ID: 1019689825

View in Genome Browser
Species Human (GRCh38)
Location 7:2404156-2404178
Sequence GGCCCCGCCGACCGCAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 1, 2: 0, 3: 36, 4: 328}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019689821_1019689825 -6 Left 1019689821 7:2404139-2404161 CCTGAACGGGGCTCCCCGGCCCC 0: 1
1: 0
2: 2
3: 11
4: 188
Right 1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG 0: 1
1: 1
2: 0
3: 36
4: 328
1019689809_1019689825 28 Left 1019689809 7:2404105-2404127 CCAGCTCCCGAGGGCCCCCGTGT 0: 1
1: 0
2: 0
3: 17
4: 126
Right 1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG 0: 1
1: 1
2: 0
3: 36
4: 328
1019689812_1019689825 14 Left 1019689812 7:2404119-2404141 CCCCCGTGTGCCTGCTGTCACCT 0: 1
1: 0
2: 1
3: 24
4: 224
Right 1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG 0: 1
1: 1
2: 0
3: 36
4: 328
1019689807_1019689825 30 Left 1019689807 7:2404103-2404125 CCCCAGCTCCCGAGGGCCCCCGT 0: 1
1: 0
2: 1
3: 10
4: 207
Right 1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG 0: 1
1: 1
2: 0
3: 36
4: 328
1019689815_1019689825 11 Left 1019689815 7:2404122-2404144 CCGTGTGCCTGCTGTCACCTGAA 0: 1
1: 0
2: 0
3: 36
4: 263
Right 1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG 0: 1
1: 1
2: 0
3: 36
4: 328
1019689814_1019689825 12 Left 1019689814 7:2404121-2404143 CCCGTGTGCCTGCTGTCACCTGA 0: 1
1: 2
2: 4
3: 29
4: 297
Right 1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG 0: 1
1: 1
2: 0
3: 36
4: 328
1019689808_1019689825 29 Left 1019689808 7:2404104-2404126 CCCAGCTCCCGAGGGCCCCCGTG 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG 0: 1
1: 1
2: 0
3: 36
4: 328
1019689811_1019689825 21 Left 1019689811 7:2404112-2404134 CCGAGGGCCCCCGTGTGCCTGCT 0: 1
1: 0
2: 3
3: 31
4: 229
Right 1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG 0: 1
1: 1
2: 0
3: 36
4: 328
1019689819_1019689825 4 Left 1019689819 7:2404129-2404151 CCTGCTGTCACCTGAACGGGGCT 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG 0: 1
1: 1
2: 0
3: 36
4: 328
1019689813_1019689825 13 Left 1019689813 7:2404120-2404142 CCCCGTGTGCCTGCTGTCACCTG 0: 1
1: 1
2: 3
3: 19
4: 236
Right 1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG 0: 1
1: 1
2: 0
3: 36
4: 328
1019689810_1019689825 22 Left 1019689810 7:2404111-2404133 CCCGAGGGCCCCCGTGTGCCTGC 0: 1
1: 1
2: 4
3: 20
4: 218
Right 1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG 0: 1
1: 1
2: 0
3: 36
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019689825 Original CRISPR GGCCCCGCCGACCGCAGCCC TGG Intronic
900148675 1:1168960-1168982 GGCCCCGCAGACACCAGCCCAGG + Intergenic
900214094 1:1471964-1471986 GTCCCCGCCGCCCTCGGCCCCGG - Exonic
900221643 1:1512348-1512370 GTCCCCGCCGCCCTCGGCCCCGG - Exonic
900255031 1:1693425-1693447 GGCCCCGCCCCCCGCAGCTCCGG - Intronic
900263774 1:1746691-1746713 GGCCCCGCCCCCCGCAGCTCCGG - Intergenic
900367654 1:2317807-2317829 AGCCCCGCCCACGGCAGCCATGG - Intergenic
900414008 1:2526778-2526800 CGCCCGCCCGCCCGCAGCCCCGG - Intergenic
900486234 1:2924111-2924133 GGCACGGCCAACCCCAGCCCTGG - Intergenic
900804126 1:4756261-4756283 GGCCCTGCCGAAAGCAGCTCAGG + Intronic
901789982 1:11648984-11649006 AGCCCAGCCCACCCCAGCCCAGG + Intronic
902793420 1:18784594-18784616 GGCCCAGCCCACCGCGGCCACGG - Intergenic
903573269 1:24321923-24321945 GGCGCCCTCGGCCGCAGCCCAGG - Intronic
903652611 1:24930686-24930708 GACCCCGCGGCCCCCAGCCCGGG - Intronic
903750395 1:25617445-25617467 GGTCCCGGCGGCCGCAGCGCGGG + Intergenic
