ID: 1019667173

View in Genome Browser
Species Human (GRCh38)
Location 7:2257706-2257728
Sequence CTTGGCTGCTCCTTGGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019667173_1019667178 -9 Left 1019667173 7:2257706-2257728 CCCCCAGCCAAGGAGCAGCCAAG 0: 1
1: 0
2: 5
3: 27
4: 305
Right 1019667178 7:2257720-2257742 GCAGCCAAGACTCACCTTATAGG 0: 1
1: 0
2: 0
3: 3
4: 70
1019667173_1019667181 14 Left 1019667173 7:2257706-2257728 CCCCCAGCCAAGGAGCAGCCAAG 0: 1
1: 0
2: 5
3: 27
4: 305
Right 1019667181 7:2257743-2257765 ACTGCAGCAGATCCAAGAAGAGG 0: 1
1: 1
2: 2
3: 27
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019667173 Original CRISPR CTTGGCTGCTCCTTGGCTGG GGG (reversed) Intronic
900422678 1:2562399-2562421 CTTTGCTGCCGCCTGGCTGGAGG - Intronic
900543594 1:3216420-3216442 CTTGGATTCTCCTTCCCTGGTGG - Intronic
901733086 1:11294618-11294640 GATGGCTGCTTCCTGGCTGGTGG + Intronic
901797976 1:11691597-11691619 CGGGGCTGCCCCTCGGCTGGGGG + Exonic
903676781 1:25069300-25069322 CTTGGTTCCTCCCTGGCTGCTGG + Intergenic
904383438 1:30126392-30126414 CTTGGCTGGTTCTTGGCTGGAGG - Intergenic
905119517 1:35671060-35671082 CTTTGGTGTTCCTTGGCTTGAGG - Intergenic
905402227 1:37712091-37712113 CTTTCCTGATCCTTGGGTGGTGG + Intergenic
905815242 1:40945130-40945152 CTTGGCTGAGCCATGGCTCGAGG + Intergenic
906281867 1:44559971-44559993 CGTGGCTCCTCCTGGGCTGAGGG - Intronic
907164789 1:52400783-52400805 CACGGCTGCCCCTAGGCTGGAGG - Intronic
910392421 1:86758650-86758672 CTTGGCTGCCCCATTGATGGTGG + Intergenic
911207360 1:95105453-95105475 CTTGCCTCCTCCATGGGTGGTGG + Intergenic
915084920 1:153379806-153379828 CTTGGCAGCACCTAGGGTGGCGG + Intergenic
915681539 1:157586359-157586381 CTTGTCTGCTCCGTGGCTGAAGG - Exonic
915713727 1:157925137-157925159 CTTGTCTGCTCCGTGGCTGAAGG + Intergenic
916925821 1:169519731-169519753 CTTGGCTGCTGAAGGGCTGGAGG - Intronic
918081407 1:181210435-181210457 GCTTGCTGCTCCTTGGCTTGTGG + Intergenic
918288759 1:183085305-183085327 CTGTGTTGCTCCTTGACTGGTGG + Intronic
920458096 1:206116410-206116432 CATCGCTGCTCCCTGGCTGCTGG - Exonic
920684807 1:208101349-208101371 CCAGGCTGCTGCTTGGCAGGTGG + Intronic
921706135 1:218324129-218324151 CTGTGCTGCTCCTTTGCTGGCGG + Intronic
921999379 1:221459760-221459782 CCTGCCTTGTCCTTGGCTGGAGG - Intergenic
922345562 1:224693458-224693480 CTTGGCTGCGCTTGGGCAGGGGG + Intronic
924038837 1:239963619-239963641 GATGACTGCTCCTTAGCTGGGGG - Intergenic
924626767 1:245702171-245702193 CCTGGATCCTCCATGGCTGGAGG + Intronic
1063141119 10:3257386-3257408 CATGGTTACTCCTTGTCTGGTGG + Intergenic
1064327803 10:14366881-14366903 CTTGGATGCTGGATGGCTGGAGG - Intronic
1064935103 10:20670783-20670805 CCTGGTAGGTCCTTGGCTGGTGG - Intergenic
1064993176 10:21274172-21274194 CTGGGCTCCTTCTTGGCTGTTGG - Intergenic
1065641051 10:27783112-27783134 CTTTGCTGCCTGTTGGCTGGGGG + Intergenic
1066630315 10:37453485-37453507 CTTTGGTGCTCCTTGGCTTGTGG - Intergenic
1067015718 10:42755244-42755266 CTTGGCTGCTGCCGGGCTCGGGG - Intergenic
1067190475 10:44063928-44063950 CTTGGCTCCTCCTTGGTTCTGGG + Intergenic
