ID: 1019668791

View in Genome Browser
Species Human (GRCh38)
Location 7:2267094-2267116
Sequence ATGGAGAAACAGGCTCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1026
Summary {0: 2, 1: 8, 2: 34, 3: 203, 4: 779}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019668791_1019668805 25 Left 1019668791 7:2267094-2267116 CCTCCCTGAGCCTGTTTCTCCAT 0: 2
1: 8
2: 34
3: 203
4: 779
Right 1019668805 7:2267142-2267164 TGTCGGAGCAACTGAAACGAGGG 0: 1
1: 0
2: 2
3: 7
4: 68
1019668791_1019668804 24 Left 1019668791 7:2267094-2267116 CCTCCCTGAGCCTGTTTCTCCAT 0: 2
1: 8
2: 34
3: 203
4: 779
Right 1019668804 7:2267141-2267163 GTGTCGGAGCAACTGAAACGAGG 0: 1
1: 0
2: 0
3: 3
4: 47
1019668791_1019668798 8 Left 1019668791 7:2267094-2267116 CCTCCCTGAGCCTGTTTCTCCAT 0: 2
1: 8
2: 34
3: 203
4: 779
Right 1019668798 7:2267125-2267147 CAGGCCTCCCAGCCCTGTGTCGG 0: 1
1: 1
2: 1
3: 37
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019668791 Original CRISPR ATGGAGAAACAGGCTCAGGG AGG (reversed) Intronic
900001101 1:15275-15297 ATGGGGAAACTGGCCCAGAGAGG + Intergenic
900020816 1:185796-185818 ATGGGGAAACTGGCCCAGAGAGG + Intergenic
900343943 1:2202135-2202157 TTGGAGAACCAGGCTCCAGGAGG + Intronic
900411975 1:2516626-2516648 CTGGAGAAGCAGCCTCTGGGTGG + Intronic
900477942 1:2884754-2884776 AAGGAGTCACAGGCTCAGGGAGG + Intergenic
900864864 1:5261039-5261061 ATGAAGAAACTGACGCAGGGTGG + Intergenic
901006359 1:6173550-6173572 ATGAAGAGAGAGGCTCAGTGGGG - Intronic
901016531 1:6235172-6235194 ATGGGGAAGCAAGCTCAGAGAGG - Intronic
901669793 1:10849564-10849586 GTGAGGAAACAGGCTCAGAGAGG - Intergenic
902181004 1:14688283-14688305 AATGAGAAACAGGCCCAGCGAGG - Intronic
902405179 1:16178918-16178940 TTGAAGAAACAGGCTCAGGGAGG - Intergenic
902540341 1:17149838-17149860 GTGGAGTAACAGGCTCAGGGAGG + Intergenic
902669043 1:17959499-17959521 TTGTAGAAACAGGCCTAGGGAGG + Intergenic
902767088 1:18624343-18624365 AGGAAGAAATAGACTCAGGGAGG - Intergenic
902781870 1:18710170-18710192 TTGGGGAAATAGGCTCAGAGAGG + Intronic
902828299 1:18992700-18992722 GTGGAGAAACAGGTTGAGGCTGG - Intergenic
903024395 1:20417150-20417172 ATGAAGAAGCAGGCTGAGAGAGG - Intergenic
903168326 1:21536767-21536789 AAGGGGAAACAGACTCTGGGTGG + Intronic
903221755 1:21873261-21873283 ATGAAGAAACAGGCTCGGACAGG + Intronic
903288362 1:22291237-22291259 ATGGAGAGACAGGAACAGAGAGG - Intergenic
903469204 1:23573758-23573780 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
903549754 1:24149740-24149762 CTGGAGAAACAGACTCAGAGTGG + Intergenic
903765005 1:25728403-25728425 TGAGAGAAACAGGCTCAGGGAGG + Intronic
903891905 1:26575339-26575361 ATGGGGAAACAGGCTCAAGTTGG + Intergenic
904235490 1:29113982-29114004 TTGGGCAAACAGGATCAGGGAGG + Intronic
904383978 1:30129758-30129780 AGGGAGAAACAGGCTCTTGGAGG - Intergenic
904468388 1:30721265-30721287 CTGGGGAAACAGGGTCAGAGAGG - Intronic
904473590 1:30750748-30750770 ATGAGGAAACAGGCTCAGGAGGG - Intronic
904562233 1:31406653-31406675 ATAGAGAAACAGGCCCAGAAAGG + Intergenic
904588351 1:31592857-31592879 AAGGAGATGGAGGCTCAGGGAGG + Intergenic
904597001 1:31653141-31653163 ATGAGGACACAGGCTCAGAGAGG + Intronic
904617900 1:31759888-31759910 AGAGGGAAACAGGCTCAGGGGGG - Intronic
904834194 1:33324385-33324407 CTGCAGAAACAGGCTGAAGGGGG + Exonic
904846349 1:33420919-33420941 ATGAAGAAACAGGCTCAAAGAGG - Intronic
904849182 1:33444317-33444339 ATGAATAAATAGGCTCAGTGAGG + Intergenic
904940091 1:34159623-34159645 ATGAAGAAACAGGTTCAGAGAGG - Intronic
905003322 1:34690623-34690645 ATGACGAAACAGGCACAGAGTGG - Intergenic
905093567 1:35449626-35449648 ATGGAGAAACAAACTCAGAGAGG - Intronic
905221069 1:36448134-36448156 ATGGAGAAACAGGTTTATAGAGG + Intronic
905291177 1:36922731-36922753 ATGAGGAAACAGGTTCCGGGAGG + Intronic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
905431989 1:37931359-37931381 ATGGAGCAACAGGCCCAGAGAGG + Intronic
905476873 1:38235200-38235222 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
905546338 1:38803197-38803219 ATGGAAAAACAGGCACAGAGAGG - Intergenic
905646388 1:39627309-39627331 ATGGGGAGACAGGCTCAGAGAGG - Intronic
905652927 1:39668521-39668543 ATGGGGAAACAGGCCCAGAAAGG + Intronic
905732329 1:40305562-40305584 ATAGGGAAACAGGCCCAGGGAGG + Intronic
905789134 1:40781190-40781212 ATGGGGAAACAAGTCCAGGGTGG + Intergenic
906282465 1:44563674-44563696 ATGGTGAAACAGGTTCAGAGAGG - Intronic
906286255 1:44589728-44589750 ATGGAAAAACTGGCTTAAGGAGG + Intronic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906531614 1:46526967-46526989 AAGGTGAATCAGGCTCAAGGCGG - Intergenic
906689639 1:47784130-47784152 ATGAGGAAACAGGCTCAGTGAGG + Intronic
906750564 1:48255345-48255367 ATGAAGAAACAAACTCAGAGAGG + Intergenic
906808830 1:48805789-48805811 ATGAGGAAACAGGCTGAGAGAGG - Intronic
907076998 1:51587998-51588020 ATGAGGAAACAGGTTCAGAGAGG - Intronic
907394308 1:54178596-54178618 ATGGAGGGACAGGCTGAGGTGGG + Intronic
907511895 1:54967609-54967631 AAGAAGAAACAGGCTCCGAGGGG - Intergenic
907782201 1:57577560-57577582 ATAAAGAAACAGGCTCAGAGAGG + Intronic
908156673 1:61360414-61360436 AGGGAGACACAGGCTCAGAGAGG - Intronic
908797987 1:67850566-67850588 ATGAAGAAAGAGGCTCAGAGAGG - Intergenic
909421827 1:75475844-75475866 ATGAAGAAATTGGCCCAGGGAGG - Intronic
909661016 1:78082150-78082172 ATGTGGAAACAGGCTCAGGAAGG + Intronic
909986509 1:82167261-82167283 ATGAAAAAAAAGGCTCAGGCAGG - Intergenic
910039715 1:82835073-82835095 ATTGAGAAAAAGGCTGAGCGGGG + Intergenic
910197805 1:84662475-84662497 ATGGAAAAAGAGGCTCCTGGAGG - Exonic
910378121 1:86595440-86595462 ATGGGGTAACAGGCAGAGGGTGG - Intergenic
910408807 1:86917562-86917584 ATGCAGGAACAGGCTTAGAGAGG + Intronic
910452050 1:87357389-87357411 ATAGAGAAACAGGCCCAGAGAGG - Intergenic
910651538 1:89573672-89573694 ATAGAGAAGCAGGATCAGTGAGG - Intronic
910667207 1:89738766-89738788 ATGGAGGAAAAGGCTCATGAAGG + Intronic
911063060 1:93764335-93764357 ATGGAGAAAGAGGATGAAGGAGG - Intronic
911335599 1:96576461-96576483 ATGTAGAAACAGGTATAGGGAGG + Intergenic
911582020 1:99644931-99644953 ATGAGGGAACAGGCTCAGAGAGG - Intergenic
912460220 1:109825475-109825497 ATGCAGAAACAGGCAGAGAGAGG + Intergenic
912587730 1:110782016-110782038 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
912597897 1:110897643-110897665 ATGAAGAAACAGGCATAAGGTGG - Intronic
913012376 1:114697095-114697117 AAGGAGAAGCAGGTTCATGGAGG - Intergenic
913539462 1:119804975-119804997 GTGAGGAAACAGGCTCAGGATGG + Intronic
914447147 1:147759727-147759749 ATGAAGAAACAGACTCAGTGAGG - Intronic
915614755 1:157028874-157028896 ATGGAGAAACTGGCTGGGCGTGG + Intronic
915614984 1:157030748-157030770 ATAGGGAAGCATGCTCAGGGAGG - Intronic
915985450 1:160459715-160459737 ATGGGAAAACAGGCTTAGAGAGG + Intergenic
916211877 1:162366369-162366391 ATGAGGTAACAGACTCAGGGAGG + Intronic
916879200 1:169002628-169002650 AAGGAGAAAAAGGCTAAAGGAGG + Intergenic
916880032 1:169011819-169011841 ATGAGGAAGCAGGCTTAGGGAGG - Intergenic
917470308 1:175320982-175321004 ATGAAGAAACTGGCCCAGAGAGG + Exonic
917629060 1:176875284-176875306 ATGCAGAAATTGGCTAAGGGAGG + Intronic
917965281 1:180174867-180174889 ATGAAGAAACAGGCTCGGCCAGG + Intronic
918044325 1:180932352-180932374 ATGGAGAAAGAGGCCCACGAAGG - Intronic
918256174 1:182749953-182749975 ATGAAGAAACAGACTAAGAGAGG - Intergenic
918346571 1:183612633-183612655 ACGAAGAAACAGGCTCAGAAAGG + Intergenic
919449784 1:197757217-197757239 ACAAAGAAACAGGCTCAGAGTGG + Intronic
919561876 1:199131332-199131354 ATGAAGAAACATGCTCAGTGAGG + Intergenic
919743868 1:200996524-200996546 ATGATGAAACAGGCTCAGAGAGG - Intronic
919765171 1:201122516-201122538 AAGAGGAAACAGGCTCAGAGAGG + Intronic
919975232 1:202606215-202606237 ATGGGGAAACAGGTTCAGAGAGG + Intronic
920006340 1:202836295-202836317 GTGGAGAGACTGGCTCAGAGAGG - Intergenic
920061535 1:203230062-203230084 ATGGAGAAACAGTTTGAGAGAGG - Intronic
920124840 1:203685737-203685759 AAGAAGAAACAGACTCAGGGAGG - Intronic
920176804 1:204107209-204107231 ATGAGGAGACAGGCTAAGGGAGG + Intronic
920697374 1:208191627-208191649 ATGAAGAAACAGGCACAGAGAGG + Intronic
921319795 1:213927644-213927666 CAGGAGATACAGGCTCAGGGAGG - Intergenic
921480727 1:215661887-215661909 ATGGCAAAACAGACCCAGGGAGG - Intronic
922057758 1:222057652-222057674 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
922532585 1:226355800-226355822 ATGTGGAAACAGGCTCAGAGAGG - Intergenic
922802207 1:228369620-228369642 ATGGGGATCCAGGCTCAGGCTGG - Intronic
922915736 1:229256157-229256179 ATGGAGTCACAGGCTCACTGTGG - Intergenic
923915028 1:238492311-238492333 TTGGAGAACCAGCCTGAGGGAGG + Intergenic
924221199 1:241876906-241876928 ATAAACAAATAGGCTCAGGGAGG - Intronic
924473433 1:244363541-244363563 CTGGAAGAACAGGCTCTGGGTGG + Intronic
924934756 1:248758505-248758527 ATAAGGAAACAGGCCCAGGGAGG + Intergenic
1063474646 10:6317773-6317795 TTGGAGACAGAGGCTGAGGGTGG + Intergenic
1063602577 10:7495755-7495777 AGAGAGAAACAGGCTGAGAGAGG + Intergenic
1063604372 10:7509272-7509294 ATGGGCAAACAGGCTCAGAGAGG + Intergenic
1063653403 10:7962987-7963009 ATTAGGAAACAGGCTCAGAGAGG + Intronic
