ID: 1019693493

View in Genome Browser
Species Human (GRCh38)
Location 7:2431529-2431551
Sequence CCTGGCATCCACAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019693493_1019693502 4 Left 1019693493 7:2431529-2431551 CCTTCCACCTTGTGGATGCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
Right 1019693502 7:2431556-2431578 GTCAAGGCTTAGCTCCCTGCTGG 0: 1
1: 0
2: 1
3: 11
4: 118
1019693493_1019693507 28 Left 1019693493 7:2431529-2431551 CCTTCCACCTTGTGGATGCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
Right 1019693507 7:2431580-2431602 CCACACTGACAGTACCCTGGTGG No data
1019693493_1019693505 25 Left 1019693493 7:2431529-2431551 CCTTCCACCTTGTGGATGCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
Right 1019693505 7:2431577-2431599 GGACCACACTGACAGTACCCTGG 0: 1
1: 0
2: 0
3: 10
4: 141
1019693493_1019693508 29 Left 1019693493 7:2431529-2431551 CCTTCCACCTTGTGGATGCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
Right 1019693508 7:2431581-2431603 CACACTGACAGTACCCTGGTGGG 0: 1
1: 0
2: 2
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019693493 Original CRISPR CCTGGCATCCACAAGGTGGA AGG (reversed) Intronic
903117182 1:21188020-21188042 CCTGGCATCAGCAAGGTCTAAGG - Intergenic
904033711 1:27548291-27548313 CCCGGCAGCCGCGAGGTGGACGG - Exonic
904822213 1:33253174-33253196 CCAGGCATCATGAAGGTGGATGG + Intergenic
904823739 1:33261405-33261427 CCAGGAATCCACAAGGTCAAAGG - Intronic
905709243 1:40086731-40086753 CCTGCCACCCACATGATGGAAGG - Intronic
913093431 1:115495235-115495257 CCTGGCACCGGCAAGGTTGAAGG + Intergenic
915626040 1:157114754-157114776 CCTGGCCTCCACCTGGAGGAAGG - Intergenic
917740098 1:177953500-177953522 CCTAGCATCCACAGGTTGGCAGG - Intronic
917947762 1:179993804-179993826 AATGGAATCCACCAGGTGGAGGG - Intronic
918758276 1:188366047-188366069 CTTAGCTTCCACTAGGTGGAAGG + Intergenic
921094263 1:211873674-211873696 CAAGGCTTCCACAATGTGGAAGG + Intergenic
921901317 1:220454140-220454162 CATAACATCCAAAAGGTGGAAGG - Intergenic
923036024 1:230285650-230285672 CATGGCATCAACAGGGTGAAGGG - Intergenic
924404607 1:243730078-243730100 GCTGGAATCCACAACCTGGAGGG + Intronic
1064277298 10:13917817-13917839 ACTGGCACTCACAAGGTGCATGG + Intronic
1064333111 10:14412429-14412451 TCTGGCATCCACCAGGAGGGCGG + Intronic
1067297397 10:44982623-44982645 CTGGGCATCCATGAGGTGGAGGG - Exonic
1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG + Intergenic
1071330045 10:84550032-84550054 CCTGGCATCCTCCAGATGGCTGG + Intergenic
1071336107 10:84601530-84601552 CCTTGCACCCTCAAGGTGGGGGG + Intergenic
1073464095 10:103683847-103683869 CTTGGGATCTGCAAGGTGGAAGG - Intronic
1074973728 10:118564669-118564691 CCTGGCATCCACACCGGGGCTGG - Intergenic
1075275157 10:121086449-121086471 CCTGGCCTCCCCAAGGTGTGGGG - Intergenic
1075786612 10:125054150-125054172 TCTGGCATCCACAGTGTAGATGG - Intronic
1076591851 10:131588899-131588921 CCTGGGAGGCACCAGGTGGATGG - Intergenic
1080971252 11:37279852-37279874 CCTGCCAGCCAGAAGGTGGATGG - Intergenic
1083749360 11:64752914-64752936 CCTCGCATCCACCTGGAGGAGGG - Intronic