904162287 1:28530710-28530732 GGCCCCCCAACCCGCAGCCCCGG - Intronic
904211031 1:28887189-28887211 GTCCCCGCCGCACCCAGCCCAGG + Exonic
904613243 1:31736561-31736583 GGCCCTGCTCACCCCAGCCCAGG + Exonic
905464135 1:38140040-38140062 AGCCCAGCCGAGAGCAGCCCAGG + Intergenic
905584302 1:39105219-39105241 GGCCCAGCCGGCCGCAGCCTGGG + Intronic
906288404 1:44603375-44603397 GGCCTGGCCCACCGTAGCCCGGG - Intronic
906688133 1:47775563-47775585 GGGCCCGGTGACAGCAGCCCAGG + Intronic
907223019 1:52921242-52921264 GGCCCCGCGGCCCCCAGGCCAGG - Intronic
907281633 1:53350814-53350836 GGCCTCAGCCACCGCAGCCCAGG + Intergenic
912549052 1:110472750-110472772 GGTCCCGCCGGCGGCTGCCCAGG + Intergenic
912551426 1:110487908-110487930 GGCCCAGCCGAGGGCAGCCAGGG + Intergenic
912798547 1:112707045-112707067 CGCCCCACCGCCCGCAGCCCCGG + Intronic
912844652 1:113068743-113068765 GGCGCCGGCGAGCGCCGCCCGGG + Intergenic
912993426 1:114510897-114510919 GGCCGCGCCGCCCTCAGCGCCGG + Exonic
915355004 1:155250633-155250655 GGCCCCGCAGGCCACAGTCCAGG + Exonic
916101893 1:161399919-161399941 GACCCCGCCGCGAGCAGCCCGGG - Intergenic
916651790 1:166839976-166839998 GGCCCCTCCCACCTCTGCCCCGG + Intronic
921171948 1:212558467-212558489 GGCCCCGCCGACTGCTGACGCGG + Intergenic
922335729 1:224616970-224616992 GGCTCCGGCGACCCCAGACCCGG - Exonic
922821285 1:228487470-228487492 GGCCCCGCCGCCCGCAGCCCTGG + Exonic
922958494 1:229625648-229625670 CACGCCGCCGGCCGCAGCCCGGG + Intronic
923008003 1:230067375-230067397 GGCGCCGCCGCCCGCGCCCCCGG - Exonic
924775503 1:247112446-247112468 GGCCCCGCCGGCCTGAGTCCTGG + Intergenic
1064060101 10:12129845-12129867 AGCCCCACCGCCCGCAGCCCAGG - Intronic
1065099558 10:22320727-22320749 GGCCCCGCGGGCTGCGGCCCAGG - Intronic
1065214992 10:23439904-23439926 CGCCCCGGCGCCCGCAGCCCCGG + Exonic
1065928581 10:30458252-30458274 CCCCCCGCCGCCCCCAGCCCTGG - Intronic
1065993046 10:31031638-31031660 GGCCTCGCCTCCCGCACCCCAGG + Intronic
1066614996 10:37285122-37285144 GGCAGCTCCGCCCGCAGCCCTGG - Intronic
1067113953 10:43420560-43420582 CGCCCCGCCGCCGGCAGCGCTGG - Intergenic
1069962811 10:72088298-72088320 GCACCAGCCGCCCGCAGCCCGGG + Exonic
1071715251 10:88089135-88089157 GGCACCGCCGCCTGCCGCCCCGG + Intergenic
1072970039 10:100009755-100009777 GTCCCCTCCGCCCGCGGCCCCGG + Intronic
1075492065 10:122879906-122879928 GGCCCCGCCTGCGGCATCCCAGG - Intergenic
1075562013 10:123474841-123474863 GGCCATGCCAACAGCAGCCCAGG - Intergenic
1075638854 10:124050021-124050043 CCCCACGCCCACCGCAGCCCAGG - Intronic
1076133591 10:128029800-128029822 GGCCCCTAAGACCCCAGCCCTGG - Intronic
1076480779 10:130783984-130784006 GGCCGTCCAGACCGCAGCCCTGG - Intergenic
1076594542 10:131617672-131617694 GGCCCAGCCTCTCGCAGCCCAGG + Intergenic
1076993758 11:288873-288895 GGCCCCACCCACAGCCGCCCCGG + Intergenic
1077040423 11:518753-518775 GGCCCCGTCGTGGGCAGCCCGGG - Intergenic
1077112234 11:866860-866882 GGCCCCTCCCACCCCTGCCCTGG - Exonic
1077183916 11:1228182-1228204 GGCCCCGCAGCCGGCAGCCCTGG + Intronic
1077218992 11:1407097-1407119 GGCCCCACCCTCGGCAGCCCAGG - Intronic
1077316040 11:1919787-1919809 GGCCCCGTCGGCCCCAGTCCTGG - Intronic
1077507905 11:2940644-2940666 GGCCCAGCCCAGCCCAGCCCAGG - Intergenic
1078053470 11:7987388-7987410 GGCCACGCCAACCCCAGTCCCGG + Exonic
1078091686 11:8268232-8268254 GGCACCGCCGACCCCGGCACCGG + Intronic
1078317766 11:10306512-10306534 GGCGCCGGCGGCCGTAGCCCTGG - Exonic
1079136072 11:17776654-17776676 GGCCCTGCCTCCCCCAGCCCAGG - Intronic