1067344736 10:45429036-45429058 CCTGGCAGCACCTTGACTGGGGG - Intronic
1068570613 10:58624118-58624140 CTTTGGTGTTCCTTGGCTTGTGG + Intronic
1070605065 10:77892877-77892899 CTTTGTTTGTCCTTGGCTGGTGG - Intronic
1071073868 10:81728583-81728605 GTTGGCTGCTGATTGGTTGGGGG + Intergenic
1071450886 10:85790643-85790665 CCTGGCTGCTCCCTGCCAGGAGG - Intronic
1072683171 10:97521261-97521283 GTGGGCAGCTCCCTGGCTGGTGG + Intronic
1073462089 10:103671679-103671701 CTTGTCTGCCTCCTGGCTGGAGG - Intronic
1074882375 10:117669114-117669136 CTGTGCTACTCCATGGCTGGAGG - Intergenic
1075255925 10:120926107-120926129 CTTAGCTGCTCCTGGGAAGGAGG + Intergenic
1075794100 10:125106680-125106702 CTGAGTTGCTCCTTCGCTGGAGG - Intronic
1076473601 10:130737036-130737058 CTTGTATCCTCCTTGGCTGGTGG + Intergenic
1076684221 10:132189848-132189870 CATGGCTGCCCCCTGACTGGGGG - Intronic
1076741347 10:132487274-132487296 CGGGGCTGCTCCTGAGCTGGAGG - Intergenic
1076901385 10:133340147-133340169 CCTGGCTGCTCCTTGGTCTGGGG + Intronic
1077095541 11:797579-797601 CCTGGCGGCTTCTTGGGTGGAGG - Exonic
1078539351 11:12200799-12200821 CATGGCAGCTCCCTGACTGGTGG + Intronic
1079384758 11:19968919-19968941 CTTGGCTTCTCCTTGTCCGCAGG + Intronic
1080034704 11:27699829-27699851 CTCGACTACTCCTGGGCTGGGGG + Intronic
1082790414 11:57342937-57342959 TGTGGCAGCTCCTTGGCAGGTGG - Intronic
1083120328 11:60505893-60505915 GAGGCCTGCTCCTTGGCTGGAGG - Intronic
1083768481 11:64853519-64853541 CAGGGCTGCTCCTTGGCTGGAGG + Exonic
1084047079 11:66575256-66575278 CCAGGCTGCTCCTTGCCAGGCGG + Intergenic
1084746562 11:71173860-71173882 CCTGGATGTTCCTTGGCTTGTGG - Intronic
1084943306 11:72625783-72625805 CTTGGCAGCGCCCTTGCTGGGGG - Intronic
1084948999 11:72654452-72654474 CTTGGCTGCTTCTTCCCCGGCGG - Intronic
1087693784 11:101352420-101352442 CTTGTCTTCTCCTTGCCTGTAGG - Intergenic
1089406844 11:118204520-118204542 CTTGGCTGCTCCTTGCATACTGG + Intronic
1089634354 11:119802924-119802946 CGTCGCTGCTCCTTTGCTAGGGG + Intergenic
1089901681 11:121993056-121993078 CATGGCTCCACCTGGGCTGGAGG - Intergenic
1091303911 11:134524447-134524469 GTTGGCCCCTCCTGGGCTGGGGG - Intergenic
1091381821 12:66839-66861 CCTGCCTGCGCCTGGGCTGGCGG - Exonic
1092725120 12:11477354-11477376 ACTTGCTGGTCCTTGGCTGGTGG - Intronic
1093958889 12:25251210-25251232 CTGGGCGGCGCCTTGGCGGGAGG + Intergenic
1095986053 12:48000559-48000581 CTTCTCTGCTCCTGGGCTGGTGG - Intronic
1096086000 12:48865492-48865514 CTCAGCTGCTTTTTGGCTGGAGG - Intronic
1096339503 12:50785733-50785755 TTTGGTTGGTTCTTGGCTGGAGG + Intronic
1100608674 12:96172414-96172436 CTTGGCTTCTCCTTGGTAAGAGG - Intergenic
1101154727 12:101916693-101916715 CTTTACTTCTCCTTTGCTGGAGG - Intronic
1101904544 12:108814895-108814917 CTCCGCTGCTGCCTGGCTGGAGG - Intronic
1101911954 12:108866676-108866698 CTCGGGTGCTCTTTGGCTTGTGG - Intronic
1102033475 12:109758073-109758095 CTTGGCCGCTCCAGGGCTGTGGG + Intronic
1102600946 12:114029956-114029978 CTTGTCTGCTGCTGGGATGGAGG + Intergenic
1103564810 12:121810269-121810291 CCTGGCTTCTCCTTGGCCAGAGG - Exonic
