ID: 1019689671

View in Genome Browser
Species Human (GRCh38)
Location 7:2403629-2403651
Sequence GCGGCTGCGGGCGCGAGGTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 322}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019689665_1019689671 0 Left 1019689665 7:2403606-2403628 CCGCTAGTCGCGGGGCGGCGGCG 0: 1
1: 0
2: 0
3: 10
4: 72
Right 1019689671 7:2403629-2403651 GCGGCTGCGGGCGCGAGGTGAGG 0: 1
1: 0
2: 3
3: 24
4: 322
1019689656_1019689671 25 Left 1019689656 7:2403581-2403603 CCGGCGAGGGCTGCCTCTGGGGG 0: 1
1: 0
2: 0
3: 24
4: 223
Right 1019689671 7:2403629-2403651 GCGGCTGCGGGCGCGAGGTGAGG 0: 1
1: 0
2: 3
3: 24
4: 322
1019689659_1019689671 12 Left 1019689659 7:2403594-2403616 CCTCTGGGGGGTCCGCTAGTCGC 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1019689671 7:2403629-2403651 GCGGCTGCGGGCGCGAGGTGAGG 0: 1
1: 0
2: 3
3: 24
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019689671 Original CRISPR GCGGCTGCGGGCGCGAGGTG AGG Exonic
900100605 1:960563-960585 GCGGCTGCGGGCGGGAGCGGCGG + Intergenic
900118912 1:1040405-1040427 GCGCCTGCAGGTGCGGGGTGGGG + Intronic
900349673 1:2228504-2228526 GCGGCGGCGGGCGCGGCGCGGGG + Intergenic
900654330 1:3747453-3747475 GAGGCTCCGGGCGCGGGGCGGGG + Intergenic
901229147 1:7632299-7632321 GCCGCTGGGGGCGCGGGGGGCGG - Intronic
903155612 1:21440447-21440469 GCGGGGGCGGGTGGGAGGTGGGG + Intronic
903413795 1:23168171-23168193 CCAGCTGCGGGCGCGGGGCGCGG - Intronic
903413957 1:23168725-23168747 GCGGCGGCGGGAGCGCGGCGCGG - Intronic
903750489 1:25617731-25617753 GTGTCTGCGGGGGCGCGGTGAGG - Exonic
904272637 1:29360458-29360480 GGGGCTGCGGGGGAGAGGTGGGG + Intergenic
904533098 1:31181972-31181994 TCGGCGGCGGGGGCGAGGAGAGG + Intronic
905066869 1:35192150-35192172 GCGGGGGCGGGGGCGAGGAGGGG + Intronic
905734564 1:40316646-40316668 GGGGCTGCGGGCGCGCGGGTAGG - Intronic
909585215 1:77281861-77281883 GCGCGGGCTGGCGCGAGGTGCGG - Intergenic
911633987 1:100213391-100213413 GCGGCTGCGGGGGCGCGGCGGGG - Intronic
915310375 1:155003364-155003386 GCGCCAGGGGGCGCGGGGTGGGG - Intronic
915477424 1:156161206-156161228 GTGGCTGAGGGGGCGGGGTGGGG + Intronic
921355566 1:214281445-214281467 GCGGCGGCGGGCGGGAGCCGGGG + Intronic
923506430 1:234609698-234609720 GGGGCGGCGGGCGCGAGGTGAGG + Intergenic
924289730 1:242524726-242524748 GCGGCGGCGGGGGTGGGGTGCGG + Intergenic
924778401 1:247126821-247126843 GGGGCTGCGGGCGCGGGCCGGGG - Intronic
924783257 1:247171599-247171621 GGGGCTGCGGGCGCGGGCCGGGG + Intronic
1063960420 10:11301520-11301542 GGGGCAGCGGGAGCGGGGTGGGG - Intronic
1064981952 10:21174160-21174182 GCGGCGGCGGCGGCGAGGCGGGG - Intronic
1067216944 10:44311063-44311085 GCGGCTGCGGTGGCCAGGTGAGG + Intergenic
1069424687 10:68279050-68279072 GCGGCGGCGGGGGAGGGGTGCGG + Intergenic
1069512192 10:69050800-69050822 GGGGGTGGGGGCGCGAGGCGCGG + Intergenic
1069625819 10:69867123-69867145 GCGGCCGTGGGAGGGAGGTGGGG + Intronic
1069916722 10:71791115-71791137 GCGGCACCGGGTGCCAGGTGTGG + Intronic
1071966571 10:90858043-90858065 GCGGCGGCGGGCGCGAGGGGCGG - Intergenic
1072421119 10:95291116-95291138 GCGGCTGCGGGCGGGAGGACGGG - Intergenic
1073136783 10:101224655-101224677 GGGGCTTCGGGCGCGGGGCGGGG + Intergenic
1073403577 10:103277739-103277761 GCGGCTGCGGGCGCGCTGCGAGG + Exonic
1073921733 10:108466635-108466657 GCGGCTGCGGGGGCGCAGAGTGG - Intergenic
1076391466 10:130105901-130105923 CCGGCTGCGGGGGGGAGCTGGGG - Intergenic
1076866203 10:133167603-133167625 GCGGCGGCGGGCACGCGGGGTGG + Intronic
1077052976 11:576029-576051 GGAGCTGCGGGCGCGAGGCGGGG + Intergenic
1077089353 11:771423-771445 AGGGCTGCGGGAGCGGGGTGGGG + Exonic
1077385832 11:2269123-2269145 GAGGCTGCGGGGGGAAGGTGGGG + Exonic
1078514324 11:12009278-12009300 GCGGGTGCGGGAGCGCGGCGGGG + Intronic
1079689143 11:23400426-23400448 GGGGCTGCGGGGGTGAGGGGAGG - Intergenic
1081793645 11:45805337-45805359 GCGGCTGTGGGAGGGAGGGGCGG - Exonic
1082028695 11:47589852-47589874 GGGGCGGCGGGGGCGAGGTCGGG + Exonic
1083186806 11:61022426-61022448 GCTGGGGCGGGCACGAGGTGGGG - Intergenic
1083758283 11:64802820-64802842 GCGCCCGCGGGCGCGGGGTGCGG - Intronic
1084165486 11:67373155-67373177 GAGGCTGCGGGTGGGAGGAGGGG - Intronic
1084888099 11:72223775-72223797 GCGGCTCCGGGACCGAGGCGCGG + Intronic
1084978192 11:72814606-72814628 GCGGCTACGGGCGCGGGGAGAGG + Intronic
1085266792 11:75242130-75242152 GCGGGCGCGGGCGCGCGGCGCGG - Exonic
1085327245 11:75615956-75615978 GCGGCAGGGGGCGGGGGGTGGGG + Intronic
1087117999 11:94544536-94544558 GCGGCGGCGGGCGGGCGGCGCGG + Exonic
1088868952 11:113875413-113875435 GCGGCGGCGAGCGGGAGCTGGGG - Intronic
1090780334 11:130002078-130002100 CCGGTTGCGGGCGCGTGGGGCGG - Intronic
1091124561 11:133082961-133082983 GCGGCCGCGCGGACGAGGTGCGG - Intronic
1091401208 12:181879-181901 GGGGCAGCAGGCGGGAGGTGTGG + Intergenic
1093691878 12:22118318-22118340 GTGGCTGTTGGTGCGAGGTGGGG - Intronic
1094375325 12:29783420-29783442 GCGGCGGCTAGCGCGAGGTGAGG + Intronic
1094840118 12:34339339-34339361 GCGGCAGGGGGAGCGTGGTGTGG - Intergenic
1094843667 12:34352199-34352221 GCGGCAGCGGGGGCGTGGTTGGG + Intergenic
1096495462 12:52037170-52037192 GCGGCCGCGGGCGCGGGGGCGGG + Intronic
1096647588 12:53047181-53047203 GCGGGCGCGGGCGCGGGGCGCGG + Intronic
1097891388 12:64780867-64780889 GCGGCGGCGGTGGCGAGGCGAGG + Intergenic
1100539953 12:95548594-95548616 GGGGCTGCGGGCGCGCGGAAGGG - Intronic
1102561560 12:113766174-113766196 GCGGCCGCGGGGGCCGGGTGGGG - Intergenic
1102997309 12:117360660-117360682 GCGGCTGGGGGCCCGAGGCTGGG - Intronic
1103595300 12:122021688-122021710 CCGGCTCTGGGCGCGCGGTGGGG - Exonic
1103698458 12:122835346-122835368 GCGTTTGCGGGCGCGGGGGGCGG + Intronic
1103927672 12:124432855-124432877 GCGGCGGGGGGCGGGGGGTGGGG + Intronic
1104688705 12:130807909-130807931 GAGGCTGCTGGGGCGATGTGCGG - Intronic
1104983350 12:132583491-132583513 GGGGCGGCGGGCGGCAGGTGCGG - Exonic
1105368569 13:19782906-19782928 GCTGCAGCGGGCGTGAGTTGGGG - Exonic
1105698523 13:22915488-22915510 ATGGCGGCGGGGGCGAGGTGAGG + Intergenic
1105812295 13:24006512-24006534 GAGGCTCAGGGCACGAGGTGCGG + Intronic
1105827316 13:24134028-24134050 GTGGTTGCTGGCGGGAGGTGGGG + Intronic
1105850191 13:24327735-24327757 ATGGCTGCGGGGGCGAGGTGAGG + Intergenic
1108221013 13:48233312-48233334 GCGGCGGCGGGCTCGGGGCGCGG - Exonic
1110190894 13:72727707-72727729 CCGGCGGCGAGCGCGAGGGGCGG - Intergenic
1110573063 13:77026925-77026947 GCGGCTGCGGGAGCGCGAAGCGG - Exonic
1112504919 13:99969825-99969847 GCGGCGGCTGGCGCGCGTTGCGG + Intronic
1113483372 13:110637765-110637787 GTGGCTGCAGGTGCTAGGTGTGG + Intronic
1113871902 13:113564873-113564895 GGGGCTGAGGGCCCGAGGGGAGG - Intergenic
1113937323 13:114001372-114001394 GCGGCCGCGGGCTCGGGGTCAGG + Intronic
1117374430 14:55107957-55107979 GAGGCTGCAGGCGTGAGCTGGGG + Intergenic
1118748534 14:68790858-68790880 GCGGTGGCGGGGGCGGGGTGCGG - Intronic
1122543299 14:102509493-102509515 GCGGCCGCGGGCGCGGCGCGGGG + Intronic
1122581989 14:102777138-102777160 GCGGCGGCGGGGGCGCGGCGGGG + Intergenic
1122645161 14:103189237-103189259 GGGGCTGCGGGGTCGAGGGGAGG + Intergenic
1122736839 14:103848010-103848032 CCGGCTGCCGGCGCGCCGTGGGG + Intergenic
1122789359 14:104177845-104177867 GCGGGTGCGGGCGCCTGGGGAGG - Exonic
1122924368 14:104892862-104892884 GCAGCTGCTGGCCAGAGGTGGGG - Intronic
1122956799 14:105074966-105074988 CCGGCTGCGGTGGCTAGGTGGGG + Intergenic
1123035529 14:105470309-105470331 GCAGGTGAGGGCGGGAGGTGGGG - Exonic
1124212780 15:27776956-27776978 GCGGCGGGGAGCGTGAGGTGGGG + Intronic
1124340188 15:28885599-28885621 GCGGCGGCCGGGGCAAGGTGCGG + Intronic
1124640021 15:31391594-31391616 GCGGGGGCGGGGGCGGGGTGGGG - Intronic
1124640355 15:31392810-31392832 GCGGGGGCGGGGGCGGGGTGGGG - Intronic
1125672906 15:41486462-41486484 GAGGCTGCGGGCCCGGAGTGGGG - Intergenic
1126348356 15:47718826-47718848 GCGGCTGCCGGCGCGAGCGGCGG - Exonic
1127225137 15:56919530-56919552 GCGGCTGGGGTCTCGAGGAGCGG - Intronic
1128153471 15:65377603-65377625 GAGGGAGCGGGCGCGAGGGGCGG - Intronic
1128344143 15:66842857-66842879 GCGGCTCCGGGCGCGGGGCCAGG + Intergenic
1129468499 15:75737688-75737710 GCGGGGGCGGGGGCGGGGTGGGG + Intergenic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1130295726 15:82646440-82646462 GGGGCTGCAGGCGCGGGGCGGGG + Intronic
1131119712 15:89814729-89814751 GGGGCTGCGGGCGCGGGTAGGGG - Intronic
1131160561 15:90102285-90102307 GCGGCTGCTCTTGCGAGGTGGGG + Exonic
1131493452 15:92882649-92882671 GGGCCTGCGGGCGGGAGGCGGGG + Intergenic
1132522243 16:397184-397206 GCCGCTGTGAGCGCGAGGAGCGG - Intronic
1132589737 16:721427-721449 GCGGCTGCAGGTGCGGGGCGGGG + Exonic
1132697971 16:1210339-1210361 GCGGGGGCGGGTGAGAGGTGGGG - Intronic
1132805363 16:1772761-1772783 GCGGCTGCAGGGGCGGGGTGCGG + Intronic
1133188367 16:4116066-4116088 GCGGCGGCGGGCGCTGGGGGTGG + Exonic
1133212687 16:4272173-4272195 GCGGCTCCCGGCGCGGGGTGGGG - Intronic
1133212876 16:4272873-4272895 GCGGCGGCGGCGGCGAGGGGAGG + Exonic
1136460505 16:30407574-30407596 GCGGCTCCGGGGGCGGGGAGGGG - Exonic
1137984833 16:53099058-53099080 GCAGCTGAGGGTGGGAGGTGAGG + Intronic
1140858266 16:78996947-78996969 GCGCCTGGGAGGGCGAGGTGCGG + Intronic
1141531215 16:84648416-84648438 GCGGCTGAGGGCGGGACGCGGGG - Intergenic
1141608542 16:85169140-85169162 GCGGCGGCGGGCGGGAGGGGCGG - Intergenic
1141640756 16:85339635-85339657 GAGGCGGCGGGCGCAGGGTGGGG + Intergenic
1141720021 16:85750894-85750916 GGGGCGGCGGGCACGAGGCGCGG + Intronic
1141767390 16:86067721-86067743 GGGGCTGCAGGAGTGAGGTGTGG - Intergenic
1141926109 16:87170686-87170708 GCGGTGGAGGGCGGGAGGTGAGG - Intronic
1142163231 16:88570288-88570310 GCGGGTCCGGGCGCGCGCTGCGG + Intergenic
1143519203 17:7436127-7436149 GCGGGGGCGGGGGCGTGGTGAGG - Intronic
1143548581 17:7614790-7614812 GCGGCGGCGGGCGGAAGCTGAGG - Exonic
1143590872 17:7885295-7885317 GCGGCGGCGGGGGAGGGGTGCGG - Intronic
1143884045 17:10052852-10052874 GCCGCTGTGGGGGTGAGGTGTGG - Intronic
1145243942 17:21255496-21255518 TGGGGTGGGGGCGCGAGGTGAGG - Intergenic
1145273823 17:21418452-21418474 GGGGCTGGGGGCGTGGGGTGGGG + Exonic
1145867604 17:28250843-28250865 CCGGCGGAGGGCGCGAGGTTGGG - Intergenic
1145925739 17:28645277-28645299 CGGGCTGCGTGCGCGAGGAGCGG + Intronic
1145982060 17:29018759-29018781 GCTGCTCCGGGTGGGAGGTGGGG + Intronic
1146054106 17:29572735-29572757 GCGGCGGGCGACGCGAGGTGGGG - Intronic
1146492670 17:33293288-33293310 GCGGCTCCGGGCGGGCGGGGCGG + Intronic
1146788064 17:35735208-35735230 CGTGCTGGGGGCGCGAGGTGTGG + Exonic
1147193433 17:38749795-38749817 GTGGCTGCAGGCTCGAGCTGGGG - Exonic
1147393439 17:40123153-40123175 GTGGCGGTGGGCGCGAGGGGTGG - Intronic
1147971086 17:44219413-44219435 GCGGCTGAGGACGCGCGCTGGGG - Intronic
1148052354 17:44775472-44775494 GGTGGTGCGGGCGCCAGGTGGGG + Intronic
1148166929 17:45490405-45490427 GGGGATGCGGGCGCGGGCTGGGG + Intronic
1148553501 17:48564420-48564442 GCGGGGGCGGGGGCGGGGTGGGG - Intronic
1149296247 17:55264926-55264948 ACGCCTATGGGCGCGAGGTGCGG + Intergenic
1149296279 17:55265039-55265061 GCGGCCGCCGGCGCGGGGAGGGG + Exonic
1150398108 17:64836809-64836831 GGGGATGCGGGCGCGGGCTGGGG + Intergenic
1150423087 17:65056240-65056262 GCGGCGGCGGGTGCGGGGCGGGG - Intronic
1150562054 17:66302766-66302788 GGGGCGGCGGGGGAGAGGTGCGG - Intronic
1152289353 17:79430011-79430033 GGGGCTGCCGAGGCGAGGTGGGG + Intronic
1152458002 17:80427028-80427050 CCGGCTGCTGGCGCGCAGTGTGG + Intronic
1152535463 17:80948259-80948281 GCGGTTGCGGGCTCCTGGTGAGG + Intronic
1152581144 17:81166110-81166132 GCGGCGGGGGGCGCGGGGCGCGG - Intergenic
1152596320 17:81239431-81239453 CCGCCTGCGGGGCCGAGGTGAGG + Exonic
1155258086 18:24015273-24015295 GGGACTGCGGGCGCGCGGGGCGG - Intronic
1155284097 18:24271449-24271471 GCAGCCGCGGGCGCGTGGGGAGG - Intronic
1156275705 18:35581448-35581470 GCGGCTGCGCGGGGGAGGCGGGG - Intronic
1156994372 18:43448098-43448120 GCTGCTGCTGGCGCAAGCTGAGG - Intergenic
1157706782 18:49813919-49813941 GCGGCCGCGGCCGCCAGCTGGGG + Exonic
1160583208 18:79899362-79899384 GCCGCTGCGCGCGCGAGTTCGGG + Exonic
1160605613 18:80047368-80047390 GCGGCTGTGGGCGAGTGATGAGG + Intronic
1160745373 19:708926-708948 GCGGCGGCGGGCGCGGGGGGTGG - Intergenic
1160783925 19:891146-891168 GCTCCTGCGGGAGGGAGGTGTGG + Exonic
1160975249 19:1789813-1789835 GGGGCGGCGGGCTCGGGGTGGGG - Intronic
1161956939 19:7501356-7501378 GAGGCTGCGGGCGCGCGTCGTGG - Exonic
1161973471 19:7596349-7596371 CCGGCTGCGGGAGCGCGGTGGGG + Intronic
1162514278 19:11138778-11138800 GCGGCTGCCAGAGGGAGGTGGGG + Intronic
1163478302 19:17539731-17539753 GCGGCAGCGGGCGCGTGTGGCGG + Exonic
1163518551 19:17779053-17779075 GCGGTAGCGGGTGCCAGGTGGGG + Intronic
1163727214 19:18929535-18929557 GCGGGAGCGGGCGCGGGCTGAGG - Exonic