1081347795 11:42011658-42011680 GACCCCGCTGACCACAGGCCTGG - Intergenic
1082076760 11:47980955-47980977 GGCAGCGCCCAGCGCAGCCCGGG - Exonic
1082924692 11:58532349-58532371 GGCAGCTCCGCCCGCAGCCCTGG + Intronic
1083560626 11:63670918-63670940 GGCCCCGCCGAGCCCCGCCCTGG - Intronic
1083572663 11:63768646-63768668 GGCCCCGCGCCCCGCCGCCCCGG - Exonic
1083822566 11:65181499-65181521 GGCGCCGCCTCCCGCAGCCCCGG - Exonic
1084021317 11:66419994-66420016 GGCCCCGCCCGCCGCAGCCGCGG + Intergenic
1084420077 11:69056108-69056130 GGCCCCTGAGACCGCAGCACTGG - Intronic
1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG + Exonic
1089556262 11:119317255-119317277 GGCCCCGGCGCCGCCAGCCCGGG + Intronic
1091759351 12:3077106-3077128 CGCCCCGCCGCCCGCATGCCCGG - Intergenic
1091759480 12:3077464-3077486 CGCCTCGCCGCCCGCCGCCCGGG - Intronic
1093547654 12:20368132-20368154 CGCGCAGCCCACCGCAGCCCCGG - Intergenic
1096102592 12:48978707-48978729 GGCCGCTCTGCCCGCAGCCCTGG + Exonic
1097041799 12:56160442-56160464 GGCCCTGCCCAGCCCAGCCCAGG + Intronic
1101409558 12:104457322-104457344 CGCCGCGCGGACCGGAGCCCGGG - Exonic
1103853256 12:123946963-123946985 AGCGCCGCCGCACGCAGCCCCGG - Intronic
1104950666 12:132438511-132438533 AGCCCCACCGTCCGCAGGCCTGG - Intergenic
1105011769 12:132761408-132761430 GGCCCCTCCGCCCCCGGCCCGGG + Intronic
1105327175 13:19381267-19381289 GGCCCTGCAGGCCCCAGCCCAGG + Intergenic
1105512097 13:21060534-21060556 GGCCTGGCCGCCCGCAGCCCGGG + Intronic
1105864473 13:24447078-24447100 GGCCCTGCAGGCCCCAGCCCAGG - Exonic
1108541472 13:51451603-51451625 GGCCCGGCCGCGCACAGCCCCGG - Intronic
1108648743 13:52455363-52455385 GGCCCCGGCAACTGCAGTCCAGG + Intergenic
1108688987 13:52846040-52846062 GGCTCCGCCGCCCGCCGCCCCGG + Exonic
1109284881 13:60397645-60397667 AGGCCCGCCGCCCGCCGCCCGGG - Intronic
1111672383 13:91347839-91347861 GGGCCGGCCGGCCGCACCCCCGG + Intergenic
1113200964 13:107867243-107867265 CGCCCCGCCGGAGGCAGCCCAGG - Intergenic
1113619453 13:111703053-111703075 GACAGCGCCGAGCGCAGCCCAGG + Intergenic
1113624982 13:111788314-111788336 GACAGCGCCGAGCGCAGCCCAGG + Intergenic
1114092513 14:19302382-19302404 GGCTTCGGGGACCGCAGCCCAGG + Intergenic
1114525599 14:23365555-23365577 GTCGCCGCAGACCCCAGCCCTGG - Exonic
1117920226 14:60721456-60721478 GGCCCCGCAGCCCAAAGCCCGGG - Intronic
1118653882 14:67926019-67926041 AGCCCCTCCTACCGCAGGCCAGG - Intronic
1119265744 14:73262533-73262555 GGCCCCGTCGTCCCCAGCCTGGG + Exonic
1119480633 14:74955658-74955680 GGCCCCGCCCACCGCAGACGAGG + Exonic
1120881292 14:89417001-89417023 CCCCCCGCCGCCCGCCGCCCCGG - Intronic
1120941523 14:89954736-89954758 GGCCACGCCCACCGCGGCTCAGG + Intronic
1121529328 14:94641417-94641439 GGCCCCCAGGACAGCAGCCCTGG + Intergenic
1122418192 14:101560395-101560417 TGCCTCGCCCAGCGCAGCCCCGG - Intergenic
1122504960 14:102226565-102226587 GGCCCCTCTGCCCTCAGCCCTGG + Intronic
1122647515 14:103205193-103205215 GGCCCAGAAGGCCGCAGCCCAGG + Intergenic
1122939039 14:104973071-104973093 GGCCCCACCTACCGGACCCCTGG + Intronic
1123021319 14:105399062-105399084 GCCCCTGCCGACCCCACCCCGGG - Intronic
1123030598 14:105449454-105449476 GGCGCTGCCGCCCCCAGCCCAGG - Intronic
1123505764 15:20940780-20940802 GCCCCCGCCGCGGGCAGCCCTGG - Intergenic
1123562998 15:21514486-21514508 GCCCCCGCCGCGGGCAGCCCTGG - Intergenic
1123599245 15:21951769-21951791 GCCCCCGCCGCGGGCAGCCCTGG - Intergenic
1124972028 15:34496801-34496823 GGCCCAGGCATCCGCAGCCCAGG - Intergenic
1125505495 15:40265553-40265575 GGCCCAGCCGACCACACCCCTGG + Intronic