1103726356 12:122999233-122999255 CTTGGCTCCTCCTGGGGTGAGGG - Intronic
1103978746 12:124721989-124722011 CTTAGCTGGTCATTGGCTGGCGG - Intergenic
1104067469 12:125317484-125317506 CTTGCCTTTTCCTGGGCTGGGGG + Intronic
1104099362 12:125591729-125591751 CCTGGGTGTTCCTTGGCTTGTGG + Intronic
1104244931 12:127029922-127029944 CTTGGGTGACCCTTGGCTCGTGG - Intergenic
1104654814 12:130566564-130566586 CCTTGCTGGTCATTGGCTGGAGG - Intronic
1105448078 13:20474754-20474776 CTGGGCTGGTCATTGGCTGAGGG - Intronic
1107862052 13:44670434-44670456 CTTTCCTGCTCCTGGGCTGGTGG - Intergenic
1111097960 13:83539086-83539108 CTTTGCCCCACCTTGGCTGGTGG - Intergenic
1111937838 13:94574953-94574975 CTTGTCTGCTGCTTAGCTGATGG - Intronic
1113067197 13:106384544-106384566 CCTGGCCGCTCCTTGGCTTCAGG + Intergenic
1113710474 13:112461318-112461340 CATGGCTGGTCCGTGGCTGATGG - Intergenic
1115324461 14:32123695-32123717 CGGTGCTTCTCCTTGGCTGGTGG + Intronic
1115465456 14:33709707-33709729 CTTGGCTGTTCATTAGCAGGCGG - Intronic
1116763700 14:49045487-49045509 CATGGCAGCTTCCTGGCTGGTGG + Intergenic
1118603546 14:67487129-67487151 CTCAGCTGATCCTTGGCTGGGGG + Exonic
1119730827 14:76950240-76950262 CTTGGCTCGTCCGGGGCTGGAGG + Intergenic
1120113215 14:80582569-80582591 CTTGCCTACTGCTTGGCTAGGGG + Intronic
1121582932 14:95044531-95044553 CCTCCCTCCTCCTTGGCTGGAGG - Intergenic
1122433758 14:101677651-101677673 CCTGGCTGCTACTCGGCTGACGG - Intergenic
1122717049 14:103702148-103702170 CTTGCCTGCTTCTTGGCTACAGG + Intronic
1122909772 14:104821754-104821776 CTTTGCTGTTCCTTGGCTGGTGG + Intergenic
1123758620 15:23416072-23416094 GATGGTGGCTCCTTGGCTGGTGG - Intergenic
1125919692 15:43518120-43518142 CTCAGCTGCTCCTATGCTGGGGG + Intronic
1127632830 15:60842299-60842321 CTTGGCTGCCCATGGGCTGCAGG + Intronic
1128523584 15:68391516-68391538 GTTGGCTGCTCTTGGGCTGCAGG + Intronic
1128660927 15:69500487-69500509 CTGCACTGCTCCTTGGCTTGAGG + Intergenic
1128772128 15:70290512-70290534 GGTGGCTCCTCCTGGGCTGGAGG - Intergenic
1131547728 15:93329867-93329889 CTTTGGTGTTCCTTGGCTTGTGG + Intergenic
1132318071 15:100904828-100904850 CAGGGCTGCTCCTTGGTTGGTGG - Intronic
1132732869 16:1371466-1371488 CTTGGCTGTTCAGCGGCTGGAGG + Intronic
1132985974 16:2767849-2767871 CTCGGCTGATCCTGTGCTGGAGG - Exonic
1134870233 16:17646264-17646286 CTTGGCTCCTCACTGGCTGTAGG - Intergenic
1137055976 16:35746842-35746864 CTTGGCTGGGACTTGGATGGGGG + Intergenic
1137932594 16:52603107-52603129 CTAGCCTGATTCTTGGCTGGAGG - Intergenic
1139406601 16:66724050-66724072 CTTGACTGCTCTCTGGCGGGGGG + Intronic
1139737700 16:69006126-69006148 CCTGGGTTCTGCTTGGCTGGTGG + Intronic
1140141141 16:72259136-72259158 CCTAGGTGCTCCTTGGCTTGTGG - Intergenic
1140590998 16:76352531-76352553 CTTGCCTGCTCCATGGATGAGGG + Intronic
1141192679 16:81835845-81835867 CCTGGGTGTCCCTTGGCTGGTGG + Intronic
1142116142 16:88357098-88357120 CCGGGCTGGCCCTTGGCTGGAGG + Intergenic
1142210628 16:88806778-88806800 CTGGCTTCCTCCTTGGCTGGCGG + Intronic
1142265139 16:89061022-89061044 CTGGGCTGCTGCTGGGCAGGGGG - Intergenic
