ID: 1019675130

View in Genome Browser
Species Human (GRCh38)
Location 7:2306932-2306954
Sequence TTACCTAACCTGAGTTTCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019675129_1019675130 13 Left 1019675129 7:2306896-2306918 CCTGGAAAATAACGTAACTGGGC 0: 1
1: 0
2: 2
3: 2
4: 132
Right 1019675130 7:2306932-2306954 TTACCTAACCTGAGTTTCTCCGG 0: 1
1: 0
2: 0
3: 11
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019675130 Original CRISPR TTACCTAACCTGAGTTTCTC CGG Intronic
900910229 1:5592119-5592141 TTACCTAATCACAGTTTCCCAGG - Intergenic
901783569 1:11610099-11610121 GTACCCACCCTGAGTTGCTCAGG - Intergenic
901941918 1:12668836-12668858 CAGACTAACCTGAGTTTCTCAGG - Intergenic
902905719 1:19555588-19555610 TTATGTAAGCAGAGTTTCTCAGG + Intergenic
903846800 1:26283723-26283745 GCACCAAACCTTAGTTTCTCAGG - Intronic
909795836 1:79734839-79734861 TTCCCTAACTTGGGTTTATCAGG + Intergenic
911281881 1:95940042-95940064 TTACAGAACCTGAGGCTCTCAGG - Intergenic
911938811 1:104015975-104015997 TTACCTAACATGATCTTTTCTGG + Intergenic
912974672 1:114317131-114317153 TTACTTATCATGACTTTCTCAGG - Intergenic
913012967 1:114702825-114702847 TTTCCTAACCTGGGTATTTCAGG + Intergenic
915767393 1:158377179-158377201 TTTCCTTGCCTGATTTTCTCTGG - Intergenic
918651838 1:186974564-186974586 TTAACTAAACTGACTTTCTGTGG - Intronic
922374887 1:224952910-224952932 TTAGAAAACCTTAGTTTCTCAGG + Intronic
1064346359 10:14536425-14536447 TTACGTAACTTGGGTTTCTCAGG - Intronic
1069442711 10:68443337-68443359 TTACCCAACCTGAGTTGTTTGGG - Intronic
1071109660 10:82140903-82140925 TTACCTAGCTTGATTTTCTTTGG + Intronic
1072951841 10:99854155-99854177 TTACCTAGCTTGCATTTCTCTGG - Intergenic
1074856897 10:117480475-117480497 TTAGGAACCCTGAGTTTCTCTGG + Intergenic
1077749975 11:4956291-4956313 TTACCTAACCAGTGGCTCTCGGG + Intronic
1079421200 11:20290632-20290654 TTAACTCTCCTGAGTCTCTCTGG + Intergenic
1082194688 11:49287889-49287911 TTAACTAGCCTGGTTTTCTCTGG + Intergenic
1085697450 11:78717130-78717152 AAACATAACCTTAGTTTCTCTGG + Intronic
1086671444 11:89553039-89553061 TTAACTAGCCTGGTTTTCTCTGG - Intergenic
1089242531 11:117094791-117094813 TTACTTAGCCTGAGGTTCTCTGG - Intronic
1091018332 11:132074453-132074475 TTCCCTACTCTCAGTTTCTCAGG + Intronic
1091546968 12:1507694-1507716 TTATATAAAATGAGTTTCTCAGG - Intergenic
1091561457 12:1617160-1617182 TTATCTAAACTTAGTTTCTGGGG + Intronic
1092753151 12:11737770-11737792 TTAACTCAACTGATTTTCTCAGG + Intronic
1097855888 12:64461754-64461776 TTACCAAACCTGAGTGTCATGGG - Intronic
1099758509 12:86887744-86887766 TTACCTCAGCTGACTTTCTAAGG - Intergenic
1100095973 12:91037408-91037430 TTGCCTAACCAGACTTGCTCTGG + Intergenic
1102904854 12:116666649-116666671 TTCCCTCTCCTGAGTTTTTCAGG + Intergenic
1107373279 13:39775180-39775202 TTACCTAAGGTAAGTTACTCTGG + Intronic
1112561865 13:100522315-100522337 TTTCAAAACCTGTGTTTCTCTGG + Intronic
1115604171 14:34983333-34983355 TTACCGAGACTGAGTTTCTGTGG + Intronic
1116654113 14:47629385-47629407 TTACTTAGCCTGTGTTTATCAGG - Intronic
1116889747 14:50256659-50256681 CTATCTAACCTGATTTTCTAAGG + Intronic
1117162196 14:53000716-53000738 TAACCTAACCTCAGCTACTCAGG + Intergenic
1122109213 14:99484078-99484100 TTACAAAACCTGAGTTTTCCTGG + Intronic
1124384809 15:29198086-29198108 TAAGCTAAGCTGAGTTCCTCTGG - Intronic
1132074505 15:98809033-98809055 TTACCTATCCTGAATGTTTCAGG + Intronic