1084274610 11:68044946-68044968 CCTGGCACCCAGATGGAGGAGGG + Exonic
1088853138 11:113721812-113721834 CCTGGTAGCCACATGGGGGATGG - Intergenic
1089240919 11:117078358-117078380 CGTGTCATGCACAAGGTGGGAGG + Intronic
1089833320 11:121348213-121348235 CCTAGCATCCTCAGGGTGGTAGG + Intergenic
1093211949 12:16318325-16318347 CCTCAGTTCCACAAGGTGGAAGG - Intergenic
1097178812 12:57159221-57159243 ACTGGCATCCACCAGATTGATGG - Intronic
1097178916 12:57159821-57159843 ACAGGCATCCACAATGTGGAGGG + Exonic
1097288024 12:57892580-57892602 CTTGGCACCCAGAAGGTGGGGGG + Intergenic
1100121981 12:91379152-91379174 CCTGGCATCCATGAGGTGAGAGG + Intergenic
1102004819 12:109582465-109582487 CCTGTCTTTCAAAAGGTGGAGGG + Intronic
1102298719 12:111756311-111756333 CCTGGCAGACACAGAGTGGAGGG - Exonic
1103058816 12:117842622-117842644 CCTGGCATCCACGAGGTGCTGGG - Intronic
1104287101 12:127433282-127433304 CCTGCCAACCACAAGGAGGCTGG + Intergenic
1106694884 13:32162706-32162728 ATTGGCAGCCAGAAGGTGGAAGG - Intronic
1107642097 13:42454002-42454024 CCTTGAATCCAGGAGGTGGAGGG - Intergenic
1109959963 13:69616918-69616940 TCTGGGATCCAAAAGTTGGAAGG - Intergenic
1111701812 13:91699310-91699332 CTTGGCTGCCACAAGGTGGAAGG + Intronic
1114302545 14:21391560-21391582 CCTGTCATCAATAAGGTGGATGG - Exonic
1114634062 14:24177650-24177672 CCTGGCATCTGCAAGGGGTAAGG + Intronic
1115405212 14:33007239-33007261 CCTGGATGCCACAAGGTGCAGGG + Intronic
1118320306 14:64748846-64748868 CCTGGCTGCCACCAGGTGGGAGG + Exonic
1118655314 14:67941086-67941108 CTTGGAATCCACAAGTAGGAGGG + Intronic
1118803999 14:69218613-69218635 CCTGGCATGGACAAGGTTTATGG + Intronic
1119294422 14:73521427-73521449 CCTGTCCACCACCAGGTGGATGG - Intronic
1119400558 14:74359570-74359592 CCTGGCATCCCCAAGGGAGAAGG + Exonic
1120394479 14:83952280-83952302 CCTGGCATCCCTCAGGTGGATGG - Intergenic
1120408587 14:84121040-84121062 CCTGAAGCCCACAAGGTGGAGGG + Intergenic
1121507517 14:94487877-94487899 CCTTTCATCCACCTGGTGGATGG + Intronic
1121699938 14:95944838-95944860 CCTGGCTCCCATAAGGTGGCTGG + Intergenic
1122278001 14:100605105-100605127 CCTGGTCTCCACAGGGAGGAGGG + Intergenic
1124896879 15:33785697-33785719 CCTGACATCCCCCAGCTGGAAGG + Exonic
1125598167 15:40900638-40900660 CCAGGCATCTACAAGCTGGCGGG - Exonic
1127492297 15:59476540-59476562 TGTGGGATCCACAAGGTGGGTGG + Intronic
1128092536 15:64928746-64928768 CTGGACATCCCCAAGGTGGAGGG + Intronic
1128150141 15:65357998-65358020 CCTAGAATCCTGAAGGTGGAGGG - Intronic
1128157459 15:65400920-65400942 CCTGGCGTCCACCAGGGGGCAGG - Exonic
1128323689 15:66709445-66709467 CCTGGGACTCAAAAGGTGGAAGG - Intronic
1128397219 15:67240390-67240412 GCTGGCATCGACCAGGAGGAGGG - Intronic
1130140419 15:81221581-81221603 CCTGGCATCGAGAGGGAGGAAGG - Intronic
1130989966 15:88870339-88870361 CCTGGGATCTCCCAGGTGGAGGG - Intronic
1132493558 16:248574-248596 CCTGGGAGCCACAAGATGAAAGG + Intronic
1133485907 16:6218200-6218222 CCTGGCATACTCAAGGAGAATGG - Intronic
1134003710 16:10803383-10803405 CCTCCCATCTACCAGGTGGAGGG + Intronic