1126436714 15:48645117-48645139 GCCCCCGGCGGCAGCAGCCCCGG + Intronic
1127877394 15:63122497-63122519 GGCCCCGCCCACCTCGTCCCAGG - Intronic
1131832317 15:96361545-96361567 GGTCCCGGCGGCGGCAGCCCGGG + Intergenic
1202971350 15_KI270727v1_random:241621-241643 GCCCCCGCCGCGGGCAGCCCTGG - Intergenic
1132502588 16:291142-291164 GGTCCTGCCCACCCCAGCCCTGG - Intronic
1132527750 16:426015-426037 GGCCCCGCCGGCCTCGCCCCCGG + Exonic
1132579064 16:676899-676921 GGGCCCCCCGGCCGCTGCCCCGG + Intronic
1132581158 16:685238-685260 GGCCCCGCCCACCACACACCTGG + Exonic
1132593591 16:737783-737805 TGCCCCGCCCACCGGAGGCCAGG - Intronic
1132768374 16:1546702-1546724 GGCCCTCCCGCCCGCAGCTCTGG + Intronic
1132873078 16:2124205-2124227 GGCCCTGCTGCCCACAGCCCTGG - Intronic
1134134083 16:11668419-11668441 GGCCCCGCCCGCCGCAGCGCGGG + Exonic
1134552167 16:15143386-15143408 GGCCCTGCTGCCCACAGCCCTGG - Intergenic
1136683656 16:31981959-31981981 GCCCCCGCCGCCGCCAGCCCGGG - Intergenic
1138014021 16:53412843-53412865 AGCCCAGCGGAGCGCAGCCCAGG - Intergenic
1138179234 16:54931050-54931072 GGCGCCGCGGGCCGGAGCCCCGG + Exonic
1138201408 16:55091408-55091430 GGACCCGCCTCCCTCAGCCCTGG - Intergenic
1138688758 16:58748932-58748954 GGCCACTCCGAGCGCAGCGCGGG - Intergenic
1139528362 16:67529750-67529772 GGCCCCGCAGACTGCAGCCAGGG - Exonic
1139650851 16:68361397-68361419 GTCCCAGCCCACCCCAGCCCCGG - Intronic
1140442557 16:74999045-74999067 AGCGCCGGCGAGCGCAGCCCGGG + Exonic
1141477589 16:84284150-84284172 GGCCACGCTGACCAGAGCCCAGG + Intergenic
1142374657 16:89700873-89700895 GGCCCCGCGACCCGCAGGCCAGG + Intronic
1142377032 16:89711697-89711719 TGCCCCGCCCCACGCAGCCCTGG + Intronic
1143620783 17:8079370-8079392 GGCAGCGCCGCCTGCAGCCCAGG + Intronic
1143775395 17:9195655-9195677 GTCCCCTCCCACCACAGCCCAGG - Intronic
1143780358 17:9225892-9225914 GGCCCGGCTGCCAGCAGCCCCGG + Intronic
1143904450 17:10198156-10198178 CGCACCGAGGACCGCAGCCCCGG + Intronic
1144519676 17:15945391-15945413 GGCCACGTCGGCCGCAGCCAGGG - Exonic
1144737239 17:17561957-17561979 GGCCCCTCCCACCGGAGCCTGGG - Intronic
1144782141 17:17813676-17813698 GGCCCCGGCCCCAGCAGCCCAGG - Exonic
1144789417 17:17849156-17849178 GGTCCCGCCCTCTGCAGCCCAGG - Intronic
1146398803 17:32487929-32487951 GGCCCAGCCGCCTGCACCCCCGG + Exonic
1146492553 17:33292800-33292822 GTCTCTGCCGAGCGCAGCCCAGG - Exonic
1146896468 17:36545262-36545284 TTCCCCGCCGCCCGCCGCCCGGG - Intronic
1147159535 17:38562213-38562235 GGCAGCCCCGACGGCAGCCCGGG + Exonic
1147617160 17:41836276-41836298 GGCCCCACCAACCCCCGCCCGGG - Intronic
1147786203 17:42980482-42980504 GGCCCCGCCCACCACTCCCCTGG + Exonic
1147924450 17:43938161-43938183 TGCCGCGCTGACCACAGCCCCGG + Intergenic
1152432094 17:80254137-80254159 AGCCCCGCAGCCAGCAGCCCTGG - Intergenic
1152785433 17:82245601-82245623 GGCACGGCCGACCGCAGACAAGG + Intronic
1152834586 17:82520552-82520574 CGCGCAGCCGCCCGCAGCCCCGG - Intronic
1152866493 17:82726746-82726768 GTCCCCACCGCCCCCAGCCCAGG - Intronic
1153285693 18:3452287-3452309 GGCCCCGCCGGCCGCATCGGTGG + Exonic
1154241506 18:12657768-12657790 GGCCGCGCCGCCGGCTGCCCCGG + Exonic
1156350572 18:36298089-36298111 GGCCGCGCCCAGCCCAGCCCAGG - Intronic
1159045615 18:63366804-63366826 GGACCCGCCCTCCGCAGCCTCGG - Intronic
1159102358 18:63970644-63970666 GGCCCCGCCACCCGCACTCCCGG - Intronic
1160155620 18:76431954-76431976 GGCCCCGCCCACCACTGCCCTGG + Intronic
1160568009 18:79798724-79798746 TTGCCCGCCGAGCGCAGCCCGGG + Intergenic
1160736081 19:663012-663034 GACCCTGCCGCCCGCCGCCCCGG + Intronic
