ID: 1019689071

View in Genome Browser
Species Human (GRCh38)
Location 7:2399819-2399841
Sequence GGCTCAACTCCCTGAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019689071_1019689077 9 Left 1019689071 7:2399819-2399841 CCAGCTACTCAGGGAGTTGAGCC No data
Right 1019689077 7:2399851-2399873 GAGGCTATAGTAAGCCATGATGG No data
1019689071_1019689074 -10 Left 1019689071 7:2399819-2399841 CCAGCTACTCAGGGAGTTGAGCC No data
Right 1019689074 7:2399832-2399854 GAGTTGAGCCCAGGAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019689071 Original CRISPR GGCTCAACTCCCTGAGTAGC TGG (reversed) Intergenic
No off target data available for this crispr