1134394013 16:13845902-13845924 ACTGGCTTCCACAAGATGGAAGG - Intergenic
1138882410 16:61031607-61031629 CCTGGTAGCCACAAGGGGAATGG - Intergenic
1139315887 16:66068318-66068340 CCTTGCACCCCTAAGGTGGATGG + Intergenic
1140697780 16:77551926-77551948 CCAGGCAGCCACAAGTTGGAGGG + Intergenic
1142157681 16:88540035-88540057 CCTGGCACCTCCAAGGAGGAGGG - Intergenic
1144103180 17:11962044-11962066 CCTGTCAGCCACACAGTGGAGGG - Exonic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1148622322 17:49043875-49043897 CCTTGCATCCTCAAGGAGGAAGG - Intronic
1148887936 17:50787043-50787065 CCTGGGATCCAGACTGTGGAGGG - Intergenic
1150864983 17:68840153-68840175 CCAGTCTTACACAAGGTGGATGG - Intergenic
1151060406 17:71085420-71085442 TCTGGCAACCACAAGGGGGCAGG + Intergenic
1152239720 17:79155012-79155034 CCAGGCATCCAAAGGGTGGGTGG + Intronic
1154439394 18:14374234-14374256 GCAGGCATCCAAAGGGTGGAAGG - Intergenic
1155921176 18:31604239-31604261 CATAGCCTCCAAAAGGTGGATGG + Intergenic
1156029615 18:32696978-32697000 ACTTACATCCACAAGGCGGAAGG + Intronic
1158012160 18:52741478-52741500 ACTGGCATCCACCATGTAGAGGG - Intronic
1162797996 19:13096441-13096463 GCTGGAAGCCACAAGGTGGCTGG + Intronic
1163419589 19:17206567-17206589 CCTGGGCACCACAGGGTGGATGG + Intronic
1166384287 19:42371516-42371538 CCTGACCTCCACAAGGTGTAGGG - Intronic
1166624908 19:44342730-44342752 GCTGGAATCCAGGAGGTGGAGGG + Intronic
1168157230 19:54481520-54481542 CCTCGCAGCCCCAAGGTGGGTGG + Intergenic
925916061 2:8607287-8607309 CTTGGCATCTGCAAGGTGGGAGG - Intergenic
927520368 2:23694746-23694768 TCTGCCAGGCACAAGGTGGATGG - Intronic
931084055 2:58809252-58809274 CATGGCATCACCCAGGTGGAAGG + Intergenic
931108326 2:59082401-59082423 CCTGGAATCCACCAGGGAGATGG + Intergenic
932191178 2:69742314-69742336 CCGGGCGGCCACAGGGTGGAGGG + Intronic
933159596 2:79009296-79009318 CCTGGCATCTAATAGGTAGATGG + Intergenic
933870099 2:86557708-86557730 AGTGGCATTCACCAGGTGGACGG - Intronic
935130541 2:100257933-100257955 CCTGGCATCTGGAAGGTGGAGGG - Intergenic
936228573 2:110679997-110680019 CCTGGCATCAAGAAGGGGAAAGG - Intergenic
937230233 2:120394209-120394231 CCTGGCATCTGAAAGCTGGAAGG + Intergenic
938970040 2:136423616-136423638 CCTGGTGTCCACAAGGTGGCAGG + Intergenic
944194132 2:197034714-197034736 CCTGGCAAACACATGGTGGTTGG - Intronic
947914572 2:233823025-233823047 CCTGGCTCCCACAGGGTGGCAGG + Intronic
948318921 2:237053500-237053522 CCTGGGATCCAGAGGGTGGATGG - Intergenic
948586274 2:239021807-239021829 CCAGGCATCCACCAGCGGGAAGG + Intergenic
948981260 2:241496083-241496105 CCCGGGAGCCACCAGGTGGAGGG + Intronic
1169016682 20:2298306-2298328 CCTGGCATCCCCAGAGTGGGTGG + Intronic
1169408626 20:5348148-5348170 CTTGGCATCCACATTTTGGAAGG - Intergenic
1170353646 20:15469472-15469494 CCTGGGATCCACAAAGATGATGG + Intronic
1170931053 20:20769625-20769647 CAAGGCTTCCAAAAGGTGGAAGG - Intergenic
1176139418 20:63538409-63538431 ACTGGCAGCCACAAGGGGGCAGG + Intergenic
1176456288 21:6915174-6915196 GCAGGCATCCAAAGGGTGGAAGG + Intergenic
1176834462 21:13780234-13780256 GCAGGCATCCAAAGGGTGGAAGG + Intergenic