1160961987 19:1726118-1726140 GGACCCCCTGACCGCCGCCCCGG + Intergenic
1161057871 19:2199733-2199755 GGCCCCACCGGCTGCAGCCCTGG - Intronic
1161114550 19:2489270-2489292 GGCCCGGCCGCCCGCCGCCAGGG - Intergenic
1161124130 19:2546426-2546448 GGCCCTCCCGCCCGCAGCCCTGG - Intronic
1161124205 19:2546787-2546809 GCCCCCGCCGACCCCACCGCCGG - Intronic
1161333769 19:3700258-3700280 AGCCCAGCGGGCCGCAGCCCCGG + Intronic
1161394569 19:4038281-4038303 CGCCCCACCGCCCGCCGCCCGGG - Exonic
1161736431 19:5994893-5994915 GGCCCAGACGCCCGCAGCCTGGG - Exonic
1161849292 19:6730585-6730607 GGCCCCGCCCCCAGCAGCCCTGG + Intronic
1161864269 19:6822146-6822168 GTCCCCGCAGACCCCAGCGCAGG - Intronic
1161973327 19:7595973-7595995 GGACCCGGCGCCCGCAGCCCCGG + Exonic
1162823886 19:13239178-13239200 AGCCCCGCCCTCCCCAGCCCCGG + Intronic
1163563645 19:18036413-18036435 GGCCCCTCTGAGCTCAGCCCCGG + Intergenic
1163906098 19:20150754-20150776 GGCGCCGGCGAGCGCCGCCCGGG - Intergenic
1164644065 19:29845097-29845119 CGGCCCGCCCACCGCCGCCCTGG - Intergenic
1164952088 19:32345529-32345551 GGCCCCGCCTACCGGCGTCCCGG - Intergenic
1165349752 19:35269211-35269233 GGCCCCGCGGCCTGCAGGCCGGG + Intronic
1165419501 19:35715953-35715975 GGCCCCGCACAGCTCAGCCCTGG + Exonic
1165850861 19:38849706-38849728 GCCGCCGCCGCCCGCCGCCCCGG + Exonic
1166121631 19:40690497-40690519 GCCCCCGCCTCCCGCGGCCCTGG + Exonic
1166832159 19:45645361-45645383 GGCCCCCCCGGTCCCAGCCCGGG + Exonic
1166882976 19:45940282-45940304 GCCCCCGCCTCCCGGAGCCCTGG - Exonic
1168443676 19:56393473-56393495 GGCCGCGCCCCCGGCAGCCCAGG + Exonic
925258200 2:2507584-2507606 GGCTCGGCAGACCGCAGACCTGG + Intergenic
926117499 2:10222641-10222663 AGCCCTGCTGACCCCAGCCCTGG - Intergenic
932570631 2:72936560-72936582 CGCCCCGCCCCCCGCAGGCCTGG - Intergenic
934797296 2:97112863-97112885 GGCGCGGCCGGCCGCAGCTCCGG + Intergenic
934836109 2:97590576-97590598 GGCGCGGCCGGCCGCAGCTCCGG - Intergenic
937919703 2:127120544-127120566 GGCGCCGGCGAGCGCCGCCCGGG - Intergenic
938296458 2:130182304-130182326 GGCGCCGCCGACCCCGGCCCAGG - Exonic
938365068 2:130727762-130727784 GGCCACGCCCACCACAGCCCCGG - Intergenic
938365076 2:130727784-130727806 GACCACGCCCGCCGCAGCCCGGG - Intergenic
938365099 2:130727852-130727874 GACCACGTCCACCGCAGCCCAGG - Intergenic
938460293 2:131492333-131492355 GGCGCCGCCGACCCCGGCCCAGG + Exonic
942451028 2:176107999-176108021 GCCCCCGCCGCCACCAGCCCCGG - Exonic
944159606 2:196644421-196644443 GGCTCCACCAACTGCAGCCCTGG + Intronic
944431088 2:199634243-199634265 GCCCCCGCCAACCCCGGCCCAGG - Intergenic
945879618 2:215312221-215312243 GGTCCCGCCGGCCGCCGCCAAGG - Intronic
946247574 2:218396358-218396380 GGTCCCTCAGACCCCAGCCCAGG + Exonic
946351854 2:219160566-219160588 GGCCCCGCCCACCCCTCCCCCGG + Intronic
946354605 2:219176977-219176999 GGCCCCGCCTTCCGCCGCCGGGG - Intronic
947399114 2:229714572-229714594 GGCCCCGCCCGCCGTTGCCCGGG - Intergenic
947591711 2:231389704-231389726 GCCCCTGCCGACAGCAGCCTAGG + Intergenic
948661436 2:239508937-239508959 GCCCCTGCCCACCTCAGCCCAGG - Intergenic
948762985 2:240204122-240204144 GGCCCTGCTGACCGGAGCTCAGG - Intergenic
949011066 2:241678888-241678910 GTCCCCGCCACCCACAGCCCAGG + Intronic
1168991945 20:2102854-2102876 CCCCCCGCCGCCCGCAGCCATGG + Exonic
1172245621 20:33443472-33443494 AGCCCCGCCGACGGCGACCCTGG - Exonic
1172841132 20:37903288-37903310 GGCCCCGGAGACCGCAGAACCGG - Exonic
1173800364 20:45891192-45891214 GGCCTCGCAGATCGTAGCCCGGG - Exonic
1173813110 20:45968325-45968347 GGCCCCGCCATCCTCAGCACTGG + Exonic