1142347131 16:89561103-89561125 CGCGGCTGCGCCTTGGCTTGCGG + Intronic
1142964328 17:3571481-3571503 CTTGGCGCCTCCTTGGCTGGTGG - Intronic
1144952811 17:19003373-19003395 CCTGGCTGCCTCTTGGGTGGAGG - Intronic
1145066075 17:19762253-19762275 CATGGCTGCTCCAGGGCTTGGGG - Intergenic
1146913582 17:36663946-36663968 ATGGGCTGCTCCCTGTCTGGTGG + Intergenic
1147899446 17:43774460-43774482 TTTGACTGCACTTTGGCTGGAGG - Intronic
1148560277 17:48602178-48602200 TTTGCCAGCTCCTTGGTTGGTGG - Intronic
1148798672 17:50209896-50209918 CTTAGCTGCATCTTCGCTGGAGG + Intergenic
1150788877 17:68184254-68184276 CTGGGCTGTCCCTAGGCTGGGGG - Intergenic
1151459522 17:74246205-74246227 CCTGGCTGCCCCTTAGCTGGAGG - Intronic
1151917323 17:77127914-77127936 CCTGGGTGTTCCTTGGCTTGCGG - Intronic
1152012583 17:77727413-77727435 CCTGCCTCCACCTTGGCTGGGGG + Intergenic
1152250342 17:79209236-79209258 CTGGCCTGCTCCTGGGATGGGGG - Intronic
1152602889 17:81273934-81273956 CGTGGCTGCTCCTTTCCCGGAGG - Intronic
1152988723 18:343175-343197 CTTGGCTGCCCCTTTGCTTCTGG + Intronic
1154324484 18:13380079-13380101 CATTGCCGCTGCTTGGCTGGTGG + Intronic
1156394685 18:36688740-36688762 CTTGGCAGCTCCTGGGGAGGTGG + Intronic
1156459847 18:37315568-37315590 CTTGTCTGCTCTGTGTCTGGAGG + Intronic
1157573406 18:48728629-48728651 CTTGGCTCCTCACTGGCTGTTGG + Intronic
1159110160 18:64045775-64045797 CTTGTCTGCTACTTGGATGCTGG - Intergenic
1160402441 18:78620773-78620795 CTTGACTGCTGCTTGGGTTGGGG - Intergenic
1160625456 18:80201322-80201344 CTTGGCTGGTCCTGGAATGGAGG - Intronic
1161888907 19:7019469-7019491 CTTGGCTGCTGCAGGGCTGCAGG + Intergenic
1161890461 19:7032552-7032574 CTTGGCTGCTGCAGGGCTGCAGG - Exonic
1161890987 19:7038181-7038203 CTTGGCTGCTGCAGGGCTGCAGG + Exonic
1161892547 19:7051280-7051302 CTTGGCTGCTGCAGGGCTGCAGG - Exonic
1161893072 19:7056642-7056664 CTTGGCTGCTGCAGGGCTGCAGG + Exonic
1162404734 19:10467025-10467047 CTTGACTCCTCCTCGGGTGGCGG - Exonic
1163055193 19:14712661-14712683 CCTTGGTGCTCCTTGGCTTGTGG + Intronic
1163196931 19:15728476-15728498 GTGGGCTGCTCCTGGGCTGGTGG + Exonic
1163204761 19:15794481-15794503 GTGGGCTGCTCCTGGGCTGGTGG + Exonic
1163206541 19:15807583-15807605 GTGGGCTGCTCCTGGGCTGGTGG - Exonic
1163543019 19:17922962-17922984 CTTGGCAATTCCTTGGCTTGTGG + Intergenic
1163847924 19:19647609-19647631 GTTGGCTGCTCCTCGGAGGGAGG + Exonic
1164559929 19:29283732-29283754 CTTGCCTAATCCTTGCCTGGTGG + Intergenic
1164615678 19:29665615-29665637 CTTGGCGGCTCCTGGGCCGGCGG + Intronic
1164635380 19:29787680-29787702 CTGGGCTGCTCCAGGGCTGCGGG - Intergenic
1166322190 19:42025368-42025390 CCTGGTCGCTCCATGGCTGGGGG + Intronic
1166882178 19:45936286-45936308 GTGGGATTCTCCTTGGCTGGTGG + Exonic
925082410 2:1080798-1080820 CATGGCTGCTTCCTGGGTGGTGG + Intronic
925879871 2:8343604-8343626 CTTGGCCTCTCCTTGTCTAGAGG - Intergenic
926689916 2:15726001-15726023 CCTTGCTGCTCCTTGGCTCGCGG + Intronic
926745185 2:16151071-16151093 ATTGGCTGGACCTTGTCTGGAGG + Intergenic
927070989 2:19529234-19529256 CTTGGCTGCTCTTTAACTAGGGG - Intergenic