1063749568 10:8927426-8927448 CTGGAGAGACAGGGTCAAGGTGG - Intergenic
1064110665 10:12535908-12535930 ATGAGGACACAGGCTCAGAGGGG + Intronic
1064681307 10:17813101-17813123 ATGAAGCACCAGGCTCAGGGAGG + Intronic
1064956186 10:20913080-20913102 AGGGTGAAATAGGCTTAGGGAGG + Intronic
1065155267 10:22863001-22863023 ATGAGGAAACAGGGTCAGAGGGG + Intergenic
1066228898 10:33412640-33412662 AGGGAGAAACTGGCTGATGGAGG + Intergenic
1067067963 10:43114244-43114266 ATGGAGACAGAGGCTCAGAGAGG - Intronic
1067977425 10:51041979-51042001 ATGGAGACTCAGGTTCAGGCAGG - Intronic
1068309978 10:55264022-55264044 AAGGAAAAACAGGCCCGGGGCGG - Intronic
1068604048 10:58986029-58986051 ATGGAGAAAGAGGCAAAGAGAGG + Intergenic
1068874304 10:61980189-61980211 ATGGAGGAAGGGGCTCAGGAGGG + Intronic
1069610671 10:69770507-69770529 ATGGGAACAGAGGCTCAGGGAGG + Intergenic
1069825393 10:71252209-71252231 ATGGCAAAACAGGCCCAGAGAGG - Intronic
1069827294 10:71262088-71262110 ATGGAGAAGCCAGCTCAGGCTGG - Intronic
1069842106 10:71346354-71346376 ATGGGAAAACAGGCTCATGGAGG + Intronic
1070371236 10:75784239-75784261 GTGAGGAAACAAGCTCAGGGAGG - Intronic
1071052229 10:81464903-81464925 ATGGTAAAACAGCCTCAGGCAGG - Intergenic
1071160800 10:82743101-82743123 AGGGAGAGAAAGGCACAGGGTGG - Intronic
1071564519 10:86664867-86664889 TTGGAGGGATAGGCTCAGGGGGG + Intronic
1072205674 10:93203366-93203388 ATGGAAAACCAAGCTCAGAGAGG - Intergenic
1072660675 10:97361645-97361667 GTGGAGAAACAGGAACCGGGAGG + Intronic
1073082300 10:100867929-100867951 ATGAGGAAACGGGCTCAGTGAGG + Intergenic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074113659 10:110439913-110439935 AAGGAGATAGAGGCTCAGAGAGG + Intergenic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074525250 10:114257496-114257518 ATGAGGGAACAGGCTCAGAGAGG + Intronic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074541635 10:114370040-114370062 ATGGGGAAACAGAGTCAGGGAGG - Intronic
1074624938 10:115172525-115172547 ATGGAGAGAGTGGCTCAAGGAGG - Intronic
1075015606 10:118908197-118908219 CTAGAGAAACAGGCTGAGTGGGG - Intergenic
1075686301 10:124367463-124367485 ATCAGGAAACAGGCTCAGAGAGG + Intergenic
1075721608 10:124590765-124590787 ACAGAGAAGCAGGCTCAGGAAGG - Intronic
1075922414 10:126224464-126224486 AGGGAGAAACAAGCACAGGAAGG + Intronic
1075948336 10:126456740-126456762 ATAGAGACACAGACGCAGGGAGG + Intronic
1076402466 10:130193051-130193073 TTGGAGAAGCAGGGACAGGGTGG - Intergenic
1077146887 11:1050450-1050472 ATGAGGAAACAGGCACAGAGAGG + Intergenic
1077501464 11:2911464-2911486 CTGGAGAGACAGGCCCTGGGTGG - Intronic
1078128698 11:8594049-8594071 CTGGAGTCACTGGCTCAGGGCGG - Intronic
1078730245 11:13966813-13966835 ATGGAGAAATTGGCTCAGAGAGG - Intronic
1078746211 11:14117872-14117894 ATAAGGAAACAGGCTCAGGGAGG - Intronic
1079138889 11:17794448-17794470 ATGAAGAACCAGGCTCAGAGAGG + Intronic
1079295455 11:19229529-19229551 CTGGAGAAAGAGGCTCAAAGAGG - Exonic
1079322169 11:19460352-19460374 ATGTGAAAAGAGGCTCAGGGAGG - Intronic
1079401999 11:20113179-20113201 ATGAGGAAATAGGCCCAGGGAGG - Intronic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1080691296 11:34560757-34560779 ATGAGGAAACAGACTCAGGCAGG + Intergenic
1080804033 11:35635578-35635600 ATGGGGAAACAGGCACAGAGTGG + Intergenic
1081351558 11:42059230-42059252 TTGGATAGACAGGGTCAGGGAGG - Intergenic
1081863995 11:46349689-46349711 ATGGAGAAACAGGCCAGGTGTGG - Intronic
1082792981 11:57359982-57360004 ATGGAAAAACAGACTCAGAGAGG + Intronic
1082806496 11:57454984-57455006 ATGGAGAAACAGGCTCAGAGAGG - Intergenic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083233598 11:61338297-61338319 ATGTAGAAACAGATTCAGAGAGG - Intronic
1083315550 11:61812915-61812937 ATGAGATAACAGGCTCAGGGAGG - Intronic
1083633121 11:64105840-64105862 TGGAAGAGACAGGCTCAGGGTGG - Intronic
1083796710 11:65021150-65021172 ATGGTGAAGCAGGCTCACAGAGG + Intronic
1083935801 11:65869527-65869549 AAGAAGAAACAGGCTCAGAGAGG + Intronic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1084130563 11:67130884-67130906 ATGGAGAGAGAGGCCCAGGGAGG + Intronic
1084949477 11:72656826-72656848 ATGGGGAAACAGGCCCAGGGTGG - Intronic
1084964640 11:72738320-72738342 AATGCAAAACAGGCTCAGGGAGG - Intronic
1085025757 11:73235631-73235653 ATGGAGAAACAGGCCCAGAGAGG + Exonic
1085039254 11:73317375-73317397 ATAAAGAAGCAGGCTCAGAGTGG + Intronic
1085052560 11:73387373-73387395 ATGGGGAGACAGGCTCGAGGTGG + Intronic
1085114120 11:73915110-73915132 ATGAGGAAGCAGGCTCAGAGAGG - Intronic
1085218154 11:74850182-74850204 ATGAAGCAACAGACTCAGAGAGG - Intronic
1085245347 11:75096755-75096777 ATGGGGAGATAGGCTCAGGGAGG - Intergenic
1085297040 11:75437176-75437198 ATGGGGAAATAGGCCCAGAGAGG + Intronic
1085440118 11:76553780-76553802 ATGGAGAAACTGACTCGGAGAGG - Intergenic
1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG + Intronic
1085725661 11:78952473-78952495 AGGGAGAGACAGGGGCAGGGAGG + Intronic
1085782678 11:79423662-79423684 CTGGAGCAGCAGGCGCAGGGAGG + Intronic
1085840952 11:80011405-80011427 GGGGAGAAAAAGTCTCAGGGAGG + Intergenic
1086286689 11:85259685-85259707 ATGGAGAGACAGGTTCAGATGGG - Intronic
1086408584 11:86520881-86520903 ACTGAGGAACAGGCTCAGAGAGG - Intronic
1087361793 11:97169955-97169977 ATGGGAAATCAGGCTCATGGAGG - Intergenic
1087611091 11:100434854-100434876 ATGGAGAAGGATGCCCAGGGTGG - Intergenic
1088447302 11:109945868-109945890 ATGGAGAAACAGAAACATGGAGG - Intergenic
1088530226 11:110800081-110800103 ATGGGGACACAGGCTCTGGGTGG + Intergenic
1088867048 11:113858303-113858325 AAGGTGGAACAGGCTAAGGGGGG - Intronic
1088968463 11:114749864-114749886 GTGGGGAATCAGGCACAGGGTGG - Intergenic
1089001788 11:115058089-115058111 ATGGTGGGACAGGCACAGGGTGG - Intergenic
1089029633 11:115311676-115311698 ATGGGAAAACAGGCTGAGAGTGG + Intronic
1089192436 11:116662702-116662724 TTGAAGAAACAGTCTCAGAGAGG - Intergenic
1089399322 11:118155353-118155375 ATGAAGAAAGAGGCTCAGAGAGG + Intergenic
1089515118 11:119027274-119027296 AATGAGAAACAGGACCAGGGAGG + Intronic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089654732 11:119938962-119938984 GTGGAGACACAGGCTCAGTGTGG + Intergenic
1089699617 11:120236598-120236620 AGGGAGTATCAGGCTCAGGGGGG + Intergenic
1089929512 11:122296105-122296127 ATGAAGAAATAGGTTCAGAGAGG - Intergenic
1089974665 11:122722154-122722176 ATGAAGACAGAGGCACAGGGAGG + Intronic
1090024423 11:123155529-123155551 ATGGAGAAACCAGCTCAGAGGGG + Intronic
1091374190 12:15390-15412 ATGGGGAAACTGGCCCAGAGAGG + Intergenic
1092145554 12:6212252-6212274 ATGAAGAAACAGGCTCCGAGAGG - Intronic
1092248141 12:6874942-6874964 AGGAAGAAACAGGCACAGGGAGG - Intronic
1092370185 12:7910413-7910435 ATGGATAAACAGGCTGGGCGCGG + Intergenic
1092752631 12:11733027-11733049 ATGGAGAAACAGAGTCTGAGTGG - Intronic
1093483635 12:19629778-19629800 ATGAAGAAACAATCTCAGGGAGG + Intronic
1093936900 12:25011111-25011133 ATAAAGAAACAGGTTCAGAGAGG + Intergenic
1094218999 12:27973782-27973804 CTGGAGGAACTGCCTCAGGGAGG + Intergenic
1094461426 12:30700582-30700604 ATGAGGAAACAGGCACAGAGAGG - Intergenic
1094697691 12:32837351-32837373 ATGAGGAAACAGCCTCAGAGAGG - Intronic
1095223985 12:39656591-39656613 ATTGTAAAACAGGCTCAGGCAGG + Intronic
1095704995 12:45227477-45227499 CTGAAGAAACAGGCTCAGAGAGG - Intronic
1095817273 12:46438305-46438327 ATGAGGAAACTGGCTCAGAGAGG + Intergenic
1096410839 12:51376180-51376202 AAGAGGAAACAGGTTCAGGGAGG + Intronic
1097238215 12:57554258-57554280 ATGACGAAACAGGCTCAAAGAGG - Intronic
1097954037 12:65464899-65464921 ATGAAGAAATAGGCACAGAGAGG - Exonic
1098029583 12:66240237-66240259 ACAGGGAAACAGGCTTAGGGGGG + Intronic
1098401444 12:70080866-70080888 ATTGAGAAACAGCAGCAGGGAGG + Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100150959 12:91737057-91737079 ATGAGGAAACAGGTTTAGGGAGG - Intergenic
1100388063 12:94121878-94121900 AATGGGAAACAGGCTCAGAGAGG - Intergenic
1100657167 12:96659592-96659614 ATGGAGAAATAGACTCATGAAGG + Intronic
1101109080 12:101468191-101468213 ATGAAGAAACAGGCTCAGGGAGG - Intergenic
1101272655 12:103163909-103163931 CTGGGGAAAAAGGCTCAGAGAGG + Intronic
1101314729 12:103618702-103618724 ATGAGGAAACAGGCACAGAGTGG - Intronic
1101625810 12:106440174-106440196 ATAGAGAAAAAGGGTCAGGACGG - Intronic
1101755767 12:107619578-107619600 CTGGGGAAAGAAGCTCAGGGGGG - Intronic
1101774883 12:107784566-107784588 ATGGGGAAATAGGTTCAGAGAGG - Intergenic
1101777487 12:107807504-107807526 ATGAGAAAACAGTCTCAGGGGGG + Intergenic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1101846668 12:108368358-108368380 ATGGAGAAACAGGCCCAGAAGGG + Intergenic
1101853795 12:108425532-108425554 CAGGACAAACAGACTCAGGGAGG + Intergenic
1101870727 12:108563115-108563137 CTGGGGAAACAGGTTCAGAGAGG - Intronic
1102010588 12:109616154-109616176 GTGGGGAAACAGGTTCAGAGAGG - Intergenic
1102042599 12:109810314-109810336 ATGGAGGCACAGGGTCTGGGAGG + Intronic
1102195717 12:111023877-111023899 CTGAAGAAACAGGTTCAGGCAGG + Intergenic
1102210579 12:111123894-111123916 ATAAGGAAACAGGCTCAGAGGGG + Intronic