1175223774 20:57433135-57433157 GGCCCCGCCACACCCAGCCCTGG - Intergenic
1175258876 20:57662794-57662816 GGCCCAGCCCACATCAGCCCTGG + Intronic
1175821011 20:61908848-61908870 GGCCCAGCCACCTGCAGCCCTGG + Intronic
1176014860 20:62925963-62925985 GGCCACCCCGACCGCACCCAAGG + Intronic
1176162073 20:63653163-63653185 GGCGCCGCAGACCCCAGCCTCGG + Intronic
1176168202 20:63685538-63685560 GACCCCTCCGAGGGCAGCCCTGG + Exonic
1176549311 21:8214514-8214536 TCCCCCGCCGACCCCACCCCCGG - Intergenic
1176557204 21:8258737-8258759 TCCCCCGCCGACCCCACCCCCGG - Intergenic
1176568243 21:8397552-8397574 TCCCCCGCCGACCCCACCCCCGG - Intergenic
1176576146 21:8441772-8441794 TCCCCCGCCGACCCCACCCCCGG - Intergenic
1177045172 21:16160153-16160175 GGCTCCGCCCACCACATCCCTGG - Intergenic
1178882551 21:36460932-36460954 GACCCAGCCCACAGCAGCCCAGG + Exonic
1178992274 21:37366385-37366407 GCCCGCGCCGACTGCGGCCCGGG - Intronic
1179815479 21:43903520-43903542 AGCCCTGCCAGCCGCAGCCCTGG - Intronic
1179886859 21:44317945-44317967 GGCCACGGCAACCGCAGGCCTGG + Intronic
1180109924 21:45643039-45643061 CGCCCCGCCCACCACAGGCCTGG + Intergenic
1180488216 22:15820184-15820206 GGCTTCGGGGACCGCAGCCCAGG - Intergenic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1181031034 22:20149013-20149035 GGCTCCCCGCACCGCAGCCCTGG + Intronic
1181512292 22:23394389-23394411 GGCTCCCCGCACCGCAGCCCTGG - Intergenic
1181513396 22:23398772-23398794 AGCCCCGCCCAGCCCAGCCCAGG - Intergenic
1183370216 22:37427788-37427810 GGCCCCACGGACCCGAGCCCCGG + Intergenic
1183665571 22:39244125-39244147 GGCGCCGCCGCCCCCGGCCCCGG + Exonic
1183667405 22:39253721-39253743 GGCCCTGCCCACTGCAGTCCCGG - Intergenic
1183845094 22:40536394-40536416 GGCGCCGGCGAGCGCCGCCCGGG + Intronic
1183903524 22:41022799-41022821 GGCGCTCCCGACCGCAGCCCAGG - Intergenic
1184523850 22:45010022-45010044 GGCACCGCCCCCCGCCGCCCCGG - Intergenic
1184781762 22:46653224-46653246 GGCCGTGCCGCCCGCTGCCCCGG + Intronic
1184787707 22:46679902-46679924 CGCCCCGCCGCCGGCAGCCGTGG - Intergenic
1185086491 22:48743671-48743693 GGCCCCGCCGTGGGCAGCCGAGG + Intronic
1185271207 22:49929922-49929944 GGCCCTGCAGACCCCAGTCCTGG - Intergenic
1185296864 22:50058746-50058768 GGACCCGCAGCGCGCAGCCCGGG - Intergenic
1185342865 22:50299448-50299470 GGCCCCGCAGCCAGCAGCCAGGG + Intronic
1185384506 22:50525697-50525719 GGCCCCCGCCTCCGCAGCCCTGG + Intronic
1185420200 22:50730771-50730793 GGCCCCGCCGCCCGGGCCCCCGG - Intergenic
1203254196 22_KI270733v1_random:130830-130852 TCCCCCGCCGACCCCACCCCCGG - Intergenic
1203262252 22_KI270733v1_random:175909-175931 TCCCCCGCCGACCCCACCCCCGG - Intergenic
951323133 3:21271582-21271604 GGCAGCTCCGCCCGCAGCCCTGG - Intergenic
951551805 3:23882485-23882507 GGCAGCTCCGCCCGCAGCCCCGG - Intronic
953485052 3:43286862-43286884 GGTCCGGGCCACCGCAGCCCGGG - Intronic
953614484 3:44477756-44477778 AGCCCCGCCGCCCGCCGCACCGG - Intergenic
953931779 3:47009343-47009365 GGCCCCGCCCCCGGCAGGCCTGG + Exonic
954618604 3:51983293-51983315 GGCCGCGGCGGCCGCTGCCCGGG + Exonic
954733534 3:52685754-52685776 CGCTCCGCCGCCTGCAGCCCCGG + Exonic
954806540 3:53224119-53224141 GGCCCCGGCGCCTGCTGCCCAGG + Intergenic
956487825 3:69740303-69740325 GGACACGCCCACCGCTGCCCTGG - Intronic
959920109 3:111859939-111859961 GGCACTGCCGACCCCAGCCCGGG - Intronic
960939061 3:122921915-122921937 TGCGCCGCCTACCGCAGCCAGGG - Exonic
961380082 3:126491426-126491448 TGGCCAGCTGACCGCAGCCCGGG + Intronic
961447528 3:126987867-126987889 GGTCCCACCGAGAGCAGCCCAGG + Intergenic
