-71242106 CAGGGGGCTGGGGTTGGCCTAGG - Intronic
1071153901 10:82667642-82667664 CACTTGGCTGGGGGTGCCCCAGG - Intronic
1072052090 10:91714830-91714852 CACGTGCCTGGGGAGGCCTCAGG - Intergenic
1072378048 10:94837773-94837795 CATGGGCTGGGGCTTGCCCCAGG + Intronic
1072717365 10:97760709-97760731 CACTGGCCTGGGTAAGCCCCTGG - Exonic
1073179450 10:101574988-101575010 TAGGGGCCCGAGGTTGCCCCTGG - Intronic
1075204738 10:120437181-120437203 CAAGGGCATGGGGTGACCCCTGG + Intergenic
1075651595 10:124131098-124131120 CCCGGGCCTGGGCTGGACCCTGG - Intergenic
1076348950 10:129801680-129801702 CAGGGGCCTGGTCCTGCCCCTGG + Intergenic
1076549190 10:131267134-131267156 CACTGGCCTGCGGGTACCCCTGG - Intronic
1076563392 10:131381868-131381890 TATGGGCCTGGGTTTGCTCCAGG - Intergenic
1076613863 10:131743617-131743639 CACTGGGCTGTGGGTGCCCCAGG + Intergenic
1076664148 10:132076681-132076703 GACTGGCCTGCGGTGGCCCCGGG + Intergenic
1076664165 10:132076755-132076777 GACTGGCCTGAGGTGGCCCCGGG + Intergenic
1076996264 11:298877-298899 CACTGGCCTGGGATGGCCCCCGG - Intronic
1077130818 11:971556-971578 CACAGGACTGGGGTTTGCCCTGG + Intronic
1077468838 11:2747380-2747402 CTGGGGCCTGGGGGTGGCCCCGG + Intronic
1082835082 11:57645794-57645816 CAGGGGTCTGGGGGTACCCCAGG - Exonic
1083266174 11:61547930-61547952 CAAGGGGCTGGGCCTGCCCCAGG - Intronic
1084396175 11:68911937-68911959 CAGGGGCCTGGAGTTGGCCTGGG + Intronic
1084452750 11:69249816-69249838 CAAGGGGCTGGGGCTGCCCGTGG + Intergenic
1084814898 11:71640071-71640093 GAAGGGGCGGGGGTTGCCCCGGG + Intergenic
1085032581 11:73281667-73281689 CCCAGGCCTGGCCTTGCCCCTGG - Intronic
1085326589 11:75611063-75611085 CACAGGCCTAGGGCTGGCCCAGG + Intronic
1085755525 11:79198377-79198399 CACTGGCCTGGGGAGGCGCCAGG + Intronic
1087874452 11:103339305-103339327 CATGGGCCTTGGGTGACCCCCGG - Intronic
1089497187 11:118913747-118913769 CAAGGGCCAGGGGTTAGCCCAGG + Intronic
1090343167 11:126043663-126043685 CTTAGGCCTGGGGTTGCCCTGGG - Intronic
1091060145 11:132453438-132453460 CCCGGCCCTGGGGATGCCCCTGG - Intronic
1091596669 12:1883162-1883184 CACTGGCCTGCGGCTGCCCCTGG - Intronic
1091838074 12:3600013-3600035 AACAGGCCTGGGGTTGAGCCTGG + Intergenic
1095261709 12:40105813-40105835 CAGGGGCCCGGGGCTGCCCGGGG + Exonic
1096387962 12:51207440-51207462 CACCGGACTGGGGAGGCCCCAGG - Intronic
1098905609 12:76158982-76159004 CACAGGCCTGTGGTTGGCTCTGG - Intergenic
1101941457 12:109102231-109102253 CACGAGCTGGGGGTTGCTCCTGG - Intronic
1102747502 12:115262200-115262222 CTCAGGCCTGGGCTTCCCCCAGG + Intergenic
1103702303 12:122854192-122854214 TCCGGGCCAGGGGTTGCCCTGGG - Intronic