1134858939 16:17543696-17543718 TTGCCTAACCTAAGTTACACTGG + Intergenic
1139743309 16:69054235-69054257 CTACCTATCCAGAGTCTCTCTGG + Intronic
1140346389 16:74217442-74217464 TTGCCTAAACTGATTATCTCTGG - Intergenic
1141540556 16:84717266-84717288 TTCCCTTACATCAGTTTCTCGGG + Intronic
1148272732 17:46276396-46276418 TTAGCTAACCTGACTTTTTGGGG + Intronic
1151952730 17:77364111-77364133 TTCCCCACCCTGAGTGTCTCTGG - Intronic
1156985791 18:43350069-43350091 TTATCTAACCTAAGTATCACTGG + Intergenic
1158162282 18:54498854-54498876 TAACCTAACCTAAGTGTCTGTGG + Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1162135504 19:8552756-8552778 TTACCTATCCTGACTTTCACTGG + Intronic
1163419956 19:17208825-17208847 TCACCCAACCTGAGTCCCTCTGG + Intronic
1163976672 19:20859175-20859197 TTTCCTACACTTAGTTTCTCAGG - Intronic
1164610598 19:29629004-29629026 TTACAAAGCCTGAGATTCTCAGG - Intergenic
926004026 2:9357853-9357875 TTACCTGCCGTGAGTTTCTCAGG + Intronic
927136222 2:20098207-20098229 TTACCTCTCTTGTGTTTCTCTGG - Intergenic
927201886 2:20583166-20583188 TGTCCTGAGCTGAGTTTCTCAGG + Intronic
928028854 2:27761776-27761798 TGACCTAACTTGAGCTTCTGTGG - Intergenic
933327939 2:80862896-80862918 TTTCCTGACCTGAGTTTCATAGG + Intergenic
935835656 2:107050486-107050508 TTTCAGAACTTGAGTTTCTCAGG - Intergenic
936803306 2:116293819-116293841 TTTGCTAAGCTGTGTTTCTCTGG + Intergenic
937631649 2:124108838-124108860 TTATCTAACTTGAGTTTATAAGG + Intronic
939020118 2:136948522-136948544 TTCCCTCACCTGAATTTCTACGG - Intronic
942279394 2:174344507-174344529 TTCCCAAACCTTAGTTTCCCCGG + Intergenic
944340567 2:198592470-198592492 TTTCCTAAACTGAGTTCCCCAGG + Intergenic
944694768 2:202190911-202190933 TTTCCTAATCTGCGTTTCTGCGG + Intronic
945842435 2:214903939-214903961 TTACCTCACATGCTTTTCTCTGG - Intergenic
948330206 2:237158527-237158549 TTACCTAAAATGCATTTCTCAGG + Intergenic
1169292277 20:4362935-4362957 TTACCTAACGGGTGTTTTTCAGG - Intergenic
1170333808 20:15246333-15246355 TTACCAAACCTGAGTTTTTTAGG + Intronic
1172159637 20:32857715-32857737 TTTTCTAACCTGAGTTACTTAGG + Intergenic
1172197165 20:33099803-33099825 TAACATCACCTGAATTTCTCAGG + Intronic
1175074183 20:56359382-56359404 TTCCCGAGCCTCAGTTTCTCTGG - Intronic
1179304306 21:40141023-40141045 GTCCCTAACATGTGTTTCTCAGG - Intronic
952015182 3:28948345-28948367 TTTCCTAAACTGTGTTTCCCTGG + Intergenic
953107390 3:39897385-39897407 TTCCCTAAAGTGTGTTTCTCAGG - Intronic
958921217 3:100107911-100107933 TTCCCTTCCCTGAGATTCTCTGG - Intronic
959181963 3:102992872-102992894 TCACCAAACCTGAGGTTATCTGG + Intergenic
961852878 3:129839332-129839354 TAAAATAACCTGAGTTTTTCAGG - Intronic
962591554 3:136894650-136894672 TTTCCTGCCCTGAGTGTCTCTGG - Intronic
970958732 4:21847213-21847235 TTTACTAACCTGAGATTGTCAGG - Intronic
974370192 4:61006696-61006718 TTAATTAAGCTGATTTTCTCTGG + Intergenic
976701224 4:87970756-87970778 TTACATAACATGAGGTCCTCTGG - Intergenic
977026726 4:91828426-91828448 CTATTTAACCTCAGTTTCTCTGG + Intergenic
978695959 4:111579612-111579634 TTGCCTTCCCTGAGTTCCTCCGG - Intergenic
981623683 4:146733049-146733071 TTGCCTGGCCTGAGTTTCTGAGG + Intronic
983112053 4:163763399-163763421 TTACCAAAACTCAGTTTCTCTGG + Intronic
984443415 4:179802537-179802559 TTACCTAACTTCAATTTTTCTGG + Intergenic
986766114 5:10929134-10929156 TAACCTAACAGGAGTTTTTCAGG - Intergenic
990381549 5:55225563-55225585 CCACCTAAACTGAGTGTCTCTGG + Intronic
992084473 5:73265629-73265651 ATACCGAATCTGAGTTTCTAGGG + Intergenic