1102246584 12:111360489-111360511 ATGTGGAAACAGGCTCACTGAGG - Intergenic
1102512470 12:113425103-113425125 AAGGGGAAACAGGCACAGAGAGG + Intronic
1102570555 12:113824736-113824758 TTGAAGAAACAGGCTCAGAGAGG - Intronic
1102752912 12:115311335-115311357 TGGGAGAAAAAGGATCAGGGTGG + Intergenic
1102766883 12:115441065-115441087 ATGAAGAAATAGGCTTAGAGGGG + Intergenic
1103102354 12:118189719-118189741 AAGCCGAGACAGGCTCAGGGAGG + Intronic
1103151283 12:118641206-118641228 ATGGAGGAAGGGACTCAGGGAGG + Intergenic
1103201000 12:119087896-119087918 ATGAGAAAACAGGCTCAGAGAGG - Intronic
1103273763 12:119694884-119694906 ATGGAGAAACAGGTTGTGAGAGG - Intronic
1103538382 12:121649347-121649369 AGGAGGAAACAGGTTCAGGGAGG - Intergenic
1103916235 12:124377018-124377040 AGGGAAAAAGAGGCACAGGGTGG + Intronic
1103922209 12:124404925-124404947 AGGAGGAAACAGGCTCAGAGAGG + Intronic
1104360919 12:128132482-128132504 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1104739653 12:131163631-131163653 ACAGAGAAACAGGGTCAGGCCGG - Intergenic
1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG + Intronic
1104939472 12:132388130-132388152 AGGGAGATGCAGGCTCAGAGAGG + Intergenic
1105701573 13:22939004-22939026 GTGGAGAAAAAGGCACAGGTGGG - Intergenic
1105822516 13:24092138-24092160 ATGGAAGAACAGGTTTAGGGAGG + Intronic
1106193472 13:27474139-27474161 ATGAAGAAACAGGCCCAGACAGG + Intergenic
1106373044 13:29155544-29155566 ATGAAGAGGCAGGCTCAGGATGG + Intronic
1108000784 13:45904105-45904127 ATGAGGAAACAGGCTTAGAGAGG - Intergenic
1108143862 13:47455982-47456004 ATGAAGAAATAATCTCAGGGAGG - Intergenic
1108159535 13:47623745-47623767 ATGTAGAGTAAGGCTCAGGGTGG + Intergenic
1108379773 13:49844635-49844657 ATGTAGAAACAGGCTCACAGAGG - Intergenic
1108666001 13:52631260-52631282 CTGGGGAAACAGGCTGATGGAGG - Intergenic
1108739191 13:53317663-53317685 ATGAGGAAAAAGGCTCAGAGAGG + Intergenic
1110249924 13:73370306-73370328 AAGGAGAAACACGCGCAGAGTGG - Intergenic
1111651416 13:91094992-91095014 ATCCAGAAACAGCCTCTGGGAGG + Intergenic
1112086628 13:96038992-96039014 ATGGAGAGACAGGCATAGGATGG + Intronic
1112185645 13:97125531-97125553 AGGGAGAAGCAGGCTCATGGGGG - Intergenic
1112497504 13:99916370-99916392 ATGGAGAAGTAGGCTCATCGGGG - Intergenic
1112813256 13:103243595-103243617 TTGGGGAAACAGTTTCAGGGAGG - Intergenic
1112826362 13:103397155-103397177 ATGGTGAAACAGGCACAGAATGG + Intergenic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1114382331 14:22220491-22220513 AAGGAGAAAAATGCCCAGGGAGG + Intergenic
1114508978 14:23240953-23240975 ATGAAGAGACTGGCTCAGAGAGG + Intronic
1115150177 14:30275786-30275808 ACAGAGAATCAGGTTCAGGGAGG + Intergenic
1115297993 14:31852129-31852151 ATGGAGAGAAAGGTTCAGAGAGG - Intronic
1115631173 14:35247044-35247066 ATGATGAAACAGGCTCAGAGAGG + Intronic
1115976751 14:39005269-39005291 TTCTAGAAACAGGCTCAGGAGGG - Intergenic
1116001094 14:39243573-39243595 ATGAAGAACCAGGCTGGGGGTGG + Intronic
1117019094 14:51550822-51550844 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1117642320 14:57813063-57813085 ATGAGGAAACAGGCACAGAGAGG + Intronic
1118165077 14:63328222-63328244 TTGGAGGATCAGGATCAGGGCGG - Intergenic
1118319777 14:64746453-64746475 TTGGACAAACAAGCTCAGGGAGG - Exonic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119613807 14:76085132-76085154 ATGAGGAAACAGACTCAGAGAGG + Intergenic
1119877839 14:78075575-78075597 ACTGGGAAACAGGCTCAGAGGGG + Intergenic
1120785905 14:88535485-88535507 ATTAAGAAACAGACTCAGTGAGG - Intronic
1121103804 14:91267749-91267771 ATGGAGTAACAGGACCACGGGGG + Intergenic
1121181727 14:91934280-91934302 ATGAGAAAACAGGCTCAGTGAGG - Intronic
1121246121 14:92462048-92462070 AGGCGGAAACAGGCTCAGAGAGG + Intronic
1121419457 14:93802509-93802531 ATGAGGAAACAGGCCAAGGGAGG + Intergenic
1121495480 14:94389047-94389069 ATGAGGAAACAGGCTCAGAGCGG + Intronic
1121645542 14:95515485-95515507 AAGCAGAAACAGGCCCAGAGAGG - Intergenic
1121808272 14:96852433-96852455 AAGGAGAAACAGTCACAGGAAGG + Intronic
1121844677 14:97162322-97162344 ATACACAAACAGGCTCAGGCTGG - Intergenic
1122045205 14:99018009-99018031 ATGAGGAAACAGGCTCAGCAAGG - Intergenic
1122229716 14:100299716-100299738 CAGGAGAAACAGGCTCAGTGAGG + Intronic
1122971312 14:105153389-105153411 ACAGAGACCCAGGCTCAGGGCGG + Intronic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1124490891 15:30154559-30154581 ATGGGGAAACAGGTTCAGAGAGG + Intergenic
1124625867 15:31307199-31307221 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1124632151 15:31344149-31344171 CTGGAGTGACAGGCTCAGGGTGG - Intronic
1124752642 15:32383772-32383794 ATGGGGAAACAGGTTCAGAGAGG - Intergenic
1124999534 15:34755384-34755406 ATGGAGATGCTGGCTGAGGGAGG + Intergenic
1126096757 15:45095655-45095677 ACGGAGACACAGGCAGAGGGAGG + Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126407619 15:48337433-48337455 ATGAGGAAACAGGCTCAGAAAGG - Intronic
1126408083 15:48343591-48343613 ATGCAGAAATGGGCTCAGAGAGG + Intergenic
1127764149 15:62168300-62168322 ATGCAGAAACAGGCTCACAAAGG + Intergenic
1128252489 15:66172802-66172824 ATGAGGAAACAGGCTCAGACAGG + Intronic
1128323932 15:66711400-66711422 CTGAGGAAACAGGCTCAGAGAGG + Intronic
1128325964 15:66724512-66724534 AAGAAGTAACAGGCTCAGAGAGG + Intronic
1128576879 15:68782360-68782382 ATGAAGAAATAGGCTCAGAAAGG + Intronic
1128579338 15:68797911-68797933 ATGGCCAAACAGGCTAGGGGAGG + Intronic
1128761021 15:70216078-70216100 TTGAAGAAACAGGCCCAGAGAGG + Intergenic
1128937476 15:71759380-71759402 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1129230496 15:74194534-74194556 ATGGAGAAACGGTCTCAGAAAGG + Intronic
1129250438 15:74305888-74305910 ATGAAGAGACAGGATCAGAGAGG - Intronic
1129575731 15:76743075-76743097 ATGAACAAATAGGCTCAGAGAGG + Intronic
1129595706 15:76962497-76962519 ATGGAGAAACCGGTAGAGGGTGG - Intergenic
1129660428 15:77550063-77550085 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
1129687324 15:77694337-77694359 ATGAGGAAACAGGCCCAGAGAGG + Intronic
1129713380 15:77832944-77832966 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1129852061 15:78798996-78799018 ATGAGGAAACAGGCTCAGAGGGG - Intronic
1129901781 15:79157062-79157084 ATGTGGAAACAGCCTCAGAGAGG + Intergenic
1130250942 15:82300091-82300113 ATGAGGAAACAGGCTCAGAGGGG + Intergenic
1130287503 15:82568181-82568203 ATGAGGAAATAGGCTCATGGAGG - Intronic
1130515912 15:84625655-84625677 ATGGAGAGGCAGGCATAGGGAGG - Intronic
1130551894 15:84894796-84894818 ATGAGGAAACAGGCTCAGTGAGG + Intronic
1130660027 15:85824059-85824081 ATGAAGAAACAGGCTGATGGAGG + Intergenic
1130785662 15:87093118-87093140 TTGGAGACTCAGGCTCAGGTTGG + Intergenic
1130988588 15:88860996-88861018 AAGGACAAACAGGCTCATGGTGG - Intronic
1131390450 15:92043881-92043903 AGGGAGAAACAGGAGGAGGGAGG - Intronic
1131864010 15:96687533-96687555 ATGAGGAAACAGGCTCAGGGAGG + Intergenic
1132153339 15:99477609-99477631 TTGAAGAAACAGGCTCAGGGAGG + Intergenic
1132452409 15:101975665-101975687 ATGGGGAAACTGGCCCAGAGAGG - Intergenic
1132454487 16:14957-14979 ATGGGGAAACTGGCCCAGAGAGG + Intronic
1132617196 16:847535-847557 AGAGAAAAAGAGGCTCAGGGAGG + Intergenic
1132988787 16:2782543-2782565 AAGGGGAAACAGGCCCAGAGAGG - Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133644070 16:7746489-7746511 ATTGAAAAAGAGGCTTAGGGAGG + Intergenic
1134238583 16:12487049-12487071 AAGGGGAAACAGGCACAGAGAGG - Intronic
1134330401 16:13245616-13245638 AAGAAGAAACAGGCTCAAAGAGG + Intergenic
1134572425 16:15302668-15302690 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1134729957 16:16453373-16453395 GTGAAGAAACAGGCTCAGAGAGG + Intergenic
1134837586 16:17375066-17375088 AGGCAGACACAGGCTCAGAGAGG + Intronic
1134878134 16:17720418-17720440 ATGGGAAAACACACTCAGGGAGG + Intergenic
1134907346 16:17991668-17991690 ATGGAAACTCAGGCTCAAGGAGG + Intergenic
1134937476 16:18258527-18258549 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1135184463 16:20303279-20303301 AGGAAGAAACATGCTCAGAGAGG - Intergenic
1135485184 16:22858717-22858739 ATACAGAAACAGACTCAGAGAGG - Intronic
1135627871 16:24011815-24011837 ATGAAGAAACAGGAACAGAGAGG - Intronic
1135657992 16:24268282-24268304 AAGGAGACAGAGGCTCAGAGAGG + Intronic
1135861337 16:26058795-26058817 ATGCGGAAACAGGCCCAGAGAGG + Intronic
1136011514 16:27366542-27366564 ATGGAGAAACAGTTTTAGAGAGG + Intergenic
1136369360 16:29826268-29826290 ATGAGGAAACAGGCACAGGGTGG + Intronic
1136392953 16:29976923-29976945 ATAAAGAAACAGGCTCAGCAAGG - Intronic
1136475297 16:30509296-30509318 AAGGAAATACAGGTTCAGGGAGG - Intronic
1136615114 16:31393744-31393766 TGGGGGAAACAGGCCCAGGGAGG - Intronic
1136620471 16:31425051-31425073 AGAGAGAAACAGGCTTAGAGAGG - Intronic
1136686319 16:31996777-31996799 AGGAGGAAACAGGCTCAGAGAGG + Intergenic
1136786932 16:32940306-32940328 AGGAGGAAACAGGCTCAGAGAGG + Intergenic
1136882841 16:33913483-33913505 AGGAGGAAACAGGCTCAGAGAGG - Intergenic
1137010436 16:35315447-35315469 GTGAGGAAACAGTCTCAGGGAGG + Intergenic
1137024048 16:35455773-35455795 ATGAGGAAACAGTCTCAGGGAGG + Intergenic