927114859 2:19889736-19889758 CCTGGGTGTTCCTTGGCTTGTGG + Intergenic
927156812 2:20225345-20225367 CTCGGCTGCTCCCTGGGTGGTGG + Exonic
927459690 2:23287316-23287338 CTTGGCTGTGCCTTGACTGCAGG - Intergenic
927696641 2:25244097-25244119 CTTGGCTGAGCCTTGGTTGTGGG - Intronic
928710621 2:34001290-34001312 CTTGTCTGCTCATTTTCTGGTGG - Intergenic
930772374 2:55141130-55141152 CTTTGCTGTACCTTGGCTTGTGG + Intergenic
933111535 2:78407978-78408000 CTGTACTGCTTCTTGGCTGGGGG + Intergenic
933163649 2:79053062-79053084 CCAGGCTGCTCCTTGCCAGGCGG + Intergenic
937111656 2:119371291-119371313 CTTGGATACTTCTTGGCTGCTGG - Intronic
938373802 2:130791111-130791133 CTGGCATGTTCCTTGGCTGGAGG - Intergenic
938498563 2:131817850-131817872 CTTTGCTGCTCACAGGCTGGTGG + Intergenic
941972584 2:171368069-171368091 CTTTGCTGCTCACTGGATGGTGG - Intronic
941983180 2:171482787-171482809 CCTGGCTGCTTTTTTGCTGGGGG + Exonic
941996254 2:171604648-171604670 CTTTGGTGTTCCTTGGCTTGTGG - Intergenic
945067809 2:205961837-205961859 CTTTGGTGTTCCTTGGCTTGGGG + Intergenic
945193751 2:207218120-207218142 CATGACTGCTGCTTGGCTGATGG + Intergenic
945579061 2:211569985-211570007 TTTTGCTGCTCTTTGGCTGAAGG + Intronic
946470882 2:219959916-219959938 CAGGACTGCTCCGTGGCTGGAGG + Intergenic
946922665 2:224595838-224595860 CTGGGCTCCTACTTGACTGGTGG + Intergenic
947109720 2:226706050-226706072 CCTTGGTGTTCCTTGGCTGGTGG - Intergenic
948264492 2:236627091-236627113 CATGGCAGCTCCTGTGCTGGGGG - Intergenic
948267146 2:236643242-236643264 CTTGGCTTCTCCTTGGAAAGGGG - Intergenic
948476838 2:238226054-238226076 CTTTTCTGCTGTTTGGCTGGAGG - Intronic
948575680 2:238947978-238948000 CTCCGCCCCTCCTTGGCTGGTGG - Intergenic
1169959090 20:11138807-11138829 GTGGGCTGCCCCTGGGCTGGGGG + Intergenic
1170272638 20:14545296-14545318 GTTGGCTGCTCCTTGGATCTGGG + Intronic
1170597364 20:17816248-17816270 CCCGGGTGCTCCTTGGCTTGTGG - Intergenic
1174548824 20:51346200-51346222 CTTGGCTGGTCCTAGGTTTGTGG + Intergenic
1174561224 20:51432161-51432183 TTTGGCGGCTCTTTGGCTCGTGG + Exonic
1175219243 20:57407565-57407587 CTGGGCTGCACGATGGCTGGTGG - Exonic
1175298213 20:57923831-57923853 CTCGCCTGTTCCTGGGCTGGCGG + Intergenic
1175672692 20:60919597-60919619 GTAGGCTGATCCTTTGCTGGTGG - Intergenic
1175699096 20:61124272-61124294 CTTTGCTCTTCCTTGGCTTGAGG + Intergenic
1175812136 20:61864154-61864176 CTTGGGTGCTCCTGGGCTTGTGG - Intronic
1175849987 20:62085118-62085140 CCTGGGCGCTCCTTGGCTGGGGG - Intergenic
1176171769 20:63699422-63699444 CTGGGCTGCTCAGGGGCTGGTGG - Exonic
1176302503 21:5105261-5105283 CTTCCGTGCTTCTTGGCTGGCGG - Intergenic
1176343105 21:5716266-5716288 CTTGTTTTCTCCCTGGCTGGAGG + Intergenic
1176475359 21:7148417-7148439 CTTGTTTTCTCCCTGGCTGGAGG + Intergenic
1176501722 21:7608190-7608212 CTTGTTTTCTCCCTGGCTGGAGG - Intergenic
1176537426 21:8114335-8114357 CTTGTTTTCTCCCTGGCTGGAGG + Intergenic
1178840286 21:36133038-36133060 CTTGTCCCCTCCTGGGCTGGTGG + Intergenic
1179308220 21:40174145-40174167 CTTGACTGCTCCTTTGTTGTGGG + Intronic