992917290 5:81470237-81470259 TTAGCTAACCTGTGTTTTTAAGG - Intronic
993336762 5:86669642-86669664 TTACTCAATCTGTGTTTCTCAGG + Intergenic
993540888 5:89150021-89150043 TTACATAAACTTAGTTGCTCTGG - Intergenic
994042065 5:95270194-95270216 TTTCCTAAACTGGGTTCCTCAGG + Intronic
994514914 5:100759200-100759222 GTAACTAACATGAGTTTCTGGGG + Intergenic
997142460 5:131397334-131397356 TTTGCTCACCTGATTTTCTCTGG + Intronic
997427690 5:133815421-133815443 TTACCCAACGTGAATCTCTCAGG - Intergenic
1000714315 5:164622007-164622029 TTCCATAACCTGACTTTCTCAGG + Intergenic
1006088943 6:31616449-31616471 TCAGCTACCCTGACTTTCTCAGG + Exonic
1006741529 6:36312511-36312533 TTCCCTAACCTTAGTTCCACCGG - Intergenic
1009760809 6:68002873-68002895 TTCCCTAACTTGAGTTACACAGG + Intergenic
1009875933 6:69505361-69505383 TTCCCTAAAATAAGTTTCTCTGG + Intergenic
1010108837 6:72200577-72200599 TTACCTGGCCTGACTTTTTCTGG + Intronic
1012493853 6:99812763-99812785 AAACACAACCTGAGTTTCTCAGG - Intergenic
1015013881 6:128386393-128386415 TTACCTAGTCTGAGTTTATAGGG + Intronic
1016269326 6:142270205-142270227 TTACCAAACTTGACTTTCTCTGG + Intergenic
1016637330 6:146308263-146308285 TTACCAAAACTGAGGTTCTGAGG - Intronic
1018412279 6:163563024-163563046 ATACCAAAACTGAGTTTCTGTGG + Intronic
1018672859 6:166194057-166194079 CTTCATAACCTGAGTTTCTGTGG - Intergenic
1019002443 6:168766188-168766210 TGACCTGAGCTGATTTTCTCTGG + Intergenic
1019675130 7:2306932-2306954 TTACCTAACCTGAGTTTCTCCGG + Intronic
1021767768 7:23966682-23966704 TTCCCAACCCTGACTTTCTCAGG - Intergenic
1021827622 7:24571516-24571538 TTACTTGCCCTGAGCTTCTCTGG - Intergenic
1021956569 7:25830929-25830951 TTAACACACCTGAGTTTCTAAGG + Intergenic
1022429192 7:30299551-30299573 TTATCTAACCTGATTTTTTGGGG - Intronic
1030428289 7:109408281-109408303 ATACTTAACCTGTGTCTCTCAGG + Intergenic
1031718791 7:125142268-125142290 TTGTTTAACCTGATTTTCTCAGG + Intergenic
1032300400 7:130681081-130681103 TTACCTCACCTTAGTCTCACTGG + Intronic
1032391499 7:131557839-131557861 TTCCGTAAACTGAGTTTATCCGG + Intronic
1033009107 7:137600384-137600406 TTATCTAACCTGTGTAACTCTGG + Intronic
1034053499 7:148008699-148008721 TCATTTAACCTGAGTTCCTCTGG + Intronic
1036940595 8:13048385-13048407 TCACCTAACCTGGGTATCTAGGG + Intergenic
1037410456 8:18590347-18590369 TTTCCACACCTGTGTTTCTCTGG - Intronic
1040720861 8:50321623-50321645 TTACTGAAGCTGACTTTCTCTGG + Intronic
1040739291 8:50553199-50553221 ATACCTAGCCAGGGTTTCTCAGG + Intronic
1047723393 8:127663605-127663627 TTACCTAACACCATTTTCTCTGG - Intergenic
1051143918 9:14007007-14007029 TTCTCTAACCTAAGTATCTCCGG - Intergenic
1055270645 9:74554321-74554343 GGACCTAACCTGGGCTTCTCAGG - Intronic
1060607918 9:124934195-124934217 TAACCTGACCTGAGTTCCTAAGG + Intronic
1186359820 X:8829089-8829111 TTACTTAACCTGAGTTTCAGAGG + Intergenic
1186763929 X:12751181-12751203 TTACTTAGCTTGAGATTCTCTGG - Intergenic
1188515582 X:30982001-30982023 TTACCTTCCCTGAGTTTTTCTGG - Intergenic
1188808712 X:34624535-34624557 TTGCCAAAACTGAGTTTCTCTGG + Intergenic
1189186154 X:39057156-39057178 TTACATAGCCTGAATTTTTCTGG + Intergenic
1191035896 X:56026326-56026348 TTACCCAAGCTGAGATTGTCTGG + Intergenic
1193234820 X:79093887-79093909 TTACCAAAACTGAGTCTCTTAGG + Intergenic
1198870135 X:141169852-141169874 TTATATACCCTGAGTTTCTGAGG - Intergenic
1199993221 X:153001679-153001701 TTAATTAATCTGAGGTTCTCAGG - Intergenic