1137491708 16:48938488-48938510 ATGAGGAAACAGGTTCAGAGAGG + Intergenic
1137812796 16:51368803-51368825 ATGAAGAAACAGATTCAGAGAGG + Intergenic
1138230714 16:55333864-55333886 ATGAGGAAATAGGCTCAGAGAGG + Intergenic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1138498161 16:57421316-57421338 ATGGAGAAATAGGCTCAGGCAGG - Intergenic
1139465145 16:67150408-67150430 ATAGAGTAAGAGGCCCAGGGAGG + Exonic
1139528379 16:67529838-67529860 ATGCAGAAACAGGCCCAGAGAGG + Exonic
1140183520 16:72745275-72745297 ATTGAGAAACAGACCCAGTGAGG - Intergenic
1140865791 16:79060950-79060972 ATGGAAAAACAAGCACAGAGAGG + Intronic
1141198144 16:81877000-81877022 AACAAGAAACAGGCCCAGGGAGG - Intronic
1141290759 16:82716287-82716309 ATGGAAAAGCAGGCTCGGGATGG - Intronic
1141346195 16:83248276-83248298 AAGGAGAAACAGAGGCAGGGGGG + Intronic
1141486396 16:84343137-84343159 ATGGAGACTGAGGCCCAGGGAGG + Intergenic
1141520520 16:84575792-84575814 GAGGAGACTCAGGCTCAGGGAGG - Intronic
1141760171 16:86023031-86023053 ATGAGGAAACAGGCTCAGATAGG + Intergenic
1141768625 16:86075039-86075061 ATGGAGAAACAGGCCCAGGGTGG - Intergenic
1141990526 16:87606597-87606619 ATGAAGAAACAAGCTCAGAGAGG - Intronic
1142001721 16:87668132-87668154 AAGGAGGAACAGGCTCAGGCAGG - Intronic
1142150277 16:88509603-88509625 GTGGAGAAACAGGCCTGGGGAGG + Intronic
1142150290 16:88509658-88509680 GTGGAGAAACAGGCCCAGGGAGG + Intronic
1142326125 16:89415853-89415875 ATGGAGAACCAGCCTCAGTGAGG + Intronic
1203089168 16_KI270728v1_random:1201976-1201998 AGGAGGAAACAGGCTCAGAGAGG + Intergenic
1142871730 17:2825591-2825613 ATGGGAAAACAAGCTCAGAGAGG - Intronic
1143097929 17:4488363-4488385 ATGGAGAAGCTGGGTCAGAGTGG - Intergenic
1143270173 17:5669472-5669494 AAGTGGAGACAGGCTCAGGGAGG + Intergenic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143618892 17:8069881-8069903 ATGAGGAAACAGGCACAGAGAGG - Intergenic
1144395361 17:14837913-14837935 ATGAAGAAACAGACTAAGTGAGG - Intergenic
1144721428 17:17473144-17473166 GAGGAGACCCAGGCTCAGGGAGG + Intergenic
1144755783 17:17679999-17680021 ATGAGGAAACAGGCGCAGAGTGG - Intergenic
1144822078 17:18082292-18082314 ATGTAGAAACAGGCTCAGAGAGG + Intergenic
1144840273 17:18181811-18181833 ATAGGGAAACAGGCCCAGAGAGG - Intergenic
1144966324 17:19078936-19078958 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1144981594 17:19173121-19173143 TTGAGGAAACAGACTCAGGGAGG - Intergenic
1144986630 17:19205118-19205140 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1145008464 17:19352174-19352196 ATGAAAAAACAGGCTAAGTGGGG - Intronic
1145259004 17:21343714-21343736 CTGGGGAAACAGGCACAGAGAGG + Intergenic
1145317617 17:21744290-21744312 CTGGGGAAACAGGCACAGAGAGG - Intergenic
1145375444 17:22343421-22343443 CTGAAGAAACAGGGTGAGGGGGG - Intergenic
1146185171 17:30719932-30719954 ATGGGGAAATAGGTTCAGAGAGG + Intergenic
1146296653 17:31655366-31655388 ATCGGGAAGCAGGCTCAGAGGGG - Intergenic
1146315356 17:31802678-31802700 AGGGAGAAACAGGCTGTGGCTGG - Intergenic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1146405148 17:32530224-32530246 ATGGACAAAAAGGCTTAGAGAGG - Intronic
1146556212 17:33826562-33826584 ATGAGGAAACAGGCCCAGAGAGG + Intronic
1146913709 17:36664807-36664829 ATGGAGAAACTGAGTCTGGGAGG + Intergenic
1147147278 17:38492445-38492467 AGGAGGAAACAGGCTCAGAGAGG + Intronic
1147744113 17:42684623-42684645 ATGGAGAAAGAAGCAGAGGGGGG + Intronic
1147864232 17:43542500-43542522 AGGGAGACCCAGGCTCAGGCAGG - Intronic
1147976746 17:44252371-44252393 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1148049633 17:44763282-44763304 ATGGAGAAACAGGCACAGAGAGG + Intronic
1148082851 17:44976990-44977012 ATGGAGGGTGAGGCTCAGGGAGG + Intergenic
1148216887 17:45838149-45838171 AAGGAGAAATGGGCTCAGGTGGG - Intergenic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1149344767 17:55723600-55723622 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1149494966 17:57111571-57111593 ATGGGGAAACAAGCCCAGAGAGG - Intronic
1149858874 17:60109971-60109993 ATGTAGAAACAGGCTCCAAGGGG - Intergenic
1150453202 17:65286793-65286815 CTGAAGAAACATGCTCAGAGAGG + Intergenic
1150776920 17:68088486-68088508 ATGGGGAAACAGACTCAATGAGG + Intergenic
1151040880 17:70859889-70859911 ATGAAGAAACAGTCTCAAGCAGG - Intergenic
1151209810 17:72536083-72536105 ATGAAGAAACATGTTCAGAGAGG - Intergenic
1151306429 17:73265574-73265596 ATTGAGACACAGGCACAGAGGGG + Intergenic
1151352039 17:73537514-73537536 ATGGAGAGGCAGGCAGAGGGTGG + Intronic
1151542316 17:74770872-74770894 GTGGAGGCACAGGCTCAGGGTGG - Exonic
1152002659 17:77656090-77656112 CTGGATGAACAGGCTCGGGGTGG + Intergenic
1152036213 17:77874712-77874734 AAGAGGAAACAGGCTCAGGATGG - Intergenic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1152218381 17:79047580-79047602 ATGGCAAAACAGGCTCAGCAGGG + Exonic
1152366655 17:79860378-79860400 AATGATAAACAGGCTCAGGCGGG - Intergenic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153247711 18:3089737-3089759 ATGAAGAAATAGGCTTAGGAAGG + Intronic
1153764680 18:8364291-8364313 ATGAGAAAACAGGCTCGGGGTGG + Intronic
1153923174 18:9809144-9809166 AGGTAAAAACAGGCTCAGGATGG - Intronic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1154405638 18:14087854-14087876 ATGGACAAAAAGGATCTGGGAGG + Intronic
1154982689 18:21516695-21516717 ATGAAGAAACATGTTCAGGTTGG + Exonic
1155154202 18:23144476-23144498 TGGGAGAGACAGGCTCAGGTAGG - Intronic
1156448283 18:37252845-37252867 ATGGAGGAACATGGGCAGGGAGG + Intronic
1156450094 18:37262015-37262037 AGGGAGAGACAGGCGCAAGGTGG - Intronic
1156470297 18:37373608-37373630 ATTAAGAAACTGGCACAGGGAGG + Intronic
1157130318 18:45001243-45001265 ATGGGGAAACAGGCTTTGAGTGG - Intronic
1157580008 18:48768494-48768516 ATGGGGAAAGTGGCTCAGTGAGG + Intronic
1157655262 18:49380746-49380768 ATGAAGAGACAGGCTCAGAAAGG + Intronic
1157750121 18:50170995-50171017 AAGGAGAGAGAGCCTCAGGGAGG - Intronic
1157790298 18:50525182-50525204 GTGAGGAAAGAGGCTCAGGGTGG + Intergenic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1159015897 18:63101494-63101516 GTGCAGACACAGGCTCTGGGAGG + Intergenic
1159967751 18:74612506-74612528 ATGGAGAGACAGGTTCTTGGAGG + Intronic
1160162476 18:76484168-76484190 ATGGAGAAAAAGGCTAAGCTGGG + Intronic
1160432318 18:78820115-78820137 ATGGAGAAACAGGGGGAGAGAGG + Intergenic
1160513494 18:79465799-79465821 ATGCCGAGACAGGCTCCGGGTGG + Intronic
1161398240 19:4056069-4056091 CTGGGGAAACAGGCTGGGGGAGG - Intronic
1161872173 19:6878536-6878558 AAGGAGCCACAGGCTCAGGTTGG - Intergenic
1161992084 19:7689949-7689971 ATAGAGGAAGGGGCTCAGGGAGG - Intronic
1162444816 19:10716343-10716365 ATGGAGAAAGAGGAGGAGGGTGG - Intergenic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1162809826 19:13157077-13157099 TTGGGGAAACAGGCCCAGAGAGG - Intergenic
1162892658 19:13745146-13745168 ATGGTGAGACAGGCCCAGAGAGG - Intronic
1162973609 19:14195757-14195779 ATGGGGAAATAGGTTCAGAGAGG - Intronic
1163270290 19:16248856-16248878 ACAGAGAAACAGGCCCAGAGAGG - Intergenic
1163288795 19:16365214-16365236 ATTAAGAAACAGGCTGAGGGGGG - Intronic
1163398704 19:17078852-17078874 ATACAGAAACAGGCCCAGGCAGG + Intronic
1165060351 19:33202100-33202122 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1165112036 19:33508087-33508109 AAGGAGAAACAGCTTCAGGGAGG - Intronic
1166288945 19:41849434-41849456 ATAGAAAAACAGGCTCAGAGAGG - Intronic
1166351738 19:42202050-42202072 ATGGGGAAACAGGCTCAGAGAGG - Intronic
1166443069 19:42833167-42833189 ATGAGGAAAGAGGCTGAGGGAGG + Intronic
1166468899 19:43060384-43060406 ATGAGGAAAGAGGCTGAGGGAGG + Intronic
1166540866 19:43604820-43604842 ATGGAGAAAAAGGAACAGGGTGG - Intronic
1166738369 19:45099455-45099477 GAGGAGACTCAGGCTCAGGGAGG - Intronic
1166763675 19:45239857-45239879 GTGGAGAAACAGGCTGAGAGGGG + Intronic
1167247296 19:48381330-48381352 ATGAGGAAACAGGTTCAGAGGGG - Intergenic
1167621963 19:50565753-50565775 AGGGAGCCACAGACTCAGGGAGG - Intronic
1167679725 19:50911949-50911971 TTGGAAAAACAGGCTCACAGGGG - Intergenic
1168132474 19:54330347-54330369 AAGTTGCAACAGGCTCAGGGGGG + Intergenic
1168193328 19:54755845-54755867 GTGGAGATACAGGCCTAGGGTGG + Intronic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
1168280604 19:55303568-55303590 ATGGGGAAACAGGCCTAGAGTGG - Intronic
1168289556 19:55350924-55350946 AGGGAGACACGGGGTCAGGGTGG - Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
1168468885 19:56625183-56625205 ATGGGGAAACAGGCTCGCAGAGG + Exonic
925502119 2:4516628-4516650 AGGGAGGAACAAGCTCATGGAGG - Intergenic
925673597 2:6337365-6337387 ATGGAGAAACAAGCAGAAGGTGG + Intergenic
925881915 2:8359871-8359893 CTGGAGAATCAGGCACAGGATGG + Intergenic
926088505 2:10035159-10035181 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
926110662 2:10181224-10181246 ATGAGGAAACAGGCTTAGAGTGG + Intronic
926136535 2:10340566-10340588 ATGGGGATGCAGGCTCAGAGGGG + Intronic
926210727 2:10867703-10867725 AAGAGGAAACAGGCTCAGAGAGG - Intergenic
926317172 2:11718892-11718914 ATGGAAAAACAAGCAAAGGGTGG + Intronic
926758225 2:16252919-16252941 GTGGGGAAACAGGCTGAGAGAGG + Intergenic