1165617924 19:37218382-37218404 GGGGAGGCGGGCGCGAGGCGTGG + Intronic
1165851470 19:38852270-38852292 GGGGCTGGGGGCGAGGGGTGCGG - Intronic
1165939888 19:39409771-39409793 GCGGGGGCGGGCGCGGGGCGGGG + Intergenic
1166851453 19:45763432-45763454 GAGGCTCCGGCCCCGAGGTGTGG + Intronic
1167576886 19:50322080-50322102 GCGGCTGAGGGAGCAAGATGGGG + Intronic
1168721800 19:58558464-58558486 GCAGCTGCGGGTCCGAGGAGCGG - Exonic
926914349 2:17878523-17878545 CCGGCTGCGGGCCCGAAGCGAGG + Intronic
927510746 2:23642516-23642538 GCGGCTGAGGGAGCGAGTAGTGG - Exonic
927606565 2:24491500-24491522 GCGGCGCCGGGCCCGAGGAGCGG + Intergenic
929453011 2:42048726-42048748 GCAGCTGCGTGCGCGAGTTCGGG + Exonic
929604278 2:43224936-43224958 GCGGCGGCGTGCGCGACGTGGGG + Exonic
932599334 2:73112989-73113011 GGGGCGGCGGGCGCGGGGCGGGG - Exonic
933684621 2:85133441-85133463 GCGGCGGCGGTGGCGAGTTGGGG + Exonic
933782347 2:85811309-85811331 GCGCCTGCGGGGGCGGGGGGAGG - Intergenic
934655871 2:96116619-96116641 GCGGGAGCGGGCGGGAGGCGGGG + Intergenic
936141831 2:109947747-109947769 GCGGCGGCGGGCGCGGCGAGCGG - Intergenic
936178519 2:110245695-110245717 GCGGCGGCGGGCGCGGCGAGCGG - Intergenic
936202859 2:110423737-110423759 GCGGCGGCGGGCGCGGCGAGCGG + Exonic
937045286 2:118848021-118848043 GCGGGTGCGGGCGCGGGTGGGGG - Intergenic
938252059 2:129822977-129822999 GCTACTGCGAGCACGAGGTGGGG - Intergenic
939629389 2:144515880-144515902 GCGGCTGGGGGCGCAGTGTGAGG - Intronic
941686845 2:168456317-168456339 GCGGCGGCGGGCGGGAGCAGCGG + Exonic
942042998 2:172083257-172083279 GCCGCGGCGGGCGCGGGGTCGGG - Intergenic
943589919 2:189784498-189784520 GCGGGTGCGGGTGCGGGGTTGGG + Exonic
943669895 2:190649169-190649191 GAAGCGGCGGGCCCGAGGTGGGG + Intronic
946280017 2:218659779-218659801 GTGGCTGGAGGCGCGAGCTGGGG + Exonic
946692295 2:222319095-222319117 GCGGCCGCGGGCTCGACGGGGGG - Intergenic
947117943 2:226791673-226791695 GCCGCGGCGGGCGCGGGGCGGGG - Intronic
948487236 2:238288705-238288727 GCGGCGGCGGGCGCGGGGCCGGG - Intronic
1169216268 20:3796427-3796449 GAGGCAGCGGGCGAGGGGTGGGG - Exonic
1170890173 20:20369222-20369244 GCGGCGGCGGGCGCGGGCCGCGG - Exonic
1171768247 20:29301649-29301671 GCCTCTGCGGGCCCGAGGAGGGG - Intergenic
1172275131 20:33675060-33675082 GTGGCTGCGGTCCTGAGGTGAGG - Intergenic
1172702799 20:36863280-36863302 GCGGGTGCAGGCGCGGGCTGGGG + Exonic
1172908036 20:38383977-38383999 GCAGCTGGGGGCAGGAGGTGAGG - Intergenic
1173213230 20:41054293-41054315 GCAGGTGCGGGGGCGGGGTGGGG - Intronic
1176359536 21:5983174-5983196 GCTGCTGCAGGCCTGAGGTGAGG - Intergenic
1179674832 21:42974441-42974463 GCGGCGGCGGGCGCGGGGCGGGG - Intergenic
1179763982 21:43555376-43555398 GCTGCTGCAGGCCTGAGGTGAGG + Intronic
1179784059 21:43719701-43719723 GCGGGGGCGGGCGGGCGGTGCGG + Intronic
1180837085 22:18935273-18935295 GCCTCGGCGGGTGCGAGGTGAGG - Intronic
1181064480 22:20299116-20299138 GCGGCTGGGAGCGCGGGGCGGGG + Intergenic
1181064525 22:20299266-20299288 GCGGCTGGGAGCGCGGGGCGCGG + Intergenic
1181064872 22:20300750-20300772 GCCTCGGCGGGTGCGAGGTGAGG + Intergenic
1181599548 22:23941371-23941393 GGGGCTGCGGGAGCGAGGTCTGG + Intergenic
1181610942 22:24011446-24011468 GGGGCTGCAGGCGCGAGGCTGGG + Exonic