1103898678 12:124291835-124291857 CTGGGGCTTGGGGTTACCCCAGG + Intronic
1103936935 12:124481929-124481951 CTCAGGCCGGGGGTTGCCTCAGG + Intronic
1103939059 12:124492160-124492182 CACGGTCCTGTGGTTCCCCAGGG + Intronic
1104386009 12:128352214-128352236 CACGGGGCTGGGGAGGCCTCAGG + Intronic
1104961977 12:132492576-132492598 CGTGGGCCTGGGATTGGCCCTGG - Intronic
1105069773 12:133227438-133227460 CAGGGGCTTGGGGTGGCCCTGGG - Intronic
1109854452 13:68108828-68108850 CATGTGCCTGGGGTTGGACCTGG + Intergenic
1110568555 13:76980166-76980188 CACGGCCCTGGGGGCGCCACGGG - Intergenic
1110626762 13:77662006-77662028 CAAGGGCCTGGGATTGTACCAGG + Intergenic
1113885078 13:113654632-113654654 CAGGGGCCAGGGGCTGCCCTCGG + Intronic
1118244546 14:64096694-64096716 CACAGGCCTGGGCTTTCTCCTGG - Intronic
1118882592 14:69842054-69842076 CACAGGTCTTGGGTTACCCCTGG - Intergenic
1120377927 14:83733138-83733160 CACAGGGCTGGGGAGGCCCCAGG - Intergenic
1122057861 14:99117100-99117122 CAGGTGCCAGGGGTTGCCCTTGG + Intergenic
1122318012 14:100837033-100837055 CTCGGGCCTGGGGTTGTTCTGGG + Intergenic
1122329469 14:100903001-100903023 CACAGGCCGGGGGCTGCCTCCGG - Intergenic
1122399421 14:101458307-101458329 CACGGGCCTGGCGTGACCCTGGG - Intergenic
1122636610 14:103132584-103132606 CAGGGACCTGAGGTTGGCCCGGG + Intronic
1122661356 14:103297676-103297698 CAAGGGCCTGCGGATGCCACAGG + Intergenic
1122786890 14:104168016-104168038 CCTGGGCCTGGGGGTGCCACAGG + Intronic
1122797273 14:104212331-104212353 CATGGGCTGGGGGCTGCCCCTGG + Intergenic
1122856806 14:104563882-104563904 CACTGGGCTGGGATTCCCCCGGG + Intronic
1122923015 14:104887676-104887698 CACGGGCTCAGGGTTGCCCAGGG - Exonic
1122961020 14:105093652-105093674 CACGGCCCTGGGGTTACAGCCGG - Intergenic
1122979636 14:105185714-105185736 CACCGGGCTGGGGATGCTCCTGG + Intergenic
1202872660 14_GL000225v1_random:177986-178008 GCCGGGCCTGGGGTGGTCCCTGG + Intergenic
1125600936 15:40915541-40915563 CCCAGGCCTGGGGTAGCACCTGG - Intergenic
1125768792 15:42151782-42151804 CACCGACCTGGGTTTGACCCTGG + Intronic
1128146077 15:65333172-65333194 CAGGGCCCTGGGGTTGGGCCTGG + Intronic
1128860656 15:71068555-71068577 CACGTGGCTGGGGAAGCCCCGGG - Intergenic
1130651459 15:85764320-85764342 CACGGGATTGGGGTGGCCTCAGG + Intronic
1132840551 16:1976665-1976687 CAGGTGCCTGGGGGTGACCCAGG + Intronic
1132913063 16:2325687-2325709 CACCTGCCTGCAGTTGCCCCAGG - Intronic
1132975137 16:2707193-2707215 CACAGGCCTGGGGTTAGCTCGGG - Intronic
1133040647 16:3058467-3058489 CACGGAGCTGGGGCTGCCCCCGG + Exonic
1134128636 16:11633179-11633201 CACGGACCTGGGGCAGCCCAGGG + Intronic
1136239137 16:28933403-28933425 GACGGGTCTGTTGTTGCCCCGGG + Exonic
