ID: 1019688842

View in Genome Browser
Species Human (GRCh38)
Location 7:2398387-2398409
Sequence GGGGATCAGCTGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019688842_1019688853 29 Left 1019688842 7:2398387-2398409 CCTTCCTCCTTCAGCTGATCCCC No data
Right 1019688853 7:2398439-2398461 CTCCCCACTATCTATCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019688842 Original CRISPR GGGGATCAGCTGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr