ID: 1019689074

View in Genome Browser
Species Human (GRCh38)
Location 7:2399832-2399854
Sequence GAGTTGAGCCCAGGAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019689070_1019689074 -9 Left 1019689070 7:2399818-2399840 CCCAGCTACTCAGGGAGTTGAGC No data
Right 1019689074 7:2399832-2399854 GAGTTGAGCCCAGGAGGCTGAGG No data
1019689068_1019689074 -1 Left 1019689068 7:2399810-2399832 CCTGTAGTCCCAGCTACTCAGGG 0: 826
1: 44844
2: 164903
3: 224557
4: 209880
Right 1019689074 7:2399832-2399854 GAGTTGAGCCCAGGAGGCTGAGG No data
1019689071_1019689074 -10 Left 1019689071 7:2399819-2399841 CCAGCTACTCAGGGAGTTGAGCC No data
Right 1019689074 7:2399832-2399854 GAGTTGAGCCCAGGAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019689074 Original CRISPR GAGTTGAGCCCAGGAGGCTG AGG Intergenic
No off target data available for this crispr