1182360605 22:29744375-29744397 GCGGGGGCGGGCGGGGGGTGTGG + Intronic
1183149735 22:36028373-36028395 GCGGCGCCGGGCCCGAGCTGAGG + Exonic
1183158778 22:36096214-36096236 GAGGCTGAGGGCGGGGGGTGGGG - Intergenic
1183294138 22:37019795-37019817 ACAGCTGCGGGCGCGGGGAGGGG + Intronic
1183504807 22:38202966-38202988 GTGGCTGCGGGCGCGGGCTCTGG - Intronic
1183548502 22:38468022-38468044 GCGGCCGCCGGCGCAGGGTGGGG - Intergenic
1184172807 22:42769513-42769535 CCGGCTGCGGGTGGAAGGTGAGG + Intergenic
1184412229 22:44331875-44331897 GCGGCGGCGGGCGCGGCGCGGGG - Intergenic
1184759860 22:46537899-46537921 GCGGCCCCGAGCCCGAGGTGCGG - Intergenic
1184863573 22:47190517-47190539 GAGGGTGCGGGCGCTGGGTGGGG - Intergenic
1185080301 22:48706027-48706049 GGGGCTGCAGACGGGAGGTGGGG + Intronic
1185245938 22:49772855-49772877 GCGGGTGCAGGAGCCAGGTGGGG - Intergenic
1185291609 22:50030355-50030377 GCGGCTGCTGGCGAGGGTTGGGG + Intronic
1203287178 22_KI270734v1_random:160572-160594 GCCTCGGCGGGTGCGAGGTGAGG - Intergenic
950316369 3:12004858-12004880 GCGGCTGCGGGCGCGGGAGCGGG - Exonic
950759267 3:15206250-15206272 GCCGCTGGGGCCGCGAAGTGGGG + Exonic
952908847 3:38165451-38165473 CCGGAGGCGGGCCCGAGGTGGGG + Intronic
953013791 3:39052871-39052893 GGGGCTGGGGGCGCTAGGGGAGG + Intronic
953911975 3:46897895-46897917 GCCGCTGGGGGCACCAGGTGAGG + Exonic
953925364 3:46979922-46979944 GCGGGTGCGGGCGCGGGGCGGGG - Intronic
955059286 3:55482331-55482353 GCGGGTGCGGGTGGGAGGAGCGG + Intronic
955356796 3:58238218-58238240 GCTGCTGCGGGCGCAGGGGGTGG - Intronic
955911601 3:63864020-63864042 GCCGCGGCCGGCGCGAGTTGGGG + Intergenic
960955338 3:123027310-123027332 GAGGCTGCGGGCGGGAGGACAGG - Intronic
961408944 3:126704439-126704461 GCGGGCGCGGGGGGGAGGTGCGG + Intronic
961532347 3:127547397-127547419 GAGGCTGGGGGTGCGAGCTGGGG + Intergenic
961543843 3:127618497-127618519 GCGGGTGCGGGCCGGAGGGGAGG - Intronic
963133264 3:141877095-141877117 GCTGCTTCGGGAGCGAGCTGCGG - Intronic
964118556 3:153160709-153160731 GCGGCGGCGGGTGCGGGATGGGG - Intergenic
964607152 3:158571716-158571738 GAGGTTGAGGGCGTGAGGTGAGG + Intronic
965404181 3:168249729-168249751 GCGTCTGGGAGCGCGAGGAGCGG - Intergenic
967916723 3:194583901-194583923 GCGGCTGCGGCGGCGGGGCGGGG + Intergenic
968434514 4:577457-577479 GCGGCTGGGTGCGTGGGGTGGGG + Intergenic
968674721 4:1871360-1871382 GCGGCGGCGGGCGGGAGGCGCGG + Intergenic
968746091 4:2361370-2361392 GTGGCTGCAGGTGGGAGGTGCGG + Intronic
969240391 4:5893151-5893173 GCGGCTGCGGGCTAGCGGCGCGG + Intergenic
969344829 4:6563924-6563946 GCGGCTGCGGGCGCCGAGGGTGG + Intergenic
969597831 4:8158893-8158915 GCGGCAGCGGGGGCGCGGGGCGG - Intergenic
970529495 4:16967604-16967626 GAGGGTGCGGGCGAGGGGTGTGG - Intergenic
971257818 4:25030439-25030461 GCGGCGGCGGACGCAGGGTGGGG + Intronic
973551266 4:52038188-52038210 GCGGCCGCGGGCTGGAGGAGCGG - Intronic
974549120 4:63349233-63349255 GCTGCTGCCCGCGCCAGGTGAGG + Intergenic
975420495 4:74158287-74158309 AGGGCTGCGGGCGCCGGGTGCGG + Intronic
976475251 4:85475613-85475635 GCGGCTGCCTGCGCCAGGGGAGG + Intronic
985611633 5:892665-892687 CCGGCGGCGGGCCCGAGGCGGGG + Exonic
