ID: 1019689071 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:2399819-2399841 |
Sequence | GGCTCAACTCCCTGAGTAGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1019689071_1019689077 | 9 | Left | 1019689071 | 7:2399819-2399841 | CCAGCTACTCAGGGAGTTGAGCC | No data | ||
Right | 1019689077 | 7:2399851-2399873 | GAGGCTATAGTAAGCCATGATGG | No data | ||||
1019689071_1019689074 | -10 | Left | 1019689071 | 7:2399819-2399841 | CCAGCTACTCAGGGAGTTGAGCC | No data | ||
Right | 1019689074 | 7:2399832-2399854 | GAGTTGAGCCCAGGAGGCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1019689071 | Original CRISPR | GGCTCAACTCCCTGAGTAGC TGG (reversed) | Intergenic | ||