ID: 1019689071 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:2399819-2399841 |
| Sequence | GGCTCAACTCCCTGAGTAGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1019689071_1019689077 | 9 | Left | 1019689071 | 7:2399819-2399841 | CCAGCTACTCAGGGAGTTGAGCC | No data | ||
| Right | 1019689077 | 7:2399851-2399873 | GAGGCTATAGTAAGCCATGATGG | No data | ||||
| 1019689071_1019689074 | -10 | Left | 1019689071 | 7:2399819-2399841 | CCAGCTACTCAGGGAGTTGAGCC | No data | ||
| Right | 1019689074 | 7:2399832-2399854 | GAGTTGAGCCCAGGAGGCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1019689071 | Original CRISPR | GGCTCAACTCCCTGAGTAGC TGG (reversed) | Intergenic | ||