927189527 2:20507867-20507889 ATGGAGAAATGGGTTCAGAGAGG + Intergenic
927272893 2:21232356-21232378 ATGAAGAGAGGGGCTCAGGGAGG + Intergenic
927754845 2:25700332-25700354 GTGGTGAAACAGGCTCACTGCGG + Intergenic
928157189 2:28887633-28887655 ATGGAGGGACAGGGTCAGGGAGG - Intergenic
928186148 2:29113135-29113157 ATGAAGAAGCAGACTCTGGGAGG - Intronic
928309478 2:30197625-30197647 CTGGAGAAACTGGCTCAGGCAGG + Intergenic
929046770 2:37798192-37798214 GTGGAGAAACAGGCACAGACAGG - Intergenic
929046844 2:37798645-37798667 ATGGGGAAAAAGGCAGAGGGTGG - Intergenic
929429392 2:41874307-41874329 ATGAAGAAACAAACTCAGAGAGG + Intergenic
929804569 2:45133274-45133296 ATAGATCAAGAGGCTCAGGGAGG - Intergenic
929870166 2:45752549-45752571 ATGAGGAAACAGGCTCAGAGAGG - Intronic
929922590 2:46183009-46183031 ATGAGGAAACTGGCTCAGAGAGG - Intronic
929943034 2:46349275-46349297 ATGGACAGCCAGGCTCAGGAGGG - Intronic
930414302 2:51070557-51070579 ATGGAGAAACAAGTACAGAGAGG + Intergenic
930755826 2:54970996-54971018 AAGGGGAAAAAGGCTCAGGAAGG + Exonic
931144466 2:59502061-59502083 GTAAAGAAACAGGCTCAGAGAGG - Intergenic
931474023 2:62570194-62570216 ATGAAGAAACTGGCTCTGAGGGG - Intergenic
931752394 2:65341352-65341374 ATGGAGAAACATGATGGGGGAGG + Intronic
931789814 2:65654745-65654767 TTGGAGAATCAGGCACAGGCTGG - Intergenic
931849998 2:66243489-66243511 TTGGAGAACCAGGCTCTGAGAGG - Intergenic
931850941 2:66249857-66249879 TTGGAGAACCAGGCTCTGAGAGG - Intergenic
932443416 2:71754034-71754056 ATGGTGAAACAGCCTCAAGCAGG + Intergenic
933227968 2:79772819-79772841 ATGGACAAACATGCTTTGGGAGG - Intronic
933588975 2:84210668-84210690 ATGAAGAAACAGGCACAGAGAGG - Intergenic
933677187 2:85067211-85067233 AGGCAGAAGCAAGCTCAGGGAGG - Intergenic
933866405 2:86522223-86522245 ATGCAGCAACAGGCTAGGGGTGG + Intronic
935165762 2:100567463-100567485 GAGGAGAAGCAGGCTCAGAGAGG + Intronic
936154875 2:110041013-110041035 ATGGAGAAAGTAGCTCAGAGAGG - Intergenic
936189807 2:110330401-110330423 ATGGAGAAAGTAGCTCAGAGAGG + Intergenic
936568622 2:113598139-113598161 ATGGGGAAACTGGCCCAGAGAGG - Intergenic
936618383 2:114071349-114071371 ATGGAGAGAGAGCCTCAGTGTGG - Intergenic
937642698 2:124231362-124231384 ATGGAGAAACAGAGTCAGAGAGG + Intronic
937648810 2:124297325-124297347 TGAGAGAGACAGGCTCAGGGAGG - Intronic
938371070 2:130768612-130768634 AGGGAAAAACAGGCTGAGGGTGG - Intergenic
938943176 2:136187130-136187152 ATGGAGCAACTGGCTCAAGTAGG + Intergenic
941645817 2:168039970-168039992 AGGGATAGAGAGGCTCAGGGAGG - Intronic
942298472 2:174539432-174539454 ATTTAGAGAAAGGCTCAGGGAGG + Intergenic
942894208 2:181032014-181032036 ATGGAAAACCAGCTTCAGGGAGG + Intronic
943088164 2:183340592-183340614 ATGGAGAAGAAGGTTCAGGAGGG - Intergenic
944175471 2:196823860-196823882 ATGAAGACACAGACTCAGAGAGG + Intergenic
944669235 2:201981457-201981479 ATGAAGAAACAGGCACACTGAGG + Intergenic
945151495 2:206796618-206796640 CTAGAGAAACCTGCTCAGGGTGG - Intergenic
945160298 2:206883607-206883629 AGGGGAAAACAGGCACAGGGAGG + Intergenic
945178120 2:207064262-207064284 CTGAAGAAACTGGCCCAGGGAGG + Intergenic
945670208 2:212793341-212793363 ATGTAGAAACAGGCTAGAGGTGG + Intergenic
945906493 2:215599625-215599647 GTGAAGAAACAGGTTCAGTGGGG - Intergenic
946166457 2:217867052-217867074 ATGAAGAAACAAGCACAGAGAGG - Intronic
946367249 2:219256078-219256100 AAGGAAAAAGAGGTTCAGGGAGG - Intronic
946389435 2:219406583-219406605 GTGAGGAAACAGGCTCAGAGAGG + Intergenic
946928116 2:224645667-224645689 CTGGAGTGACAGGCTCAGGTGGG + Intergenic
947277806 2:228413815-228413837 ATGAGAACACAGGCTCAGGGTGG - Intergenic
947611846 2:231529753-231529775 ATAGGGAAACAGCCTCAGAGAGG - Intronic
947768409 2:232652035-232652057 ATGGAGAAACAGGCCCACCAAGG - Intronic
947772489 2:232681809-232681831 ATGGAGATGCTGGCTCAGGGAGG - Exonic
947835739 2:233173971-233173993 AGGCTGAAACAGGCTCAGGATGG + Intronic
948011748 2:234654256-234654278 GAGGAGAAAAAGGCTGAGGGAGG + Intergenic
948735456 2:240001500-240001522 AAGGAGACAGAGGCTCAGAGAGG + Intronic
948910884 2:241002123-241002145 GGGGAGACAGAGGCTCAGGGAGG - Intronic
948988514 2:241540352-241540374 GAGGAGAAACAGGCCCAGCGAGG - Intergenic
1168811403 20:706874-706896 ATGAGGAAACAGGCCCAGAGAGG - Intergenic
1168957085 20:1841777-1841799 AGGGACAAAGGGGCTCAGGGAGG - Intergenic
1168960937 20:1869210-1869232 ATAAGGAAACAGGCTCAGAGAGG - Intergenic
1169016924 20:2299612-2299634 AAGGAAAATCAGGCTGAGGGAGG - Intronic
1169369720 20:5019459-5019481 AGGGAGACTGAGGCTCAGGGAGG + Intergenic
1169733794 20:8814859-8814881 ATGTAGAAAGAGGCCCAGAGAGG + Intronic
1169937889 20:10904446-10904468 TTAGAGAACCAGGCTCAGAGAGG + Intergenic
1170090216 20:12582492-12582514 ATCAAGAAACAGCCTCGGGGAGG + Intergenic
1170341932 20:15338668-15338690 ATGAAGAAACAGGCCTAGGGGGG + Intronic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1171467588 20:25341534-25341556 AAGGAGAACAAGGCTCAGAGAGG - Intronic
1172024062 20:31935983-31936005 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1172025000 20:31942590-31942612 AAGGGAAAACAGGCTCAGAGAGG - Intronic
1172175788 20:32971073-32971095 AGGGAGACAGAGGTTCAGGGAGG - Intergenic
1172273824 20:33669204-33669226 ATGAGGAAACAGGCCCAGAGAGG + Intronic
1172275977 20:33679631-33679653 CTGGGGAAACGGGCTCAGAGAGG - Intronic
1172450581 20:35019958-35019980 GTGGAGGAGCAGGCTTAGGGAGG - Intronic
1172610701 20:36249725-36249747 ATGAGGAAGCAGGCTCAGGAAGG + Intronic
1172758412 20:37304725-37304747 GTGAAGGAACAGGCTTAGGGTGG + Intronic
1172848945 20:37946885-37946907 TTGAGGAAACAGGCTCAGAGAGG + Intergenic
1172902900 20:38347763-38347785 CGGGACATACAGGCTCAGGGAGG + Intronic
1172965873 20:38834371-38834393 GTGGAGGAACAGGCTTAGAGAGG + Intronic
1173384890 20:42578125-42578147 ATGGGAAAACAGGCCCAGAGTGG + Intronic
1173613861 20:44390215-44390237 ATGGAGAAACACGCTCAGAAAGG + Intronic
1173671186 20:44800006-44800028 ATGAGGAAACAGGCTCAGGGAGG + Intronic
1173846449 20:46191631-46191653 ATGAGGAAACGGGCTCAGAGGGG + Intronic
1173868087 20:46325529-46325551 ATGAAGAAACATGCTCAGAGAGG - Intergenic
1173934779 20:46851840-46851862 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
1173943281 20:46930375-46930397 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1174053454 20:47783040-47783062 ATGAGGAAACAGGCACAGAGAGG - Intronic
1174057614 20:47809549-47809571 CTGGGGAAACAGGCTCAGGGAGG + Intergenic
1174061240 20:47834413-47834435 ATGGAGCTGCAGACTCAGGGAGG - Intergenic
1174070536 20:47896286-47896308 ATGGAGCTGCAGACTCAGGGAGG + Intergenic
1174153634 20:48503079-48503101 ATGGAGGTACAGACCCAGGGAGG - Intergenic
1174260661 20:49292561-49292583 ATAGCAAAACAGGCTCAGGGAGG + Intergenic
1174406091 20:50304374-50304396 CAGATGAAACAGGCTCAGGGAGG - Intergenic
1174514683 20:51082810-51082832 AAGGACAAACAGGCACAGGTGGG + Intergenic
1174519768 20:51120445-51120467 ATGAGGAAACAGGCACAGAGTGG + Intergenic
1174837113 20:53866985-53867007 AAAGAGAACCAGGCTAAGGGTGG + Intergenic
1175277975 20:57784805-57784827 ATGGAGACAGAGGCTCTGTGGGG - Intergenic
1175401167 20:58700886-58700908 AGGGAGCACCAGGCTCAGGCAGG + Intronic
1175760059 20:61556348-61556370 ATGGAGAGAGAGGCTCCGGGGGG + Intronic
1175915773 20:62425057-62425079 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1175939450 20:62531324-62531346 AGGGAGGGGCAGGCTCAGGGAGG - Intergenic
1177196307 21:17907102-17907124 ATGAAAAAGCAGGCTCAGAGTGG + Intronic
1178442719 21:32612031-32612053 ATGGAGAAAGAGGGGCAGGGTGG - Intronic
1178582964 21:33851277-33851299 ATGGAGACCCAGCCTCAGGAGGG + Intronic
1178821227 21:35977064-35977086 ATGGGGAAGCAGGCTTGGGGAGG - Intronic
1179921053 21:44507834-44507856 CAGGAGAAACAGGCACGGGGCGG - Intronic
1180635560 22:17260501-17260523 ATGAGAAGACAGGCTCAGGGAGG - Intergenic
1181456662 22:23063799-23063821 AAGGGGAAGCAGGCCCAGGGTGG + Intronic
1181527640 22:23499271-23499293 GTGGGAAAACAGGCTCAGAGGGG + Intergenic
1181560351 22:23696420-23696442 AAGAGGAAACAGTCTCAGGGAGG + Intronic
1181631731 22:24155259-24155281 GATGAGAAACAGGCTCAGGAGGG - Intronic
1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG + Intergenic
1181919966 22:26312897-26312919 CAGGAGACCCAGGCTCAGGGTGG - Intronic
1181937282 22:26447997-26448019 ATGAGGAAACAGGCTCAGAGCGG + Intronic
1181958060 22:26602631-26602653 AGGGACAAAAAGGCTCAGAGAGG + Intronic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182438145 22:30344499-30344521 AAGCAGAAACAGGCTCAGAAAGG - Intronic
1182448264 22:30402491-30402513 ATGAGAAAACAGGCTCAGAGAGG + Intronic
1182540420 22:31037540-31037562 CAGGGGAAACAGGCTCAGAGAGG - Intergenic
1182554271 22:31120520-31120542 ATGCTGAAACAGGCTGAGGGTGG - Intergenic
1182747251 22:32615475-32615497 ATGGAGAAATGGAGTCAGGGAGG + Intronic
1183032476 22:35116426-35116448 GTGTGGAAACAGGCTCAGAGAGG + Intergenic
1183040604 22:35175007-35175029 ATGTGGAATCTGGCTCAGGGTGG - Intergenic
1183101558 22:35587384-35587406 ATGGAGAAATAGGAACAGTGAGG + Intergenic
1183313480 22:37124386-37124408 ATTAGGAAACAGGCCCAGGGAGG - Intergenic
1183321628 22:37168521-37168543 ATGCAGAAACAGGCTCAGAGAGG - Intronic