987102645 5:14605400-14605422 GCGGGTGGGGGGGCGTGGTGCGG + Intronic
988319579 5:29676228-29676250 GGGGCTGGGGGTGGGAGGTGAGG - Intergenic
989368221 5:40679739-40679761 GGGGCTGGGCGCGCGGGGTGGGG - Exonic
992104151 5:73436658-73436680 CCGGCTGTGGGCGGGAGGCGCGG - Intergenic
992396270 5:76372174-76372196 GAGGCTGCTGGGGTGAGGTGGGG - Intergenic
999175650 5:149630018-149630040 GGGGCTGGGGGTGGGAGGTGGGG + Intronic
999252302 5:150190161-150190183 GCGGCTGCGGGCGTGGAGCGCGG - Exonic
999462695 5:151771055-151771077 GCGGCCGCGGGCGTGTGGCGAGG - Intronic
1003058215 6:2841763-2841785 GCGGGGGCGGGCGCGGGGAGAGG - Intronic
1003995550 6:11537341-11537363 CCGGCTGGGTGCGCGCGGTGCGG - Intergenic
1004113973 6:12749288-12749310 GGGGCTGCAGGCGGGAGGCGGGG + Intronic
1004114200 6:12750099-12750121 CAGGCTGCGGGCGCGGGGTCTGG + Intronic
1006300725 6:33192495-33192517 CCGGGGGCGGGGGCGAGGTGGGG - Exonic
1007557816 6:42782013-42782035 GCGGCGGCGGGCGCGGGGCCGGG - Exonic
1014116761 6:117675506-117675528 ATGGCGGCGGGGGCGAGGTGAGG + Exonic
1016340915 6:143060810-143060832 GCGGGCGCGGGCGCGGGGCGGGG - Intronic
1016923447 6:149317816-149317838 GCGGCGGCGGGCGAGCGGAGGGG + Intronic
1016949496 6:149566371-149566393 GCAGCCGCGGCCGGGAGGTGAGG - Exonic
1017696588 6:157021722-157021744 GAGCCTGCGGGCGCGCGGGGCGG - Intronic
1017880553 6:158559994-158560016 GGGGCCGCGGGCGCGCGGCGAGG - Intronic
1018046313 6:159969271-159969293 GCGGGCGCGGGCCCCAGGTGGGG - Exonic
1018876650 6:167827291-167827313 GCGGCGGCGGGGGGGAGGGGCGG - Intronic
1019472757 7:1229982-1230004 GCGGCTGCGGGGGCGGCGGGTGG + Intergenic
1019473275 7:1232527-1232549 GCGGCGGCTGGCGGGAGGCGCGG + Intergenic
1019689671 7:2403629-2403651 GCGGCTGCGGGCGCGAGGTGAGG + Exonic
1021452780 7:20798066-20798088 GCGGCCGCGGGCGCGGGAGGCGG + Intergenic
1022104002 7:27185606-27185628 GGAGCTGCGGGTGGGAGGTGGGG - Intergenic
1023839516 7:44088521-44088543 GCCACAGCGGGGGCGAGGTGGGG - Intergenic
1023858435 7:44201046-44201068 GCGGCGGCGGTCCCGAGGGGCGG + Exonic
1023875831 7:44285823-44285845 GCGGCGGAGGGGGCGCGGTGTGG + Intronic
1023882007 7:44325929-44325951 TGGCCTGCGTGCGCGAGGTGCGG - Intronic
1026360262 7:69597460-69597482 GCGGCCGCGGGCGAGGGGCGGGG - Intergenic
1026765162 7:73155453-73155475 GCGGCGGCGGGGGCGGGGCGGGG - Intergenic
1026789535 7:73322839-73322861 GGGGCTCAGGGCGAGAGGTGTGG - Intronic
1027041635 7:74965208-74965230 GCGGCGGCGGGGGCGGGGCGGGG - Intronic
1027082007 7:75237161-75237183 GCGGCGGCGGGGGCGGGGCGGGG + Intergenic
1027374517 7:77537124-77537146 GCGGCTGCTGGCGGGGGGTGGGG + Intergenic
1028988220 7:97024203-97024225 GACGCTGGGGGCGCGAGATGGGG - Intronic
1029123243 7:98281894-98281916 GCGGCGGCGGGGGCGCGGCGGGG - Exonic
1029390590 7:100271706-100271728 GCGGCGGCGGGGGCGGGGCGGGG + Intronic
1029596025 7:101538051-101538073 GGGGCTGGGGGCAGGAGGTGGGG - Intronic
1029640462 7:101816528-101816550 GCGGCGGCGGGCGCCGGGAGGGG + Intronic
1030121249 7:106112417-106112439 GCGGCTGGGGAGGCGAGGGGCGG + Intronic
1030347894 7:108455052-108455074 GCGGGCGCGGGCGGGAGGGGAGG + Intronic
1032344362 7:131105948-131105970 GCGGCGGCGGGCGCGCGCGGGGG + Intergenic
1033477180 7:141702167-141702189 GGAGCCGCGGGCGCGAGGGGCGG + Intergenic