961519271 3:127457231-127457253 AGCCCTGCCGGCCGCTGCCCTGG + Intergenic
961545238 3:127628950-127628972 GGCCCGGCCGCCCGCAGACCTGG - Intergenic
961646759 3:128396976-128396998 GGCCCCGCAGCCCACAGTCCTGG + Intronic
963827542 3:149971069-149971091 CGCCCGGCCGCCCGCAGCCGCGG + Exonic
964862988 3:161222029-161222051 GAATCCACCGACCGCAGCCCTGG + Exonic
966852074 3:184170611-184170633 GCCCCCGCCGCCCGCGGCCATGG + Exonic
968405534 4:336849-336871 GGCCCCGCCGCCCCCACCCCAGG - Intergenic
968612608 4:1563997-1564019 GGTCCCGGCGGCCCCAGCCCTGG + Intergenic
968658696 4:1789823-1789845 GGCCCGGCCCAGCCCAGCCCTGG - Intergenic
968854558 4:3109870-3109892 GGCCCCCCCGTCCCCAGCACTGG - Intronic
969220148 4:5753897-5753919 GGCCCAGCCGACTGCTGACCCGG + Exonic
969431360 4:7156694-7156716 GGTCCAGCCTACCACAGCCCTGG - Intergenic
970333285 4:15004658-15004680 CGCCCGGCCGCCCGCGGCCCCGG - Intronic
971451348 4:26804619-26804641 GACCCCACCGGGCGCAGCCCAGG + Intergenic
973045456 4:45530860-45530882 GGCAGCTCCGCCCGCAGCCCTGG + Intergenic
973613699 4:52659367-52659389 CGCGCCGCCGGCCGCGGCCCAGG - Intergenic
973619518 4:52712697-52712719 GGCACCGCCGCCCGCCCCCCGGG - Intergenic
981128399 4:141132617-141132639 GCCGCCGCCGCCCGCCGCCCCGG + Exonic
986403003 5:7396829-7396851 GGCACCGCTGCCCGCAGCGCTGG + Intronic
990955173 5:61332853-61332875 GTCGCCGCCGTCCGCCGCCCCGG - Exonic
993716556 5:91280651-91280673 GGCCTGGGCGGCCGCAGCCCGGG + Intergenic
994570370 5:101506436-101506458 GGCAGCTCCGCCCGCAGCCCTGG + Intergenic
1000052549 5:157575461-157575483 GCCCCCGCCGTCCCCAGCCTGGG - Intronic
1001129152 5:169049079-169049101 GGCCCTGCCTGCCGTAGCCCTGG - Intronic
1001557707 5:172647709-172647731 GCCCCCGCCCACCTCACCCCAGG + Intronic
1002058091 5:176610120-176610142 GGCGCCGCCGTCCCCAGCGCCGG + Exonic
1002306430 5:178286505-178286527 GGCCCCAGGGACAGCAGCCCCGG + Intronic
1002512747 5:179733355-179733377 GGCCCCGGCGCCCGCCGCCCCGG + Exonic
1002567233 5:180118952-180118974 AGCCCTGCAGACCTCAGCCCTGG - Intronic
1002926695 6:1609453-1609475 AGCCCCGCCGACGCCAGCGCTGG - Intergenic
1003112122 6:3259212-3259234 CGCCCCGCCGCCCGCACCCTCGG - Intronic
1003552136 6:7108878-7108900 GGTCACGCCGACCACCGCCCCGG + Intronic
1003623944 6:7726517-7726539 GGCCCCGCTCCCCGCTGCCCCGG + Intergenic
1003873877 6:10420669-10420691 AGTCCCGGCGACAGCAGCCCGGG - Intergenic
1005529621 6:26689776-26689798 GGACTCGCCACCCGCAGCCCTGG - Intergenic
1005541175 6:26811871-26811893 GGACTCGCCACCCGCAGCCCTGG + Intergenic
1006340314 6:33443174-33443196 GGCCTCGCTGACAGCAGCCTTGG + Exonic
1009011984 6:57853943-57853965 GGACTCGCCACCCGCAGCCCTGG + Intergenic
1011488373 6:87866683-87866705 CGCCCGGCCGACCGCAGGCAAGG + Intergenic
1017816425 6:158019570-158019592 GGCCTCGCCTAGGGCAGCCCTGG - Intronic
1018900842 6:168050997-168051019 GGCCCCCCCCACCCCATCCCGGG - Intergenic
1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG + Intronic
1019711486 7:2520024-2520046 GCCGCCGCCGCCCCCAGCCCGGG - Exonic
1019739359 7:2665042-2665064 CGCCCCGCCCACCCCATCCCTGG - Intergenic
1020262236 7:6536900-6536922 CCCCCCGCCCACCCCAGCCCCGG - Intronic
1020418280 7:7969680-7969702 GCCGCCGGCGGCCGCAGCCCCGG + Exonic
1022698005 7:32728674-32728696 GGCCCCCCGGCCCCCAGCCCTGG - Intergenic
1023822266 7:43986770-43986792 GGCCCTGGCGAGAGCAGCCCGGG + Intergenic
1023839423 7:44088072-44088094 GGCCCTGCCCACTGCTGCCCAGG - Intergenic
1026787099 7:73308632-73308654 GGCCCGTCCGACCCCACCCCGGG + Intronic
1026923732 7:74174528-74174550 GCCCCCGCCTCCCGCCGCCCCGG - Intronic