1183360423 22:37380324-37380346 GGGGAGAAACAGGCTCGGAGAGG - Intronic
1183370567 22:37429406-37429428 AGGAGGAAACAGGCTCAGAGAGG - Intergenic
1183650200 22:39149257-39149279 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1184033250 22:41906900-41906922 TGGGAGAAACAGTCTCCGGGAGG - Exonic
1184088390 22:42279693-42279715 ATGAGCAAACAGGCTCAGGGAGG + Intronic
1184299706 22:43550213-43550235 AGGGAGACACAAGCTCAGAGAGG + Intronic
1184372694 22:44092713-44092735 ATGGAGAAATAGGTGCAGAGAGG + Intronic
1184410612 22:44323982-44324004 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1184444117 22:44537259-44537281 ATGAGGAAACAGGCTCAGAGGGG + Intergenic
1184517546 22:44971929-44971951 ATAAGAAAACAGGCTCAGGGAGG + Intronic
1184569838 22:45315602-45315624 ATGGAGAAACAGGTTTAGAGAGG + Intronic
1184574703 22:45353736-45353758 ATGAAGAAACAGACCCAGAGAGG + Intronic
1184654912 22:45936205-45936227 ATGGGAACACAGGCTCAGAGAGG - Intronic
1184677459 22:46051513-46051535 CTGTAGCAACAGGCTCAGAGAGG + Exonic
1184691169 22:46117986-46118008 GTGGAGACAGAGGCTCAGAGAGG + Intergenic
1185073490 22:48669907-48669929 ATGGAGAAGCCAGCTCAGGCGGG - Intronic
1185089289 22:48756876-48756898 GTGGAGACAAAGGCTCAGAGGGG + Intronic
1185153701 22:49180605-49180627 GTGGGGAAACAGGAGCAGGGAGG - Intergenic
950002534 3:9668313-9668335 AAAGAAAAACAGGCTAAGGGAGG - Intronic
950103150 3:10370540-10370562 CTGGAGCAGCAGGCTAAGGGAGG - Intronic
950185650 3:10943829-10943851 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
950347099 3:12306424-12306446 ATGAAGAAACAGGAACAGAGAGG + Intronic
950452926 3:13075456-13075478 AGGCGGAAACAGGCTCAGAGTGG + Intergenic
950454565 3:13084946-13084968 AAGAAGAAACAGCCTCGGGGTGG + Intergenic
950458591 3:13107481-13107503 ATGGAGAAACAGGCTCAGAGCGG + Intergenic
950665042 3:14490214-14490236 ATGAGGAAACAGGCACAGAGAGG - Exonic
950716254 3:14849751-14849773 ATGGAGAAACAGGTGCACAGAGG - Intronic
950970555 3:17182906-17182928 ATGGAGAACAAGGCAAAGGGAGG - Intronic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
951845961 3:27084840-27084862 ATGAGAAAACAGGCTCAGAGAGG - Intergenic
952094928 3:29939494-29939516 ATGGACATACAGACCCAGGGTGG + Intronic
952140494 3:30473567-30473589 ATGAGGAAACAGGCTAAGGGAGG - Intergenic
952521619 3:34164920-34164942 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
952528777 3:34241878-34241900 ATGAAGAAACATGATCAGAGAGG - Intergenic
952852003 3:37737243-37737265 GAGGAGAGACAGGCCCAGGGGGG + Intronic
953563961 3:44015242-44015264 ATTAAGAAACTGGCTCAGAGAGG + Intergenic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
953862986 3:46561236-46561258 ATGGTGAAAAAGGGGCAGGGTGG + Intronic
953886989 3:46719706-46719728 AGGGAGAAGCAGCCTCTGGGAGG + Exonic
953957646 3:47244145-47244167 ATGCAGAAACAGGCACAGAGCGG + Intronic
953961948 3:47273312-47273334 ATGAGGAAACAGGCTCAGTGTGG + Intronic
954081547 3:48215119-48215141 GTGGAGATCAAGGCTCAGGGTGG + Intergenic
954556565 3:51521870-51521892 ATGAAGAACCTAGCTCAGGGAGG + Intergenic
954792351 3:53142776-53142798 ATGGGGAAACAGGCTCTGCAGGG - Intergenic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
955084364 3:55688346-55688368 ATGGAAAGGAAGGCTCAGGGAGG + Intronic
955393512 3:58537861-58537883 GTAAGGAAACAGGCTCAGGGAGG + Intergenic
955614022 3:60786508-60786530 ATGAAGTAACAGACTCAGGTAGG - Intronic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956687061 3:71839892-71839914 ATAGAGAAACAGGCTTAGAGAGG + Intergenic
956743786 3:72295469-72295491 GTGAGGAAACAGGCTCAGAGAGG - Intergenic
958627679 3:96646763-96646785 ATGGAGGAAGAGGCACAGGCGGG - Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959510191 3:107202110-107202132 ATGATGAAACAGGAGCAGGGAGG + Intergenic
959751002 3:109834962-109834984 ATGAAGAAACAGGCTTAGAGAGG + Intergenic
960038864 3:113129038-113129060 ATGGAGAAAAGGGCACAGGGAGG + Intergenic
960108650 3:113824131-113824153 ATAGAAAAACAGGCTTAGGCTGG - Intergenic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
960701288 3:120441854-120441876 ATGGGGAAACAGGCTCAGAGAGG + Intronic
960715236 3:120568681-120568703 AGGAAGAAACAGGCTGGGGGAGG + Intergenic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
961328765 3:126126904-126126926 ATGGAGAGACAGACTCACAGTGG + Intronic
961359571 3:126358333-126358355 ATGAAGAAACCGACTCAGAGAGG + Intergenic
961410259 3:126715289-126715311 ATGAAGAAACTGAGTCAGGGAGG - Intronic
961457131 3:127029803-127029825 ATGGGGAAACAGGCTCGGGCGGG + Intronic
961653740 3:128430131-128430153 AAGGGGAAACTGGCTCAGAGAGG + Intergenic
961673955 3:128553773-128553795 AGGGAGGAACAGGCTCACAGAGG + Intergenic
961827020 3:129604443-129604465 ATGAAGAAACAGGCACAGAGAGG - Intronic
961983873 3:131111648-131111670 ATGAGGAAACAGGTTCAGAGAGG - Intronic
962479203 3:135783956-135783978 ATGAGGAAACAGGCACAGGGAGG - Intergenic
962970490 3:140396579-140396601 ATGAGGAAACAGGCACAGAGAGG + Intronic
963025592 3:140915959-140915981 ATGAAGGAACAAGCTCAGAGAGG + Intergenic
963077255 3:141358717-141358739 ATGGAGATAGGGGCTTAGGGAGG - Intronic
963345924 3:144096732-144096754 AAGGAGAGAGAGACTCAGGGTGG - Intergenic
963918206 3:150880153-150880175 GTGAGGAAACAGGCTCAGAGAGG + Intronic
964672881 3:159246455-159246477 GAGGAAAAACAGGCTCAGCGAGG + Intronic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
964961718 3:162436190-162436212 TTGGAGAAACAGGGCCAGGAAGG + Intergenic
966368936 3:179225377-179225399 ATGGAGGAAAAGGCTATGGGGGG + Intronic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
966660998 3:182414807-182414829 ATGGAGAAACAGACCCAGTTTGG + Intergenic
966945989 3:184777424-184777446 ATGAGGAAACAGGCCCAGGGAGG + Intergenic
967789073 3:193527827-193527849 ATGGACAAACAGGCCCAGACAGG - Intronic
967980773 3:195063896-195063918 ATGAAGAAACAGGCCCAGAGAGG + Intergenic
968097609 3:195942681-195942703 ATGCAGCAGAAGGCTCAGGGAGG - Intergenic
968729065 4:2261341-2261363 CTGGGGAAACAGGCTCAGCCAGG - Intronic
968729482 4:2262822-2262844 GTGGGGAAACAGGCCCAGAGCGG + Intergenic
969038587 4:4276080-4276102 CTTGAGAAAGGGGCTCAGGGAGG - Intronic
969176400 4:5402307-5402329 ATGGAGCCACAGGCACAGGCCGG + Intronic
969296694 4:6274448-6274470 ATGGGGAAACAGACACAGTGAGG + Intronic
969377107 4:6770131-6770153 ATGAGGTAACAGGCTCAGAGGGG + Intergenic
969438241 4:7200740-7200762 ATGAGGAAAAAGGCTCAGAGAGG - Intronic
969605230 4:8199171-8199193 ACGGAGAGGCAGGCCCAGGGCGG - Intronic
969906800 4:10404732-10404754 ATGAGGAAACAGGCACAGAGAGG + Intergenic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
970419015 4:15887565-15887587 ATGGGAAAACAGGCTCTGAGTGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972243611 4:37221238-37221260 GTGAAGAAATAGGCTCAGAGAGG - Intergenic
972335809 4:38106547-38106569 AGTGAGAAATAGGTTCAGGGTGG + Intronic
972495828 4:39633573-39633595 CTGTAGAGACAGGCTCAGGTTGG - Intronic
972594162 4:40515699-40515721 ATGAGGAGACGGGCTCAGGGAGG - Intronic
973646188 4:52953475-52953497 ATAAAGAAACAAGCTCAGGGAGG + Intronic
973876299 4:55223093-55223115 ATGAGGAAACAGGTTCAGAGAGG - Intergenic
973972293 4:56225496-56225518 AAGAAGAAACGGGTTCAGGGAGG - Intronic
973977631 4:56279108-56279130 ATGGGGAAACAGGCTCAAAGAGG + Intronic
976527211 4:86107571-86107593 AAGGAGAAACAGGAGAAGGGGGG + Intronic
978323209 4:107521269-107521291 ATAAGGAAACAGTCTCAGGGAGG - Intergenic
978490164 4:109303157-109303179 ATGGAGAAATGGCCTCCGGGAGG + Intergenic
978884459 4:113750443-113750465 ATGCAGAAACAGGCTTGGGGAGG - Intronic
982364551 4:154560938-154560960 ATGGTGAAACAGGTTCAGAGAGG - Intergenic
982676562 4:158382732-158382754 ATGGAGAAACAAGGTAAGGCAGG + Intronic
984103548 4:175516267-175516289 TTGAAGAAACAGGCTTAGGTTGG - Intergenic
984891973 4:184502335-184502357 ATGAGGAAATAGGCTCAGAGTGG - Intergenic
986068167 5:4256203-4256225 ATGGACAAACAGGCCAAGAGTGG - Intergenic
986314437 5:6576963-6576985 ACAGAGAAACAGGGACAGGGAGG + Intergenic
986722873 5:10572499-10572521 ATGAAGTTACAGGTTCAGGGAGG + Intronic
987112212 5:14698954-14698976 ATGAAGAAACAGATTTAGGGAGG - Exonic
987172023 5:15269125-15269147 ATGAAGAAACAGGCTAAGCAGGG + Intergenic
988330366 5:29830303-29830325 ATGGAGAAACAGCCAGATGGTGG + Intergenic
988434107 5:31153537-31153559 CTGGAGAGCCAGGTTCAGGGAGG - Intergenic
988979656 5:36553941-36553963 AAGGAGAGGCAGACTCAGGGTGG + Intergenic
990199651 5:53357132-53357154 ATGGAAAAACAGGCACTGTGAGG - Intergenic
990707568 5:58547102-58547124 ATGTAGAAACAGGCCCGGCGCGG + Intronic
990820266 5:59831579-59831601 ATGGGAAAACAGGCTTAGTGAGG + Intronic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992483796 5:77176609-77176631 GTAGGGAAACAGGCTCAGTGTGG - Intergenic
992510241 5:77425633-77425655 ATGAAGAAATAGGCTCAGCAAGG - Intronic
992884829 5:81148161-81148183 TTGAAGGAACAGGCTCAGTGAGG + Intronic
992947758 5:81826100-81826122 ATGAGGACACAGGCTCAGGAGGG + Intergenic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
993852153 5:93023756-93023778 GAGGAGAAACAGCCTAAGGGAGG + Intergenic
994148753 5:96423821-96423843 ATGGAGAATCAGGATTTGGGGGG - Intronic
994880528 5:105488223-105488245 ATGGAAAAAAATGCTCAGAGTGG - Intergenic