1034494152 7:151410110-151410132 GAGGCTGCAGGCGCGCGGGGTGG - Intronic
1034977676 7:155457783-155457805 GGGGCGGCGGCCGCGAGGAGGGG + Intergenic
1035167595 7:157000582-157000604 GCGGGGGCGGGGGCGGGGTGGGG + Intronic
1035199178 7:157249243-157249265 GTGGCTGCCTGCGGGAGGTGGGG - Intronic
1036123440 8:6042091-6042113 GTGGCTGGGGACCCGAGGTGAGG + Intergenic
1036561437 8:9903284-9903306 GCGGCCGCGGGCGCGAGGGGAGG - Intergenic
1036837176 8:12082258-12082280 GGGGATGGGGGCGCGAGGGGAGG + Intergenic
1036858969 8:12328503-12328525 GGGGATGGGGGCGCGAGGGGAGG + Intergenic
1037769179 8:21789021-21789043 GCGGCTGGCGGCGCGGGGCGCGG + Intronic
1037789001 8:21919999-21920021 GCAGCCCCGCGCGCGAGGTGTGG - Intronic
1038644006 8:29348751-29348773 GCGCCTGCGGGGGGGAGGAGCGG + Intronic
1038789732 8:30657947-30657969 GGGGCTGCGGCCGCCGGGTGTGG - Intronic
1042039321 8:64576213-64576235 GCAGCTGAGGGAGCTAGGTGTGG - Intergenic
1048553907 8:135457372-135457394 GGGGCGGCGGGCGCGGGGCGGGG + Intergenic
1049199542 8:141333298-141333320 GCGGCTGGTGGAGGGAGGTGAGG + Intergenic
1049473146 8:142785145-142785167 GCGGCTGGGGAAGAGAGGTGTGG + Exonic
1049597770 8:143492601-143492623 GCAGGTGTGGGTGCGAGGTGAGG - Intronic
1049752365 8:144291372-144291394 GTGGCGGCCGGCGCGCGGTGGGG - Intergenic
1049762279 8:144336910-144336932 GCGGCGGCGGGCGGGGGGCGGGG + Intergenic
1049792408 8:144478111-144478133 TCGGCGCGGGGCGCGAGGTGAGG + Intronic
1053146421 9:35715127-35715149 GCGGCTGCGGGAGGCAGCTGAGG - Exonic
1054489414 9:65762586-65762608 GCGGCGGCGGGGGGGGGGTGGGG - Intergenic
1057390655 9:94639417-94639439 GCAGGTGCGGGCGGCAGGTGCGG + Intronic
1059541279 9:115132871-115132893 GCGGCGGCGGTGGTGAGGTGAGG - Intergenic
1059633935 9:116154337-116154359 GCGGCGGCGGCGGCGAGGCGCGG - Exonic
1060311225 9:122464307-122464329 GCTGCTGCTGGCGGGCGGTGGGG - Intergenic
1060856051 9:126915309-126915331 GCGGCTGCAGGTGCGGGGGGCGG + Intronic
1061186989 9:129060587-129060609 GCGGCTGCGGGCGGACGATGAGG + Exonic
1061252719 9:129436157-129436179 CCGACAGCGGGCGAGAGGTGAGG - Intergenic
1061472155 9:130835301-130835323 GCGGGCGCGGGCGCGCGGGGCGG + Intronic
1061682146 9:132248114-132248136 GAGGGTGCGGGTGCGTGGTGGGG - Intergenic
1185892733 X:3835381-3835403 GAGGCTCCGGGAGCGACGTGGGG - Intronic
1185897841 X:3873801-3873823 GAGGCTCCGGGAGCGACGTGGGG - Intergenic
1185902960 X:3912232-3912254 GAGGCTCCGGGAGCGACGTGGGG - Intergenic
1186768117 X:12791664-12791686 GCGGCTGCGGGGCCGGGTTGGGG + Intronic
1189304118 X:39973983-39974005 GAGGCTGGGGGTGCAAGGTGAGG + Intergenic
1189323443 X:40099197-40099219 GCGGCTCTGGGCGCGGGGGGAGG + Intronic
1189324598 X:40105105-40105127 GCGGCGGCGGCGGCGAGGAGGGG + Intronic
1189961280 X:46327084-46327106 GTGGCGGCGGGGGCGGGGTGGGG + Intergenic
1195883315 X:109615118-109615140 GCGGCTGGGGGCTTGAGGGGAGG + Intergenic
1196425183 X:115562033-115562055 GCGGCCCCGGGCGCGCGGTCGGG + Intronic
1196893410 X:120311053-120311075 GCTGCAGCGGGAGCGACGTGCGG - Intronic
1197806365 X:130402112-130402134 GCGTCTGCGGGGCCGAGGGGCGG + Intronic
1199057858 X:143319085-143319107 GCTGCTGTGGGCGTGAGGGGTGG + Intergenic
1200310343 X:155071336-155071358 GGGGCTGTGGGGGCGAGGAGGGG - Exonic