1136554105 16:30997657-30997679 CCCGGGCCTGGCGCTGCCGCGGG - Intronic
1138388298 16:56651686-56651708 CACGGGGCTGGGGTTGCACACGG + Intronic
1138599369 16:58045900-58045922 CTTTGGCCTGGGGCTGCCCCTGG - Exonic
1139112753 16:63911623-63911645 AACGGGCCTGGTTTTGGCCCAGG + Intergenic
1141079210 16:81035969-81035991 CTCGGGCCCGTGGGTGCCCCCGG + Exonic
1141639962 16:85335305-85335327 CCCGGGCCCGGGGCTGCTCCCGG - Intergenic
1141837240 16:86549864-86549886 CACAGGTCTGGGGTTGGGCCTGG + Intronic
1141988259 16:87594041-87594063 CAGGGGGCTTGGGTTGCCCAGGG - Intergenic
1142197041 16:88743802-88743824 CACCTTCCTAGGGTTGCCCCAGG + Intronic
1142980320 17:3667830-3667852 CAGGGGCCTAGGCTAGCCCCCGG + Intronic
1143102389 17:4511611-4511633 CACAGGCCTAGGATTGGCCCCGG + Intronic
1143112188 17:4558953-4558975 CCCCGGCCTGGGGCTGCCCGCGG - Exonic
1144408588 17:14976653-14976675 CACCGGCTTTGGGTTGCCCATGG + Intergenic
1144729171 17:17516879-17516901 CAGGTGCCTGGGGTAGCCACTGG - Intronic
1144833360 17:18143865-18143887 CACAGGCCTCGGGCTGGCCCAGG + Exonic
1145264124 17:21371392-21371414 CTGGGCCCTGGGGGTGCCCCAGG + Intergenic
1146724722 17:35147916-35147938 CATGGGCCTGGGGTGTGCCCTGG + Intronic
1148069914 17:44902687-44902709 CACGGATCTGGGGTTGCCCATGG - Exonic
1148192562 17:45689779-45689801 CTCTGGGCTGGGGGTGCCCCAGG - Intergenic
1150284820 17:63948803-63948825 CATGGGCCTGGGGTTGCCTTGGG + Intronic
1150590332 17:66556798-66556820 CACAGGCCTGGGGAGGCCTCAGG - Intronic
1151512044 17:74566664-74566686 CACAGGTCTGGGCTGGCCCCAGG - Intergenic
1151869345 17:76826031-76826053 CAGGGGGCTGTGGGTGCCCCTGG - Intergenic
1152299527 17:79486908-79486930 CACGAGACTGGGGCAGCCCCTGG + Intronic
1152582368 17:81171919-81171941 GAGGGGCCTGGGGTTTCCTCTGG - Intergenic
1152694081 17:81735093-81735115 CATGGGTCTGGAGTTGTCCCTGG - Intergenic
1152899355 17:82931183-82931205 CACGGGCCTGGTGTCCCCTCGGG + Intronic
1152947392 17:83205474-83205496 CAGGGGCCTGGGCCTGCTCCGGG - Intergenic
1153893329 18:9537920-9537942 CACTGGCCTGGCTTGGCCCCAGG + Exonic
1154992863 18:21612592-21612614 CTCGGGCCTGGGCTTCCGCCTGG + Intronic
1155063155 18:22246476-22246498 CAAGGTCCTGGGGTGGGCCCAGG + Intergenic
1157591769 18:48840596-48840618 AAAGGGCCTGGGGCTGCCCAGGG - Intronic
1159265461 18:66073432-66073454 CACAGGTCTGGAGTTGCCCAAGG - Intergenic
1159424659 18:68269658-68269680 CACGTGGCTGGGGTGGCCTCAGG - Intergenic
1159640511 18:70858560-70858582 CACAGGGCTGGGGATGCCTCAGG - Intergenic
1159908327 18:74119032-74119054 CCAGGGCCTGGGGAGGCCCCAGG - Intronic
1160232469 18:77058468-77058490 CCCGGGCCTGGGGTCGTGCCTGG - Intronic