995798463 5:115965048-115965070 ATGAGGAAACAGACTCAGAGAGG - Intronic
996681152 5:126229098-126229120 GTGGAGGAACAGGCACAGGCAGG + Intergenic
997233624 5:132260053-132260075 ATGGAGACCCAGGCACAGAGAGG + Intronic
997235307 5:132269072-132269094 ATAAAGAAACAGGTTCAGAGAGG + Intronic
997639636 5:135440207-135440229 ATGAGGAAACAGGATCAGAGAGG - Intergenic
997712177 5:136015187-136015209 AGGCAGAGACAGGCTCAGGGAGG - Intergenic
997851603 5:137337962-137337984 ATAGAGAAACAGACTCAGGGAGG - Intronic
998131797 5:139655192-139655214 ATGGAGGGACAGGCTGAGGGTGG - Intronic
998147740 5:139739843-139739865 ATGAAGAAACAGGTCCTGGGAGG + Intergenic
998152756 5:139766398-139766420 ACTGAGAAACAGGCCCAGGCAGG - Intergenic
998229929 5:140354589-140354611 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
998296251 5:140971871-140971893 ATGAGGAAATAAGCTCAGGGAGG + Intronic
998368053 5:141643938-141643960 GTGAAGAAACAAGCTCAGAGAGG + Intronic
998532559 5:142899452-142899474 ATAGAGAAGGAGGCACAGGGAGG + Intronic
998742586 5:145221780-145221802 ATGGAGAAACAAGCACAGAGAGG - Intergenic
998892963 5:146766640-146766662 ATGAGAAAACAGGCTCAGAGAGG + Intronic
999139963 5:149353900-149353922 ATAAAGAAACAGGCTCAGAAGGG - Exonic
999175829 5:149631035-149631057 GTGGTAAAACAGGCTCAGAGAGG + Intronic
999272711 5:150306851-150306873 CTGCAGACACAGGCTCAGTGAGG + Intronic
999665024 5:153904039-153904061 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
999805480 5:155077225-155077247 ATGAGAAAACAGGCTCAGGGAGG + Intergenic
1000380199 5:160622213-160622235 ATGAGGAAACAGACCCAGGGAGG + Intronic
1000383350 5:160648712-160648734 ATGTGGAAACAGGCTCAGAGAGG + Intronic
1001256407 5:170186811-170186833 ATGGAGAGATGGGCTCAGCGGGG - Intergenic
1001553855 5:172623069-172623091 ATTAAGAAACAGGCTCAGAGAGG - Intergenic
1001741022 5:174052725-174052747 GTGCAGAAACAGGCTCAGACAGG + Intronic
1001878964 5:175226268-175226290 AAAGGCAAACAGGCTCAGGGAGG - Intergenic
1002033996 5:176451581-176451603 ATGAAGAAACAGGTTCTGAGAGG + Intronic
1002139179 5:177128382-177128404 ATGGAGACACAGGCTTGGAGAGG + Intergenic
1002569818 5:180133975-180133997 ATAGGGAAACTGGCTCAGAGAGG + Intronic
1002665321 5:180819163-180819185 GTGGGGAAACAGGCACAGAGAGG - Intergenic
1002878454 6:1231710-1231732 GTGCAGTGACAGGCTCAGGGAGG - Intergenic
1003248326 6:4402671-4402693 ATGGGAAATCAAGCTCAGGGAGG - Intergenic
1004278056 6:14255506-14255528 ATGAAGAAACGGGCCCAGAGAGG - Intergenic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1004735895 6:18406211-18406233 ATGGAAAAATAGGGTGAGGGGGG + Intronic
1006155739 6:32011944-32011966 ATAGAGAAACGGGGGCAGGGAGG - Intergenic
1006162070 6:32044798-32044820 ATAGAGAAACGGGGGCAGGGAGG - Intronic
1006194111 6:32227443-32227465 AAGGAGAAACAAGCTCTTGGGGG - Intergenic
1006379573 6:33689639-33689661 TTGGAGCAACAGGGTCAGGGTGG + Intronic
1006428651 6:33981942-33981964 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1006504382 6:34478659-34478681 ATGGATAAATAGGCTGAGTGTGG - Intronic
1006520772 6:34569878-34569900 ATGAGGAAACAGGCCCAGAGAGG + Intergenic
1006538810 6:34722581-34722603 ATGGAGACACAGACTCAAAGAGG + Intergenic
1006671216 6:35730960-35730982 ACGAAGAAACTGGCTCAGAGAGG - Intergenic
1006811632 6:36824028-36824050 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1006945783 6:37783700-37783722 ATGGAGAGACAGGGGCAGGGAGG - Intergenic
1007110780 6:39312533-39312555 GTGAAGAAACAGGCTCAGAGAGG - Intronic
1007227182 6:40323169-40323191 AGGAAGAAGCAGGATCAGGGTGG + Intergenic
1007428679 6:41763778-41763800 ATGAGGAAACAGGTTCAGAGAGG + Intergenic
1007431298 6:41779035-41779057 AGGAAGAAGCAGGCTCAGGGAGG + Intronic
1007576545 6:42928885-42928907 AAATAGAAACAGGCTCAGAGAGG + Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007694729 6:43724998-43725020 GTGGGGAAACAGGCTCAGAGAGG + Intergenic
1007720835 6:43884654-43884676 ATGGAGAGCCAGCCTCGGGGTGG + Intergenic
1007749567 6:44063661-44063683 CTGGGGAAACAGGCACAGAGAGG + Intergenic
1008476312 6:51939160-51939182 ATGGAGAGAAGGGGTCAGGGGGG - Intronic
1008725201 6:54409069-54409091 ATGAAGAAACAGGCTCAACATGG + Intergenic
1008900627 6:56611264-56611286 ATAAGGAAACAGGCTCAGAGAGG - Intronic
1010085836 6:71917078-71917100 ATAGAGAAACAAGCACAGAGAGG - Intronic
1010294258 6:74177681-74177703 ATGGGGAAACAGACTTAGGGAGG - Intergenic
1010388340 6:75308397-75308419 ATGAGGAAACAGGCTCAGATGGG + Exonic
1010509200 6:76697046-76697068 ATGCAGAAATAGGGTCAGGGAGG + Intergenic
1012181065 6:96153307-96153329 ATGAAGCAGCTGGCTCAGGGAGG - Intronic
1012413784 6:98990066-98990088 ATGAATAGACAGGCTTAGGGAGG - Intergenic
1012627289 6:101419671-101419693 AGGAAGAAACAGGCTGAGAGAGG + Intronic
1012840636 6:104324994-104325016 ATGTAGAAACAGCCTCTGGATGG - Intergenic
1012919151 6:105203398-105203420 ATGGAGAAACAGGCTTAGAGTGG - Intergenic
1012953848 6:105547428-105547450 ATGGGAAAACAGGCCCAGAGAGG - Intergenic
1012956837 6:105580057-105580079 ATGGAGAAACATGGGGAGGGGGG - Intergenic
1013425620 6:110009995-110010017 AGGAAGAAATAGGCTCAGAGAGG + Intergenic
1013609399 6:111779939-111779961 AAGAAGAAACAGGCTCAGAGAGG + Intronic
1013648831 6:112172815-112172837 ATGGAGATAAAGGCTCAGTGTGG + Intronic
1015073199 6:129122825-129122847 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1015169600 6:130237677-130237699 AAGGAGAGTGAGGCTCAGGGAGG + Intronic
1015411211 6:132895760-132895782 AAGGAGAAACAGGCTGGGTGCGG + Intergenic
1015879590 6:137857757-137857779 ATGAAGAAACGGCCTCAGTGAGG - Intergenic
1016761433 6:147741720-147741742 ATGGAAAAACAGGTTGAGTGTGG + Intergenic
1019509159 7:1408645-1408667 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1020204219 7:6103093-6103115 AGGGAGAAGCAGGCTCATGGTGG + Intergenic
1020808906 7:12827320-12827342 ATAGGAAAACAGACTCAGGGAGG + Intergenic
1020978468 7:15038004-15038026 ATGGATTAAAAGGCTCAGGAAGG - Intergenic
1021445616 7:20730720-20730742 AAGGAAAAACTGGCTCACGGGGG - Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021601372 7:22367302-22367324 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1021800443 7:24300186-24300208 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1022530886 7:31066199-31066221 ATGGAGGATCAGGCTGAGGTGGG + Intronic
1023132623 7:37017987-37018009 ATGAGGAAACAGGTTCAGGGGGG - Intronic
1023186096 7:37534695-37534717 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1023496961 7:40808128-40808150 ATTGACAAACAGGGTAAGGGTGG - Intronic
1023769084 7:43538248-43538270 AGGGAGAAACTGGATGAGGGAGG + Intronic
1025610610 7:63072982-63073004 ATGAAAAAATAGTCTCAGGGAGG - Intergenic
1025753494 7:64313030-64313052 GTTGAGAAACAGTCTCAGGGAGG - Intronic
1025834932 7:65085561-65085583 ATGGGGAAACGGGCTCAGAGAGG - Intergenic
1026836933 7:73645852-73645874 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
1026990526 7:74582617-74582639 ATGTGGAAACAGGCTCAGAGAGG + Intronic
1027758097 7:82241633-82241655 ATGGAGAAAGAAGCAGAGGGGGG + Intronic
1028092077 7:86715398-86715420 AAGGAAACAGAGGCTCAGGGAGG - Intronic
1028912076 7:96219526-96219548 ATGAGGAAACAGGCCCAGAGGGG - Intronic
1029115003 7:98232223-98232245 ATGGGGAGACAGGCTCGGGAGGG + Intronic
1029843202 7:103387588-103387610 ATGCAGAAACAGGCTCTGAGAGG + Intronic
1030078896 7:105760359-105760381 ATGAGGAAACAGGCTCTGAGAGG + Intronic
1030151386 7:106409134-106409156 ATGGAAAAACAGGCTGGGTGTGG + Intergenic
1030296532 7:107934467-107934489 AGGAAGAAACAGGCTCAGTTAGG + Intronic
1030324282 7:108203543-108203565 AAGGAGAAGCTGGTTCAGGGAGG - Intronic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032640016 7:133755778-133755800 ATGGTTTAAGAGGCTCAGGGTGG - Intronic
1033179742 7:139164320-139164342 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1033242655 7:139693167-139693189 ATGAGGAAACAAGCTCAAGGAGG - Intronic
1033280755 7:140004845-140004867 ATCGAGAAACAGCCTCCGGCCGG + Intronic
1034652791 7:152705301-152705323 GATGAGAAACAGGCTCAGAGGGG + Intergenic
1034892986 7:154857089-154857111 ATGCAGAAACAGGCTAGGGCGGG - Intronic
1034896661 7:154880527-154880549 TTGGAGTCACAGGCTCTGGGTGG + Intronic
1035050762 7:155997967-155997989 AAGAGGAACCAGGCTCAGGGAGG - Intergenic
1035064227 7:156093744-156093766 ATGGAGAGGCAGGCTAAGAGGGG + Intergenic
1035206728 7:157298506-157298528 ATTGAGACACAGGGACAGGGAGG + Intergenic
1035632316 8:1117437-1117459 GAGAAGAAACAGGCTCACGGTGG + Intergenic
1035632334 8:1117557-1117579 GAGAAGAAACAGGCTCATGGTGG + Intergenic
1035727599 8:1834409-1834431 CTGGAGACACAGGCCCAGGGAGG + Intronic
1036619653 8:10416077-10416099 CTGGGGAAGCAGGCTCAGGCAGG - Intronic
1036770197 8:11573410-11573432 GTGAGGAAACAGGCTTAGGGAGG - Intergenic
1037318360 8:17620418-17620440 ATGGAGAAAAAGATACAGGGTGG + Intronic
1037623847 8:20590725-20590747 ATGCAGAGTCAGTCTCAGGGTGG - Intergenic
1037918228 8:22785680-22785702 ATGAGGACTCAGGCTCAGGGAGG - Intronic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1038012464 8:23486046-23486068 AGGGAGAAAGAGAGTCAGGGAGG - Intergenic
1038564788 8:28610677-28610699 ATGAAGAAATGGGCTCAGGTTGG + Intronic