1177631673 21:23736469-23736491 CATGACAAGCACAAGGTGGAGGG + Intergenic
1178259203 21:31083332-31083354 CAAAGCTTCCACAAGGTGGAAGG + Intergenic
1179626521 21:42652622-42652644 CCTGGTCTCCACCTGGTGGACGG - Intergenic
1180025846 21:45161615-45161637 CCTGCCATCCACAGTGTGCATGG - Intronic
1180158907 21:45990393-45990415 CGTGGCATCGACGGGGTGGACGG + Exonic
1183583523 22:38739263-38739285 CCTGGCATCTACCAGGTTGGTGG - Intronic
1184041227 22:41945262-41945284 GCTGGCATCCACATGGCGCAGGG + Exonic
1184165888 22:42727502-42727524 GCTGGCAGTCACAGGGTGGAGGG - Intergenic
1184838342 22:47037216-47037238 CCTGGCACCCCCATGGCGGAGGG - Intronic
1185075640 22:48680654-48680676 CCTGGCATGCACAAGGGGCCTGG - Intronic
952526011 3:34211318-34211340 TCTGCCCTCCACAAGGAGGAAGG - Intergenic
953044144 3:39280592-39280614 CCGAGCATCTACAAGGTGCAAGG - Intronic
953574453 3:44101828-44101850 CCTGCCTTCCACTTGGTGGAGGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955907794 3:63825963-63825985 GATGGCTTACACAAGGTGGAGGG + Intronic
956206500 3:66760364-66760386 ACTGGCATCCAATGGGTGGAGGG + Intergenic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
961908190 3:130284565-130284587 GATGTCATCCACCAGGTGGAGGG - Intergenic
962200391 3:133396551-133396573 CCTGCCATCCACAACTTGGATGG - Exonic
962848528 3:139290607-139290629 CCTGGCAGCGGCAGGGTGGAGGG - Intronic
963154767 3:142084659-142084681 CCTGTCATTCACAATATGGAAGG + Intronic
964612036 3:158625162-158625184 CCTGCCATGAGCAAGGTGGAGGG + Intergenic
966959158 3:184916082-184916104 CCTGGCATACAAAACATGGAAGG + Intronic
968643750 4:1728316-1728338 CCTGCCAGCCACCAGGTGGTTGG - Exonic
969210597 4:5684349-5684371 CCTCGCAGCCTCAGGGTGGAAGG + Intronic
969429634 4:7146586-7146608 CCTGGCCACCTCAAGGAGGAGGG + Intergenic
973817864 4:54634638-54634660 CCTGGCATACCCATGCTGGATGG + Intergenic
975652195 4:76604603-76604625 CATGGCATCCTTCAGGTGGACGG - Intronic
976274413 4:83261531-83261553 ACTGGCACCCAGAGGGTGGAGGG + Intronic
976471470 4:85434150-85434172 GCTGGCATCTAGAAGCTGGAAGG - Intergenic
976663943 4:87570437-87570459 CCTGGCATCCTGAAGTTGTAAGG - Intergenic
976878207 4:89883845-89883867 ACTTGCATCTACAAGGTGTATGG + Intronic
977380347 4:96265237-96265259 CATGGCATTAACAAGATGGAAGG - Intergenic
977667685 4:99659606-99659628 CCTGCCCTCCACAATGGGGAGGG - Intergenic
977681321 4:99801555-99801577 CCTGAATTCCAAAAGGTGGAGGG + Intergenic
977762439 4:100755617-100755639 CCAGTCATTCACAAGATGGATGG + Intronic
979027153 4:115592159-115592181 CTTTGCATCCACAAGGAGGAGGG + Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
982446559 4:155497495-155497517 CCTTGTGTCCACATGGTGGAAGG + Intergenic
984216983 4:176926006-176926028 TCTGGCATCCTAAAGGAGGAAGG - Intergenic
985478266 5:91906-91928 CGTGGCATCCACAAAATGGCAGG + Intergenic
986021456 5:3807879-3807901 TCTGGTGTCCACAAGGTTGAGGG + Intergenic
988201095 5:28069357-28069379 ACTGGTATCCCCAAGGAGGAAGG + Intergenic
988691594 5:33577872-33577894 CATGGCATACAGAATGTGGAGGG - Intronic
989069526 5:37496264-37496286 CAAAGCTTCCACAAGGTGGAAGG - Intronic
991585006 5:68193114-68193136 CCTGCCATCCACATGAAGGAGGG + Intronic