1160661948 19:305445-305467 CACGGGCGAGGGGGTGCACCGGG - Intergenic
1161015559 19:1981112-1981134 CAGGGGCCTGGGGGCGGCCCTGG + Exonic
1161268009 19:3373965-3373987 GATGGGCCTGGGGTTGTCCGTGG + Intronic
1162144472 19:8605373-8605395 CAGAGGCCTGGGGTGGGCCCTGG + Intronic
1162271713 19:9621361-9621383 AAAGGGCCTGGGGTTGGCTCAGG + Exonic
1162462251 19:10820100-10820122 CAGGGGCCTGGGGATGGCTCGGG + Intronic
1162480265 19:10923471-10923493 TACGGGTCTGGGGTGGCCACAGG - Intronic
1163334310 19:16661087-16661109 GCCGGGCCTGGGGTGGCGCCTGG + Intergenic
1163552623 19:17974065-17974087 CCTGGTCCTGGGGCTGCCCCCGG - Exonic
1163714881 19:18867827-18867849 CCCGGGCCTGGGGCTGTCACTGG + Exonic
1165750040 19:38253837-38253859 CAAGGGCCTGGGGCTGGCCGAGG + Intronic
1165792241 19:38499489-38499511 CAGGGGCCTGGTGTTACCTCTGG + Intronic
1165812402 19:38619405-38619427 CAGGGTCCTGGGCTTGCCGCGGG + Intronic
1165855204 19:38875774-38875796 CTTGGGCCTGGGGCAGCCCCCGG + Intronic
1167246425 19:48375857-48375879 CAGGGGTCGGGGGTTCCCCCAGG + Intronic
1167482906 19:49744206-49744228 AACGGGGCTGGGCTTGCCTCTGG - Intronic
1168399525 19:56076991-56077013 GCTGGGCCGGGGGTTGCCCCAGG + Intergenic
1168578203 19:57531223-57531245 CCTGGGCCTGAGGTGGCCCCAGG - Intronic
925055743 2:855709-855731 CAGGGGCCTGGGCTAACCCCAGG - Intergenic
925467850 2:4125644-4125666 CACGGGCCTCAGTTTGTCCCTGG + Intergenic
926095767 2:10080041-10080063 CACGGGGCTGGGGTCGCGGCCGG + Exonic
927853734 2:26515283-26515305 CACGGGCATGGGGCAGCCCCAGG - Intronic
929164286 2:38865447-38865469 CACAGGGCTGGGGTGGCCTCAGG - Intronic
930728978 2:54709552-54709574 CACTGGCCTGCTGGTGCCCCTGG + Intergenic
930931305 2:56886484-56886506 CACTGGAGTGGGGTTGCCCAAGG + Intergenic
931820092 2:65943192-65943214 CTCAGGCCTGGGTTTGCCACAGG + Intergenic
932063320 2:68528844-68528866 CAAGGGCCTGGGATTGTACCAGG + Intronic
932803023 2:74759361-74759383 CTCTGGCCTGGGGTAGGCCCTGG + Intergenic
932818347 2:74879261-74879283 CACTGGGCTGGGGTGGTCCCTGG - Intronic
935046831 2:99490138-99490160 CCCGAGGCTGGGGTCGCCCCGGG - Intergenic
935449340 2:103190769-103190791 CACTGCCCTGGGGTGGCCCAAGG - Intergenic
935692577 2:105744759-105744781 CCCGGGCCTGGGCCGGCCCCTGG + Intergenic
937000722 2:118464776-118464798 CACAGGGCTGGGGTTGCCGGCGG - Intergenic
937357260 2:121205845-121205867 CCCGGGCCTGGGGGTGGCCAGGG - Intergenic
937739611 2:125334228-125334250 TACTGGCCTTGGGTTGCCCCTGG + Intergenic
938392297 2:130915762-130915784 CAGGGGCCTGGGGGTGCCGGGGG + Intronic
939153932 2:138502148-138502170 CAAGCGCCTGGGGCTGCCGCGGG - Intronic
939928274 2:148201089-148201111 CTCAGGCCTGGGCTTGCCACAGG + Intronic