1026978466 7:74512981-74513003 GGCCCGGCCCTCCGGAGCCCTGG - Intronic
1027216233 7:76185672-76185694 TGCCAGGCCGACCGCAGGCCCGG + Intergenic
1028762496 7:94510452-94510474 GGCGCCCCCGACCCCAGCGCGGG - Intronic
1029750531 7:102540184-102540206 GGCCCTGGCGAGAGCAGCCCGGG + Intronic
1029768484 7:102639292-102639314 GGCCCTGGCGAGAGCAGCCCGGG + Intronic
1029849344 7:103446101-103446123 GGCTCCGCCCAGGGCAGCCCGGG - Exonic
1034885238 7:154793997-154794019 GGGACCGCCGACCCCAGCCCTGG - Intronic
1035689208 8:1548820-1548842 AGCCCCGCCGACAGCTGCCCCGG + Exonic
1038540344 8:28385860-28385882 CGCCCCGCCCGCCGCGGCCCCGG + Intronic
1038612809 8:29070560-29070582 GGCCTCGCTGACAGCTGCCCTGG - Exonic
1039949016 8:42153273-42153295 GTCCCCTCCGCCCGCAGCCGCGG - Intronic
1040059699 8:43093648-43093670 GGCCGCACCCCCCGCAGCCCCGG + Intronic
1045215651 8:100145903-100145925 CGCCCGGCCGCCCGCAGGCCTGG + Intergenic
1048234344 8:132675327-132675349 GGCCCTCCGCACCGCAGCCCCGG - Intronic
1049273318 8:141707601-141707623 GGCCCCGCCATCCGCAGACGGGG + Intergenic
1049550989 8:143259608-143259630 GGCCCCCCCGCCCCCAACCCTGG + Intronic
1049621074 8:143598566-143598588 GGCCCCGCCGCCCCCGGCCGAGG + Exonic
1049676230 8:143890507-143890529 GGCCCTGCCTCCTGCAGCCCCGG + Intergenic
1049689886 8:143953779-143953801 GGCACAGCCGCCCTCAGCCCCGG - Intronic
1049766987 8:144359459-144359481 GATCCCACTGACCGCAGCCCAGG - Intronic
1049796875 8:144501008-144501030 GGCCCCGCGGACGTCAGCCCCGG + Intronic
1054798739 9:69325812-69325834 GGCTCCCCCAACTGCAGCCCTGG - Intronic
1056186525 9:84140504-84140526 GCCCCAGCCGGCTGCAGCCCCGG + Intergenic
1057382011 9:94576888-94576910 TGCCCCCCCAACCCCAGCCCTGG - Intronic
1058861273 9:109119787-109119809 GACCCCGCGGACCGCGGCGCTGG - Exonic
1060208964 9:121699033-121699055 AGCCGCGCCGACCGCGGCCGAGG - Intronic
1061196669 9:129110580-129110602 GGACCCACCGACCCCAGCCGCGG - Exonic
1061583994 9:131554794-131554816 GGCGCCGCCGGCCGCCGCCTTGG - Intergenic
1061882897 9:133576924-133576946 GGCCCCGCCGGGCAGAGCCCTGG + Intergenic
1062084464 9:134641674-134641696 GGCCTCGCCGAGCCCAGCGCCGG + Intergenic
1062314782 9:135961283-135961305 GGCCCGGCCGACGGGAGCCGGGG - Exonic
1203772816 EBV:58114-58136 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772823 EBV:58129-58151 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772830 EBV:58144-58166 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772837 EBV:58159-58181 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772844 EBV:58174-58196 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203470597 Un_GL000220v1:113974-113996 TCCCCCGCCGACCCCACCCCCGG - Intergenic
1203478418 Un_GL000220v1:157946-157968 TCCCCCGCCGACCCCACCCCCGG - Intergenic
1187976708 X:24710095-24710117 GGCGCCGGCGAGCGCCGCCCGGG - Intronic
1188811429 X:34657344-34657366 GGCACCGCCTCCCGCAGCCCGGG - Intergenic
1189332327 X:40151786-40151808 GGCCCCGCCGATCGTGTCCCGGG + Intronic
1190246922 X:48696879-48696901 GGCCCCGGCGTCCGAGGCCCCGG + Intronic
1190385601 X:49879889-49879911 CGCGCCGCCGACCCCGGCCCCGG + Intergenic
1196404627 X:115348295-115348317 GGCGCCGGCGAGCGCCGCCCGGG - Intergenic
1198268419 X:135032264-135032286 GGCCCCGCCCACCCAAGCCTAGG + Intergenic
1198651075 X:138864498-138864520 GGCCCAGCCAACCGAAGTCCTGG + Intronic
1199772637 X:150984150-150984172 GGCCCCGGCGCCCGCGGCCCGGG + Intronic
1200118843 X:153781061-153781083 GGCCACGCAGCCCGCAGCTCCGG - Exonic
1202604637 Y:26628333-26628355 GGCCCTGCAGGCCCCAGCCCAGG - Intergenic