994529756 5:100954499-100954521 CCTGTCATTCACAATGTGGATGG + Intergenic
995769823 5:115656601-115656623 CCTGGGATCCACACAGTAGAGGG - Intergenic
996010529 5:118477562-118477584 CCTTGCAAGCCCAAGGTGGATGG + Intergenic
996665807 5:126058813-126058835 CATAGCTTCCACAGGGTGGAAGG - Intergenic
998833419 5:146182567-146182589 CCTGGCATCCCCGAGAGGGAGGG - Exonic
999582734 5:153057723-153057745 CGTGTGATCCAGAAGGTGGAAGG + Intergenic
1000484960 5:161830071-161830093 CCTGGCATCAATATGGAGGATGG - Intergenic
1001808975 5:174612459-174612481 CCTGGCATACACTAAGTGGAAGG + Intergenic
1001858924 5:175036321-175036343 CCTTGAAGCCACAAGGTGGCAGG + Intergenic
1001997574 5:176174545-176174567 CCTGGCATCAAGAAGGGGAAAGG - Intergenic
1002599445 5:180345990-180346012 CCTGGGATCCTCATGGTGCATGG - Intronic
1002924825 6:1599284-1599306 ACTGGCATCCAGAACTTGGAGGG - Intergenic
1011495533 6:87933597-87933619 CCTGGCATCCAGGATGTGGAGGG + Intergenic
1014156039 6:118110864-118110886 CTTGCCTTCCACAAGGGGGAAGG - Intronic
1016629689 6:146213946-146213968 CCTGGAGTCCAAAAGCTGGAGGG + Intronic
1018935811 6:168273516-168273538 CCTGGCTTCCAGGAGGAGGAAGG + Intergenic
1019019149 6:168902907-168902929 CCTGCCATCCACATTGTGGAAGG - Intergenic
1019182926 6:170203125-170203147 CCTGGTCTGCACAAGCTGGAAGG + Intergenic
1019545039 7:1570074-1570096 CCTGACTTCCGGAAGGTGGACGG - Intronic
1019693493 7:2431529-2431551 CCTGGCATCCACAAGGTGGAAGG - Intronic
1022099017 7:27158126-27158148 CCAGGAATACAAAAGGTGGAGGG + Intergenic
1023345895 7:39270929-39270951 CCTAGAATCCTCAAGGCGGAAGG - Intronic
1024482286 7:49876345-49876367 CTTGTCAACCACAAAGTGGAAGG - Intronic
1025873972 7:65462659-65462681 CCAGGCATCCACCAGTGGGAAGG - Intergenic
1027332867 7:77117779-77117801 ACTGGCATCTAAAAGGTAGAGGG + Intergenic
1029509050 7:100981828-100981850 CCTGGAAGCCACAAGGAGAAGGG - Intronic
1032360781 7:131252798-131252820 CTTGGCATGCACAAGGGGGATGG + Intronic
1037745642 8:21642057-21642079 CCTGACATCCAAAGGATGGAGGG - Intergenic
1037781409 8:21871731-21871753 CCTGGCAGCCACCCGGTGCAGGG - Intergenic
1038250516 8:25899852-25899874 ACTGGCGTCCACAGGGTGGTTGG - Intronic
1045403578 8:101842850-101842872 CCTGGGATACACATGGTTGATGG - Intronic
1045611453 8:103847656-103847678 ACTGGCCTTTACAAGGTGGAAGG + Intronic
1046228553 8:111320764-111320786 CCTGGCATCAACAAAGTTTAGGG - Intergenic
1050150196 9:2612279-2612301 CAGGGCATCTACAAGGAGGATGG - Intergenic
1056756618 9:89385788-89385810 CCTGGATCCCACAAGGTGGTTGG + Intronic
1059447575 9:114348417-114348439 CTGAGCATCCACAAGGTGCAGGG - Intronic
1060206056 9:121683404-121683426 CCAGCCATCCTCAAGGTTGATGG - Intronic
1062131346 9:134895290-134895312 CCTAGCAGCCACATGGTGGGTGG + Intergenic
1189798113 X:44665227-44665249 GCTGGAATCCAAGAGGTGGAGGG - Intergenic
1193758064 X:85432961-85432983 TAAGGCATCCACAGGGTGGAAGG - Intergenic
1196833006 X:119791188-119791210 CGTGGCATGCGCAACGTGGAGGG - Intronic
1197258337 X:124288519-124288541 CCTGTCATTCACAATGTGGATGG - Intronic
1199972788 X:152873005-152873027 ACTGGAATCCACGAGGAGGAGGG + Intergenic