940856229 2:158730619-158730641 CAGGGGTTTGGGGTTGCCCCTGG + Intergenic
942043174 2:172084455-172084477 CACAGGCCTGGGTTTGCTGCGGG + Intergenic
944675784 2:202033707-202033729 CCGGGGCCTGGGGCCGCCCCCGG + Intergenic
948305050 2:236940449-236940471 CACGGGCCCTGGGTAGCACCTGG + Intergenic
948650093 2:239437472-239437494 CACCAGCCTGGGGCTGTCCCAGG + Intergenic
948903664 2:240967979-240968001 AAGGGTCCTGGGGCTGCCCCAGG - Intronic
948942610 2:241203797-241203819 GAAGTTCCTGGGGTTGCCCCAGG - Intronic
1170881106 20:20297054-20297076 CACGCACCTGGGGGTGGCCCAGG + Intronic
1171191509 20:23162666-23162688 GAGGGGCCTGGGGCTGCGCCAGG + Intergenic
1172125844 20:32624764-32624786 CATGGGCCTCTGGTGGCCCCAGG + Intergenic
1172839357 20:37892861-37892883 GAGGGGCCTGGGGATGCCCAGGG + Intergenic
1173625252 20:44467623-44467645 CCCGGGCCTGGGGTTCCCTAAGG - Intergenic
1173761262 20:45562564-45562586 CTAGTGTCTGGGGTTGCCCCTGG - Intronic
1174115967 20:48226480-48226502 CCCAGGCCTGGGGATGGCCCTGG - Intergenic
1175062892 20:56259746-56259768 CACAGGCCTGGGGTGGGGCCTGG + Intergenic
1175811344 20:61859966-61859988 CATGGCCCTGGGGTGGCCCCAGG + Intronic
1176120094 20:63450411-63450433 CAGGGCCCTGGGGCTGCCCCAGG + Intronic
1176299247 21:5090831-5090853 CACACTCCTGGGGTTTCCCCGGG + Intergenic
1177773241 21:25539916-25539938 CCTGGGCCTGGGCTTGCCTCAGG - Intergenic
1179611887 21:42557263-42557285 AACTCGCCTGGGGCTGCCCCAGG + Intronic
1179718555 21:43302614-43302636 CCCCGTCCTGGGGGTGCCCCAGG + Intergenic
1179799159 21:43802863-43802885 CGCGGACCCAGGGTTGCCCCTGG - Intronic
1179857779 21:44171116-44171138 CACACTCCTGGGGTTTCCCCGGG - Intergenic
1180048253 21:45319622-45319644 CACTGGGCTGGGGTTTCCCAGGG - Intergenic
1180077282 21:45469159-45469181 CACAGGCCTGGGGGTGTCTCTGG - Intronic
1181388252 22:22559681-22559703 CACTGGCATGGGGATGCCTCGGG - Intronic
1182062136 22:27405996-27406018 AATGGGCCTGGGGTTGCAGCAGG + Intergenic
1182095782 22:27624306-27624328 CACAGACCTGGTGTGGCCCCTGG + Intergenic
1182261105 22:29073394-29073416 GACGGGCCTGGGGGTAGCCCGGG - Intronic
1182515324 22:30855433-30855455 CACAGGCGTGTGGTTGCCCCAGG + Intronic
1183265103 22:36819984-36820006 CACGGGCCTGGGGTTGGGAGCGG + Intergenic
1183745509 22:39689369-39689391 AACGGGGCTGGGGTTGGCCCTGG - Exonic
1184033990 22:41910076-41910098 CCCGCGCCGGGGGTTGCCGCGGG + Exonic
1184479712 22:44739219-44739241 GCCGGGCCTGGGGTGGCCCAGGG + Intronic
1184586411 22:45451102-45451124 AAGGGGCCTGGGGAAGCCCCAGG + Intergenic
1185226483 22:49656591-49656613 GGCGGGCCTGGGGTTGGCTCTGG - Intronic
953396986 3:42581615-42581637 CGCGTGCCTTGGGTGGCCCCGGG + Intronic