1038629698 8:29230151-29230173 AAGGAAACAGAGGCTCAGGGAGG + Intronic
1039440792 8:37594087-37594109 AGGGAGAAAAAGGCAGAGGGAGG + Intergenic
1039911380 8:41829412-41829434 ATGCAGAAAGAGGCTCAGAGAGG + Intronic
1039952550 8:42183297-42183319 AGGGGGAAAAAGGCTCAGGCCGG - Intronic
1040526460 8:48229469-48229491 TTGGAGAAACAGGGCCAGGCAGG - Intergenic
1040593099 8:48814413-48814435 ATTGAGGAACTGTCTCAGGGAGG - Intergenic
1041030062 8:53727817-53727839 ATGGAGGAACAGGATTGGGGTGG - Intronic
1041348208 8:56923304-56923326 ATGCAGACACAAGCCCAGGGAGG + Intergenic
1041794261 8:61729536-61729558 ATGGAGAAACATGCTCAGAGAGG + Intergenic
1042038665 8:64566861-64566883 AAAAAGAAACAGGCTCAGAGAGG + Intergenic
1042121735 8:65495766-65495788 ATGGCAAACCAGGCACAGGGTGG + Intergenic
1042219563 8:66460252-66460274 AGGAAGAAACGGGCTCTGGGTGG - Intronic
1043442641 8:80289833-80289855 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
1043448913 8:80347049-80347071 AAGAAGAAAGAGGCTCAGAGAGG - Intergenic
1044145962 8:88714101-88714123 ATGGGGAGACAGGTTCAGTGGGG + Intergenic
1044803160 8:95977724-95977746 AGGAAGAAACAGGCTCAGAGAGG - Intergenic
1044857701 8:96493670-96493692 CCGGAGAAGCAGGCTCAGGAGGG + Exonic
1044938821 8:97319592-97319614 ATGAAGAAACAGGCCCAGTGAGG - Intergenic
1045051460 8:98330904-98330926 ATGAGGAAACTGGCTCAGAGAGG + Intergenic
1045434795 8:102151540-102151562 ATGAAGATAGAGGCTTAGGGAGG + Intergenic
1045664516 8:104470401-104470423 CTGGACAAACCGGCTCAGTGGGG + Intergenic
1046031525 8:108787962-108787984 ATGTGGAAACAGGCTCAGAGAGG + Intergenic
1046039385 8:108883895-108883917 ATGGAGAAACCCACTCATGGTGG - Intergenic
1046230422 8:111348376-111348398 ATGGAGAAACAAGTTTTGGGAGG + Intergenic
1046275028 8:111947725-111947747 ATGGAGAAACTAGCTGAAGGAGG + Intergenic
1048018478 8:130518356-130518378 ATGAGGAAACTGGCTCAGAGAGG - Intergenic
1048140794 8:131792226-131792248 TTGAGGAAACAGGCTCAGAGAGG + Intergenic
1048297464 8:133225053-133225075 ATAGGGAGACAGGCCCAGGGTGG + Intronic
1048573437 8:135672999-135673021 CTGGAGAATCAGATTCAGGGCGG - Intergenic
1049223770 8:141440065-141440087 ATGAGGAAACAGGCCCAGAGAGG + Intergenic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049402961 8:142438759-142438781 ATGGAGACAGACACTCAGGGAGG - Intergenic
1049414620 8:142489581-142489603 GTGGGGAAACAGGCTCAGAGAGG + Intronic
1049555555 8:143279599-143279621 AGGCAGAAACAGGCTCCGTGAGG - Intergenic
1049883905 9:15386-15408 ATGGGGAAACTGGCCCAGAGAGG + Intergenic
1051145104 9:14018898-14018920 ATAGAGAAGCAAGCTCAGAGTGG - Intergenic
1051189878 9:14500160-14500182 ATGAGGAAACAGGCACAGAGAGG + Intergenic
1051749567 9:20327078-20327100 GTTGAGAAACAGGTTTAGGGAGG + Intergenic
1051901301 9:22044702-22044724 ATGGGGATACAGGCACAGGAAGG - Intergenic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1052820062 9:33131276-33131298 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1052937678 9:34106505-34106527 AGGGAGTAACAGGTACAGGGAGG + Intronic
1053042398 9:34885679-34885701 ATGGAGAAACAGGGCAGGGGTGG - Intergenic
1053153087 9:35755175-35755197 ATGAGGAAACAGGCTCAGAGAGG - Exonic
1053471994 9:38353192-38353214 ATGTGGAAACAGGCTCAGAGGGG - Intergenic
1053578786 9:39381457-39381479 ATGGCAAAATAGGCTCAGTGAGG - Intergenic
1053843305 9:42209534-42209556 ATGGCAAAATAGGCTCAGTGAGG - Intergenic
1054100369 9:60940261-60940283 ATGGCAAAATAGGCTCAGTGAGG - Intergenic
1054121767 9:61215887-61215909 ATGGCAAAATAGGCTCAGTGAGG - Intergenic
1054585976 9:66966624-66966646 ATGGCAAAATAGGCTCAGTGAGG + Intergenic
1054800686 9:69345420-69345442 AAAGAGAAACAGTCTCAGAGAGG - Intronic
1055602243 9:77931763-77931785 ATGAAGAAGCAGGCTTAGAGAGG - Intronic
1055644937 9:78354529-78354551 ATGGAGAGAGAGGCACAGAGAGG - Intergenic
1057187438 9:93064809-93064831 GTGGAGACACAGGCCCAGGGTGG + Intronic
1057479366 9:95432504-95432526 ATGGGGAAACAAGCTCAGGGGGG - Intergenic
1057900970 9:98947959-98947981 ATGGGAAAACAGGCTCAGAGTGG - Intronic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058479786 9:105380154-105380176 ATGGAAAAACAGGCTCAGAATGG + Intronic
1058581129 9:106458883-106458905 GTGAGGAAACAGGCTCAGAGAGG - Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1058816129 9:108684353-108684375 ATGGAGAATGAGACTCAGAGAGG + Intergenic
1058941364 9:109815684-109815706 ATGGAAAAGCAGGTTCAGTGAGG + Intronic
1059104488 9:111500037-111500059 GTGGAGGAACAGTCTCAGGGTGG + Intergenic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059431908 9:114255431-114255453 ATGGGGAGACAGGCCCAGGACGG - Intronic
1059439599 9:114299570-114299592 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1059450918 9:114371002-114371024 ATGGAGGAACAGGGGCTGGGGGG + Intronic
1059672790 9:116507347-116507369 ATGGAGAAACAGGCACAGAAGGG + Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1059939006 9:119339695-119339717 ATGAGGAAACAAGCTCAGAGAGG + Intronic
1060069968 9:120537663-120537685 ATGATGAAACAGGCACAGTGTGG - Intronic
1060276128 9:122184159-122184181 ATGAGGAAACAGGCTCAGTGGGG + Intronic
1060279260 9:122204951-122204973 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1060391549 9:123281766-123281788 ATAGAGAAACAGACTCAGTGGGG + Intergenic
1060431981 9:123558188-123558210 AGGGTAAAACAGCCTCAGGGAGG + Intronic
1060434137 9:123579071-123579093 ATGGAGAAACAAAAACAGGGGGG + Intronic
1060458469 9:123824170-123824192 CAGAAGAAACAGGCTCAGAGAGG + Intronic
1060900977 9:127258012-127258034 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1060920511 9:127417500-127417522 ATGAAGAAACAGGCCGAGAGGGG - Intergenic
1060999211 9:127893392-127893414 ATGGAAAAACAAGCCCAGAGTGG - Intronic
1061047900 9:128177211-128177233 AAGAGGAAACAGGCACAGGGTGG + Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061259045 9:129469592-129469614 GTGGGAAAACAGGCTCAGAGGGG - Intergenic
1061510434 9:131057656-131057678 AAGAGGAAGCAGGCTCAGGGAGG - Intronic
1061517713 9:131099067-131099089 TTGGAGAAGGAGGCTCAGAGAGG - Intronic
1061684759 9:132266227-132266249 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1061820249 9:133223433-133223455 CAGGGTAAACAGGCTCAGGGCGG + Intergenic
1061937620 9:133866992-133867014 TTGAGGAAACAGGCTCAGGGAGG - Intronic
1061989524 9:134151287-134151309 ATGGAGAAGCCGCCTCTGGGAGG - Intronic
1062116322 9:134811127-134811149 ATCCAGAAATGGGCTCAGGGTGG + Intronic
1062240384 9:135534471-135534493 CAGGGTAAACAGGCTCAGGGCGG - Intergenic
1062271508 9:135711972-135711994 ATGAGCATACAGGCTCAGGGAGG + Intronic
1062509786 9:136898495-136898517 ATGGAAACTCAGGCTCAGTGAGG - Intronic
1062710921 9:137974809-137974831 ATGGAGAACAAGGCCCTGGGAGG - Intronic
1186890313 X:13953429-13953451 ATGAGGAAACAGGCTCAAAGGGG - Intergenic
1187441332 X:19323318-19323340 ATGAAGAAACAGGCACATGGGGG - Intergenic
1187862601 X:23696583-23696605 ATGAGGAAACAGGCTTAGAGAGG - Intergenic
1188323192 X:28765944-28765966 ATGCAGAAACACTCTCAGAGGGG - Intronic
1189141905 X:38616003-38616025 ATGCAGAAACAGGCCCAGAGAGG - Intronic
1189618022 X:42804666-42804688 ATGGGGAGACAAGCTAAGGGAGG + Intergenic
1190119467 X:47648802-47648824 ATGAAGAAAAAGGCACAGAGAGG + Intronic
1190255593 X:48760104-48760126 TTTGAAAAACAGGCTGAGGGTGG - Intergenic
1190330439 X:49231932-49231954 ATGGAGAAACTGTGTCAGGGAGG + Intronic
1191021189 X:55862135-55862157 ATTAAGAAACAAGCTCAGAGAGG - Intergenic
1191688971 X:63920703-63920725 ATGGGGAAACAGGATCAGACAGG - Intergenic
1191765051 X:64689204-64689226 ATAAAGAATCAGGCTCAGGAGGG + Intergenic
1192080246 X:68040809-68040831 ATGGAGAAACATACTGAGGGGGG - Intergenic
1192538113 X:71945901-71945923 TTGGGGAAACAGGCTCAGAGGGG + Intergenic
1195009116 X:100718001-100718023 ATGGGGAAACAGACTCAAGGAGG - Intronic
1195272162 X:103242685-103242707 CTGGAGAAAGAGGGTCAGGAGGG - Intergenic
1195385151 X:104307004-104307026 ATGGGAAAACAGGCTCAGAGTGG - Intergenic
1195510492 X:105710737-105710759 ATTTAGAAACAGGCTCAGATAGG - Intronic
1197707115 X:129641994-129642016 ATGAAAAATCAGGCTCATGGAGG - Intergenic
1197971093 X:132115822-132115844 ATGAATAAACAGGTTCACGGTGG + Intronic
1198377066 X:136050725-136050747 AGGAAGAGACAGGCTCAGGCAGG - Intergenic
1198399687 X:136256819-136256841 ATGAGGAAGCAGGCCCAGGGAGG + Intergenic
1198506914 X:137310078-137310100 CAGGTGAAACAGGCTCAGGGAGG - Intergenic
1198551114 X:137745847-137745869 AGGCAGAAACAGGCTGAGAGAGG + Intergenic
1198641878 X:138765112-138765134 ATGAAGAAAGAGGCTCAGTGAGG - Intronic
1198684278 X:139211256-139211278 ATGAGGAAACAAGCTCAGAGAGG + Intronic
1198741192 X:139844829-139844851 ATGGGAAAACAGACTCAGAGAGG - Intronic
1198783803 X:140265746-140265768 ATGAGAAAACAGGCTCAGTGAGG - Intergenic
1199937907 X:152595148-152595170 AAGGAGAAACAGACACAGGCAGG - Intergenic
1199967599 X:152832751-152832773 AATGAGAAACAGGCTCAGAGAGG - Intronic
1200052096 X:153438978-153439000 ATGGAAGACCAGGCTGAGGGAGG - Intergenic
1200401905 X:156024773-156024795 ATGGGGAAACTGGCCCAGAGAGG - Intergenic
1200737840 Y:6819380-6819402 GTGGAGAAATAGGAACAGGGAGG + Intergenic
1201442447 Y:14023001-14023023 TTGGAAAAACAATCTCAGGGAGG - Intergenic