1179556604 21:42182703-42182725 CAGAGCTGCTCCTTGGTTGGGGG - Intergenic
1179854524 21:44156662-44156684 CTTCCGTGCTTCTTGGCTGGCGG + Intergenic
1180032298 21:45220770-45220792 CGTGGCTGCTCCCTCCCTGGGGG + Intronic
1180091475 21:45535749-45535771 CTTATCTGCTGCTTTGCTGGAGG - Intronic
1180918746 22:19507358-19507380 CTTGCATGCTCCTTGACTGCAGG + Intronic
1180958882 22:19753796-19753818 CCTGGCTGCACCTGGGGTGGAGG + Intergenic
1182366122 22:29780588-29780610 CCCTGCTGCTCTTTGGCTGGGGG + Intergenic
1182585552 22:31342597-31342619 TTTGCCGGCTCCTTGGATGGTGG - Intronic
1183271722 22:36866452-36866474 CTCTGCTGCTCCTTGGAAGGTGG + Intronic
1183663965 22:39236781-39236803 CTTTGCTTCTCAGTGGCTGGTGG - Intronic
1183742058 22:39674291-39674313 CTTGGTTGCCCCCAGGCTGGTGG + Intronic
1184118627 22:42436452-42436474 CCCGGCTGCTCCTAGGATGGAGG - Intergenic
1184381342 22:44146798-44146820 CAGGGCTGCTCCTTGGGTTGGGG + Intronic
1184687529 22:46103415-46103437 CGAGGCTGCTCTTGGGCTGGGGG - Intronic
1184730770 22:46369857-46369879 CCTGGCTGGTCCTTGGCATGGGG - Intronic
1203242369 22_KI270733v1_random:30691-30713 CTTGTTTTCTCCCTGGCTGGAGG + Intergenic
949198663 3:1344413-1344435 CCTGACTGCCCCTTTGCTGGTGG + Intronic
950090234 3:10289835-10289857 CGGGGCTGCAGCTTGGCTGGTGG + Exonic
953186862 3:40646127-40646149 CTGGCCTCCTCCTGGGCTGGTGG - Intergenic
957041000 3:75335511-75335533 CTTGGCTCCTCACTGGCTGTTGG - Intergenic
959826494 3:110803289-110803311 CTTTGGTGTTCCTTGGCTTGTGG - Intergenic
960861016 3:122153860-122153882 CTTGGCCACTCCTTTCCTGGGGG - Intergenic
962312985 3:134339030-134339052 CTTGGCTGCCCCTGGATTGGGGG + Intergenic
965593641 3:170386089-170386111 CCTGGCTGATTCTTGGGTGGGGG + Intronic
965599065 3:170437502-170437524 CTTTGTGGCTCCATGGCTGGGGG + Intronic
966939678 3:184737726-184737748 TTTGGTTGCTTCTTGGTTGGAGG + Intergenic
967336072 3:188346051-188346073 CTTGGCTGCACATTCGCTGCAGG - Intronic
968393712 4:213694-213716 CATGGCTGAGCCTGGGCTGGGGG + Intergenic
968405927 4:338871-338893 CATGGCTGAGCCTGGGCTGGAGG + Intronic
968960145 4:3739317-3739339 CGCGGCCGCTCCTTGGCTTGAGG - Intergenic
970761563 4:19495739-19495761 CTTTGATGTTCCTTGGCTTGTGG - Intergenic
970768219 4:19577112-19577134 TTGGGCTGTTCCTTGGTTGGTGG - Intergenic
975748860 4:77502076-77502098 CTTGACAGCTCCAAGGCTGGAGG + Intergenic
976053182 4:81031672-81031694 CTTGTCTGCCCCTTGCTTGGTGG + Intronic
976101206 4:81565720-81565742 CTGGGCTGCTGCTCAGCTGGAGG + Intronic
981042663 4:140237762-140237784 CCTGGCTGCACATTGGCTGCTGG - Intergenic
981172804 4:141644381-141644403 CTTGACTCCTCCTAGGCTGCTGG + Intronic
981738268 4:147975350-147975372 CTAGGCTCCTCCGTGACTGGAGG - Intronic
981831904 4:149011419-149011441 CATTGCTGCTCCTTGGCTTGGGG - Intergenic
982806158 4:159766442-159766464 ATTGGCTGCAGCTTGGCTGCTGG + Intergenic
984100690 4:175481925-175481947 CCTGGATGTTCCTTGGCTTGTGG + Intergenic
985519508 5:366764-366786 CTTTGCTGATACTCGGCTGGAGG + Intronic
985860082 5:2464102-2464124 CATTGCTGTTCCTTGGCTTGTGG - Intergenic
986480602 5:8183170-8183192 CTAGGCTGCTCGGGGGCTGGTGG + Intergenic