957072631 3:75578892-75578914 CCCAGTCTTGGGGTTGCCCCTGG - Intergenic
957281065 3:78152411-78152433 GAAGGGCCTGGGGCAGCCCCTGG - Intergenic
960971252 3:123141641-123141663 CAGCAGCTTGGGGTTGCCCCCGG + Intronic
961094683 3:124144292-124144314 TGCGTGCCTGGGGCTGCCCCAGG - Intronic
961281447 3:125767861-125767883 CACAGTCTTGGGGTTGCTCCCGG + Intergenic
961512232 3:127410076-127410098 CACTGAGCTGGGGTTGGCCCTGG + Intergenic
961649715 3:128411242-128411264 CGCGGGCCTGGGGTTGCCCAAGG - Intergenic
962745681 3:138396025-138396047 CATGGGGCTGGGGTTGGTCCTGG + Intronic
963057797 3:141201617-141201639 AAGGGGCCTGGGATTGTCCCTGG - Intergenic
963264859 3:143229698-143229720 CACTGGCCTGAGGTTGGGCCAGG - Intergenic
967336429 3:188349510-188349532 TAAGTGCCTGGGGTTGCCTCTGG + Intronic
968476847 4:814669-814691 ACCTGGCCTGGGGTAGCCCCTGG - Intronic
968697924 4:2041853-2041875 CCCTGGCCGGGGGCTGCCCCCGG - Intronic
969290076 4:6233266-6233288 CACAGGCCTGGGGATGCTCTGGG - Intergenic
969414485 4:7049787-7049809 CACGGCCATGCGGTGGCCCCTGG - Intronic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
969611937 4:8232300-8232322 GGGGGGCCTGGGGTTGTCCCAGG + Intronic
969737555 4:9001360-9001382 GAAGGGGCGGGGGTTGCCCCGGG + Intergenic
975870611 4:78775871-78775893 CCCGGGTCCGGGGTTGCGCCGGG - Intergenic
982198284 4:152936884-152936906 CAGGGGCCAGGCGTGGCCCCCGG - Intronic
985386344 4:189452170-189452192 CAGGGGCCTGGGCCTTCCCCAGG - Intergenic
985550021 5:528262-528284 CAGGGGCCGGGGGCTGCGCCGGG + Intergenic
985638526 5:1052284-1052306 CCTGGGCCTGGGCTTGGCCCAGG - Exonic
995436151 5:112137823-112137845 CACAGGCCAGAGGTTGCGCCAGG + Intergenic
997994659 5:138575874-138575896 CACGCGCCCGGGCTCGCCCCAGG - Intergenic
998902628 5:146872176-146872198 AAAGGGCTTGGGATTGCCCCTGG + Intronic
1000414548 5:160969882-160969904 CATGGCTTTGGGGTTGCCCCAGG - Intergenic
1000788175 5:165571596-165571618 CACAGGCCTGGGGAGGCCTCAGG + Intergenic
1001754687 5:174159400-174159422 CCCAGGCCTGGAGTTGGCCCTGG - Intronic
1002296415 5:178233506-178233528 CACGGGCCTGGGACTGCAGCAGG + Intergenic
1002311350 5:178315703-178315725 CAAGGGGCTGAGGTTGCCCAGGG + Intronic
1002596828 5:180329187-180329209 CCGGGGCCTGGGGCTGCCCGTGG - Intronic
1002741272 5:181437160-181437182 CAGGGGCCTGGGCCTGCTCCGGG - Intergenic
1004423348 6:15490626-15490648 CATGGGGCTGGGAGTGCCCCTGG + Intronic
1004823642 6:19397203-19397225 CTCAGGACTGGGGATGCCCCAGG + Intergenic
1005243224 6:23854808-23854830 CAAGGGCCTGGGATTGTACCAGG - Intergenic
1006377995 6:33682458-33682480 CCTGGACCTGGGGTTGCCCAGGG + Intronic
1006513219 6:34532724-34532746 CTGGGGCTTGGGGTGGCCCCAGG + Exonic
1007843965 6:44738905-44738927 CCCAGGCCTGGGGTTGTCACTGG + Intergenic
1009398620 6:63229716-63229738 CAAGGGCCTGGGATTGTACCAGG + Intergenic
1010893557 6:81341145-81341167 CATGGGCTGGTGGTTGCCCCAGG - Intergenic
1011295941 6:85826779-85826801 CACGGGCCTGTGGTAGGCCCTGG - Intergenic
1016118017 6:140312803-140312825 CACGGGGGCGGGGTTGCCCAAGG - Intergenic
1018951947 6:168384969-168384991 CGGGTGCCTGGGGCTGCCCCAGG - Intergenic
1019246387 6:170712857-170712879 CAGGGGCCTGGGCCTGCTCCGGG - Intergenic
1019306984 7:340294-340316 CACTGGCCTGAGGTTGCCCCTGG + Intergenic
1019477969 7:1253057-1253079 CAGGGGCCTGGGGGTCCCCAAGG + Intergenic
1019603986 7:1899368-1899390 CAGGGGCCTGGGACTGCTCCAGG + Intronic
1019664930 7:2247141-2247163 CACGGGCCTGGGGTTGCCCCAGG - Intronic
1022518786 7:30992555-30992577 CACGTGCCTGGGCTTGTGCCTGG + Intronic
1023387755 7:39677138-39677160 CAGGGGCCAAGGGATGCCCCAGG + Intronic
1026851570 7:73726998-73727020 CCCAGGCCTGGGGTTGAGCCAGG - Intergenic
1032051842 7:128654698-128654720 CACGGGCCTGGCCTTGGCCTTGG + Intergenic
1032982618 7:137301280-137301302 CACTGCCCTTGGGTTGCACCTGG - Intronic
1034743068 7:153496183-153496205 CACAGGGCTGGGGTGGCCTCAGG - Intergenic
1035271334 7:157721800-157721822 CAGGGGCCTGGGGCTCCCGCTGG + Intronic
1035297813 7:157876992-157877014 CTCAGGCCTGGGGTTCCTCCAGG - Intronic
1035501685 8:94832-94854 CAGGGGCCTGGGCCTGCTCCGGG + Intergenic
1036830083 8:12014524-12014546 GAAGGGGCGGGGGTTGCCCCGGG - Intronic
1037595015 8:20347762-20347784 CACGTGGCTGGGGTGGCCTCAGG + Intergenic
1037981092 8:23254949-23254971 CACTGGCCTGTGGTTTCCCAAGG - Intronic
1038332692 8:26621731-26621753 CACAGGCTTGGAGTTGCCCAGGG + Intronic
1038372999 8:27011751-27011773 CAAGGGCCTGGGATTGTACCAGG + Intergenic
1039914953 8:41852822-41852844 CAAGTGCCTGGGTTTGCCCAAGG + Intronic
1045811910 8:106231680-106231702 CAGGGGGCTGGGGCTGCCCTTGG - Intergenic
1049086140 8:140480082-140480104 TCCGGTCCTGGGGTGGCCCCGGG - Intergenic
1049235495 8:141510406-141510428 CCCGGGCCTGGGGCTGACCGGGG - Intergenic
1049385136 8:142339385-142339407 CACGGGCCTGTGATTCTCCCTGG - Intronic
1049455231 8:142683239-142683261 CAGGGGCCTGGGGATGCTCACGG - Intergenic
1049765321 8:144352694-144352716 CGCGGGCCTGGGGTTCCAGCGGG + Intronic
1052413342 9:28148584-28148606 CAAGGGCCTGGGATTGTACCAGG - Intronic
1053142245 9:35689503-35689525 CAGGGGCCTGGGGCTTCCCCAGG + Intronic
1053413216 9:37929008-37929030 CAGCGCCCTGGGGTTGACCCAGG + Intronic
1054254579 9:62800409-62800431 CACGGTCCTGGGGTCCCCTCCGG + Intergenic
1055986457 9:82059762-82059784 CCAGGGCCTGGGCTTGCCCTTGG + Intergenic