986737638 5:10679971-10679993 CTAGTCTGCTCACTGGCTGGTGG - Exonic
991639791 5:68740844-68740866 CCTGGCAGCTCCTTTGTTGGGGG + Intergenic
992950463 5:81852453-81852475 CTTGGCTGCTGCTTGTTTGGAGG + Intergenic
997233852 5:132261370-132261392 GCTGGCAGCTCCTTGGCTGGAGG - Intronic
997529080 5:134571113-134571135 CTTTGCTGTTCCTTGGCCTGCGG + Intronic
999848554 5:155512442-155512464 CATGGCTGCTCCATGGGTTGGGG - Intergenic
1000393303 5:160747589-160747611 CTTAGGTGTTCCTTGGCTTGTGG - Intronic
1001801165 5:174545492-174545514 CTTTGCTGTTCCTTGGATTGCGG - Intergenic
1001962134 5:175885959-175885981 CTTGGCTGACTGTTGGCTGGAGG + Intergenic
1002458249 5:179358369-179358391 ACTTGCTGTTCCTTGGCTGGTGG - Intergenic
1002460205 5:179369551-179369573 CTTTGCCGTTCCTGGGCTGGGGG + Intergenic
1002527186 5:179821257-179821279 GCTGGCTGCTCCCTGGATGGCGG + Intronic
1003172177 6:3728571-3728593 CTGCGCTCGTCCTTGGCTGGAGG + Intronic
1003385734 6:5665845-5665867 CTGGGCAGCTTCTTGGCAGGAGG + Intronic
1005351323 6:24938267-24938289 CTTTGGTGTTCCTTGGCTTGTGG - Intronic
1005734680 6:28734395-28734417 CTCGGCTCCTCTTTGGCTGTAGG + Intergenic
1006424762 6:33957058-33957080 CTTGCCTGCTCCTTGACTTGTGG - Intergenic
1006449579 6:34098491-34098513 CCTGGCTGGGCCTAGGCTGGTGG - Intronic
1007295046 6:40815180-40815202 CCTGGCTGCTCCTTCTCTCGTGG - Intergenic
1007323275 6:41042121-41042143 CTTGGTGGGGCCTTGGCTGGAGG + Intronic
1008095559 6:47336201-47336223 TTTGGCTGCTCCTTTGATGGGGG - Intergenic
1010303571 6:74289516-74289538 CCTGGCTGCACCTCTGCTGGGGG + Intergenic
1011778384 6:90758784-90758806 TTTGGCTCCTTCTTGGTTGGTGG + Intergenic
1013635544 6:112026051-112026073 TTTGGTTGCTCGCTGGCTGGTGG + Intergenic
1014422353 6:121261265-121261287 TTTGACTGCTCCTTGGCAGAGGG - Intronic
1016098092 6:140062825-140062847 ATTGGCTGTTCCTAGGCTAGAGG - Intergenic
1017842456 6:158232523-158232545 CGTGGCCGCTGCTTGGCTGTGGG + Intronic
1018739216 6:166714640-166714662 TTCGGGTGCTCCTTGGCTTGTGG - Intronic
1018755148 6:166842387-166842409 CTCTGGTGTTCCTTGGCTGGTGG - Intronic
1018830570 6:167439790-167439812 CTTGGCATTTCCTTGGTTGGTGG - Intergenic
1019069071 6:169326443-169326465 CTTAGCTGCTCTTTGGTTTGAGG + Intergenic
1019416873 7:931933-931955 CTTGGCCATTCCTGGGCTGGTGG - Intronic
1019603713 7:1898105-1898127 CGAGGCTGCTCCTTTGCTGAGGG + Intronic
1019667173 7:2257706-2257728 CTTGGCTGCTCCTTGGCTGGGGG - Intronic
1022248127 7:28581130-28581152 CCTTGCTGCTTTTTGGCTGGGGG - Intronic
1028267387 7:88742923-88742945 CTTTGATTCTCCTTGGCTTGTGG + Intergenic
1028985774 7:97007006-97007028 GTTGGCTGCTCCTTTGTTCGTGG + Intronic
1029200338 7:98835205-98835227 CTGGGCTGGGCCATGGCTGGAGG - Intergenic
1029219042 7:98973547-98973569 CATGGCTGCTCTCTGGATGGCGG + Intronic
1032506040 7:132435437-132435459 CTTGGGAGCCCCGTGGCTGGAGG - Intronic
1033520338 7:142154090-142154112 ATTTGCTGCTCATTGGCTGGGGG + Intronic
1034412322 7:150947863-150947885 CCTGGCTGCTCCGTGTCTGTGGG + Exonic
1039502841 8:38030743-38030765 CTTGCCGGCTCCTGGGCGGGCGG + Intronic
1040537652 8:48323633-48323655 CTGGGCTCCACCATGGCTGGTGG + Intergenic