1056576406 9:87858664-87858686 CAAGGGCCTGGGATTGTACCGGG + Intergenic
1056584884 9:87921370-87921392 CCAGGGCCTGGGTTTGCCCTTGG - Intergenic
1056611997 9:88131570-88131592 CCAGGGCCTGGGTTTGCCCTTGG + Intergenic
1056739818 9:89244866-89244888 TATGAGCCTGGAGTTGCCCCTGG - Intergenic
1057071632 9:92104799-92104821 CAAGGGCCTGGGATTGTACCAGG - Intronic
1057188149 9:93070495-93070517 CAGGTGCCTGCGGTTGACCCTGG + Intronic
1057225065 9:93288883-93288905 AAAGGGGCTGGGGGTGCCCCAGG - Exonic
1057230689 9:93319717-93319739 CTTGGGGCTGGGGTTGCCCATGG + Intronic
1057312644 9:93951735-93951757 CAACGGCCTGAGATTGCCCCGGG - Exonic
1057463778 9:95292436-95292458 CTCGGGCCCGTGGGTGCCCCCGG + Intronic
1057524537 9:95786797-95786819 CCCGGGCCTGGTGTTCCTCCAGG + Intergenic
1057559579 9:96116750-96116772 CTGGGGCCTGGGCTTGCCCCTGG - Intergenic
1059662727 9:116417876-116417898 GATGGGCCTGGGGTTACCACGGG + Intergenic
1060217124 9:121745128-121745150 CACTGGCCTTGGGAAGCCCCTGG + Intronic
1060553971 9:124498959-124498981 CTCGGGCCTGGGCTTCCTCCAGG - Intronic
1060985649 9:127817623-127817645 CAAGGGCCTGGGGGTGACTCTGG + Intronic
1061191472 9:129085123-129085145 CGAGGGCCTGAGGTTCCCCCAGG + Intronic
1061482632 9:130904544-130904566 GGCGTGCCTGGGGCTGCCCCTGG + Intronic
1061930534 9:133830574-133830596 CACCGGACTGGGGAGGCCCCAGG - Intronic
1061985582 9:134128484-134128506 GAAGGGCCTGAGGCTGCCCCAGG - Intergenic
1062454506 9:136629312-136629334 CCCTGCCCTGGGTTTGCCCCTGG + Intergenic
1062460325 9:136660181-136660203 CAGGGGGTTGGGGCTGCCCCCGG - Intronic
1062698614 9:137887949-137887971 CACTGGGGTGGGGTGGCCCCTGG + Intronic
1203731799 Un_GL000216v2:98557-98579 GCCGGGCCTGGGGTGGTCCCTGG - Intergenic
1203607151 Un_KI270748v1:68240-68262 CAGGGGCCTGGGCCTGCTCCGGG - Intergenic
1186178939 X:6954098-6954120 CACAGGGCTGGGGATGCCTCAGG - Intergenic
1186459160 X:9734603-9734625 CACCGGCCTGGGCTTCTCCCCGG + Intronic
1187390571 X:18884079-18884101 CAAGGGCCTGGGGTTGCAAAGGG - Intergenic
1188807960 X:34614676-34614698 CACGTGGCTGGGGATGCCTCAGG + Intergenic
1189071240 X:37866322-37866344 CACAGGCGTGGAGTTGCCCAAGG - Intronic
1194491176 X:94551684-94551706 CACGGGCCGGGGGTTTTCCAGGG + Intergenic
1194624419 X:96212369-96212391 CACGTGCCTGGGGAGGCCTCAGG + Intergenic
1195100507 X:101550812-101550834 CCCGAGTCTGGGGTCGCCCCTGG - Intronic
1197536222 X:127691691-127691713 CACAGGGGTGGGGTTGCCCAAGG + Intergenic
1198404111 X:136295560-136295582 CCCGGCACTGGGGTGGCCCCCGG + Intergenic
1198991497 X:142520205-142520227 CACGGAGCTGGGGAGGCCCCAGG + Intergenic
1200120666 X:153788769-153788791 CCAGGGCCTGGGGCTCCCCCTGG + Intronic