1042029482 8:64459996-64460018 CTTGGCTTTTCCTAGCCTGGAGG - Intergenic
1042113253 8:65404181-65404203 CTTAGATGTTCCTTGGCTTGTGG - Intergenic
1042455544 8:68998327-68998349 CTTCTCTGCTCCTAGGCTGAAGG + Intergenic
1042566109 8:70113837-70113859 CTGGGCTCCTCCTTGGCTCCTGG - Intronic
1043276880 8:78408548-78408570 TTTGGTTGCTCCTTGGATAGTGG - Intergenic
1045340718 8:101252170-101252192 TCTGGCAGCTCCTTGGCTTGTGG + Intergenic
1045548338 8:103148264-103148286 CCTTGATGCTCCTTGGCTGGTGG - Intronic
1048056829 8:130874869-130874891 CTTGGCTTCTCCATGGCTGGGGG - Intronic
1048557711 8:135496777-135496799 CATGGCTGCTGGTCGGCTGGTGG + Intronic
1049416470 8:142497752-142497774 CTTGGTTGGTCCTTGGGTAGGGG + Intronic
1049681840 8:143922424-143922446 GATGGGTGCTCCTGGGCTGGCGG - Intronic
1050395363 9:5189200-5189222 CTTGGCTGCTCCTGGGTTCAAGG + Intergenic
1051376187 9:16405087-16405109 CTTCTCTACTCCTTGACTGGAGG + Intergenic
1052366485 9:27617587-27617609 CTTTGGTGTTCCTTGGCTTGTGG + Intergenic
1052963421 9:34319747-34319769 CTTGGATACTCCATGGGTGGGGG + Intronic
1053872065 9:42503013-42503035 CCTGGCTGCTTCTGAGCTGGTGG - Intergenic
1056804092 9:89714482-89714504 CTTGGCTCCTCATTGGCTGTTGG + Intergenic
1056933007 9:90894075-90894097 TTTGTTTGCTCCTTGGCTGCTGG + Intronic
1056998233 9:91483770-91483792 CTTGTTTGCTCCCTGGCTGAAGG - Intergenic
1057606010 9:96498239-96498261 CGTGGCTGTGCCTTAGCTGGGGG - Intronic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1057748450 9:97771115-97771137 GTGGGCTACACCTTGGCTGGGGG - Intergenic
1057902188 9:98958058-98958080 ATGGGCTCCTCCGTGGCTGGTGG - Intronic
1059799799 9:117738684-117738706 CTTGAATGCTCCTACGCTGGGGG + Intergenic
1059915147 9:119091218-119091240 CTGCCCTCCTCCTTGGCTGGAGG - Intergenic
1060235149 9:121857408-121857430 TTTTGCTGCTCCCTGGCTGTGGG + Intronic
1061709301 9:132476746-132476768 CTGCGGTGCTCCTTGGCTTGTGG - Intronic
1061820941 9:133226889-133226911 CGTGGCTGCTCCAGGGCCGGGGG - Intergenic
1062082247 9:134630224-134630246 CTCAGGTGCTCCTTGGCTTGTGG + Intergenic
1062112727 9:134790829-134790851 GTGGGCTGCTCCTGTGCTGGGGG + Intronic
1062255565 9:135619196-135619218 CTTGGCTGTTGGTTGGCAGGTGG - Intergenic
1062271832 9:135713424-135713446 CTTGCCTGCTGCTTGTCTGAGGG + Intronic
1062457072 9:136644893-136644915 CCTGGCTGCTGCCTGCCTGGTGG - Intergenic
1203458697 Un_GL000220v1:13768-13790 CTTGTTTTCTCCCTGGCTGGAGG + Intergenic
1185667343 X:1776394-1776416 TCTTGGTGCTCCTTGGCTGGTGG - Intergenic
1187308250 X:18116467-18116489 CTTGGCTGCACCTTGCCATGGGG + Intergenic
1187338183 X:18398837-18398859 CGAGGCTGCTCTTTGCCTGGTGG - Intergenic
1188656435 X:32703030-32703052 GTTTGCTGCTGGTTGGCTGGGGG - Intronic
1188981903 X:36734175-36734197 CAGGGCTTCTCCTAGGCTGGAGG + Intergenic
1189602071 X:42637712-42637734 CTTGGCAGCTCCATGGCTTCAGG + Intergenic
1193270948 X:79530189-79530211 CTGTGCTGCACCTTGGCAGGGGG + Intergenic
1194284553 X:91993798-91993820 CTTCCCTTCTCCTTGGCTGCAGG + Intronic
1196442895 X:115730968-115730990 CTTGCCTTCACCTTGGCTTGGGG + Intergenic