ID: 1019694414

View in Genome Browser
Species Human (GRCh38)
Location 7:2437172-2437194
Sequence GTGTGGACACAGCTGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 507}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019694414_1019694418 5 Left 1019694414 7:2437172-2437194 CCATCCTCCAGCTGTGTCCACAC 0: 1
1: 0
2: 5
3: 55
4: 507
Right 1019694418 7:2437200-2437222 GCACAGTCATGAGAATGACTTGG 0: 1
1: 0
2: 1
3: 14
4: 245
1019694414_1019694424 20 Left 1019694414 7:2437172-2437194 CCATCCTCCAGCTGTGTCCACAC 0: 1
1: 0
2: 5
3: 55
4: 507
Right 1019694424 7:2437215-2437237 TGACTTGGTTGGGTGCGGGGTGG 0: 1
1: 0
2: 1
3: 22
4: 250
1019694414_1019694421 15 Left 1019694414 7:2437172-2437194 CCATCCTCCAGCTGTGTCCACAC 0: 1
1: 0
2: 5
3: 55
4: 507
Right 1019694421 7:2437210-2437232 GAGAATGACTTGGTTGGGTGCGG 0: 1
1: 2
2: 6
3: 32
4: 377
1019694414_1019694422 16 Left 1019694414 7:2437172-2437194 CCATCCTCCAGCTGTGTCCACAC 0: 1
1: 0
2: 5
3: 55
4: 507
Right 1019694422 7:2437211-2437233 AGAATGACTTGGTTGGGTGCGGG 0: 1
1: 0
2: 1
3: 17
4: 162
1019694414_1019694423 17 Left 1019694414 7:2437172-2437194 CCATCCTCCAGCTGTGTCCACAC 0: 1
1: 0
2: 5
3: 55
4: 507
Right 1019694423 7:2437212-2437234 GAATGACTTGGTTGGGTGCGGGG 0: 1
1: 0
2: 1
3: 11
4: 89
1019694414_1019694420 10 Left 1019694414 7:2437172-2437194 CCATCCTCCAGCTGTGTCCACAC 0: 1
1: 0
2: 5
3: 55
4: 507
Right 1019694420 7:2437205-2437227 GTCATGAGAATGACTTGGTTGGG 0: 1
1: 0
2: 0
3: 16
4: 217
1019694414_1019694419 9 Left 1019694414 7:2437172-2437194 CCATCCTCCAGCTGTGTCCACAC 0: 1
1: 0
2: 5
3: 55
4: 507
Right 1019694419 7:2437204-2437226 AGTCATGAGAATGACTTGGTTGG 0: 1
1: 0
2: 3
3: 24
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019694414 Original CRISPR GTGTGGACACAGCTGGAGGA TGG (reversed) Intergenic
900180764 1:1310008-1310030 GGGAGGGCACAGCTGGAGGCTGG - Intronic
900206439 1:1433766-1433788 GGGTGGAGACAGCGGGGGGAGGG + Intergenic
900456578 1:2777833-2777855 CCCTGGACACAGCGGGAGGAGGG + Intronic
901434842 1:9241018-9241040 GTCTGGAAGCAGCAGGAGGAAGG - Intronic
901636082 1:10670814-10670836 GAGGGGTCACAGCTGAAGGATGG - Intronic
902745278 1:18469747-18469769 GGCTGGAGAGAGCTGGAGGAGGG - Intergenic
903499949 1:23795280-23795302 GTGGGGAAACAGCTGAGGGAAGG - Exonic
903553159 1:24172862-24172884 GTGAGGACACAGCAAGATGACGG - Intronic
903610211 1:24605917-24605939 ATGTGGACACAGTTGGGGTAGGG - Exonic
903862026 1:26370418-26370440 GTGTGGCCTCAGGTGGAAGATGG - Intronic
904991087 1:34593293-34593315 GTGTAGACACAGCTGCCTGAGGG - Intergenic
905771202 1:40639099-40639121 GTACGGACACACCAGGAGGAAGG + Intronic
905824102 1:41016282-41016304 GTTTGGCCCCAGGTGGAGGACGG - Intronic
906074965 1:43045403-43045425 GTGTGGAAACAGATGGGGTATGG + Intergenic
906508756 1:46398850-46398872 AGGAGGACACAGCTGGATGAAGG + Intronic
906726652 1:48049138-48049160 GGGTGGAGGCAGCTGGAGGTTGG - Intergenic
909902963 1:81160868-81160890 ATGTGGCCACTGCTGGGGGATGG - Intergenic
911575809 1:99576762-99576784 GTATGGAAACAGCTAGGGGAAGG - Intergenic
915590251 1:156866569-156866591 CTGAGGCCACAGCTGGGGGAAGG - Intronic
915748943 1:158186665-158186687 GGAGGGACACAGCAGGAGGAAGG + Intergenic
917141157 1:171837569-171837591 GTGAGGACACAGCAGGAAGGTGG - Intergenic
917271019 1:173274517-173274539 GTGTGTACACAGTGGGAAGAGGG - Intergenic
917706772 1:177642587-177642609 TTGTGGACAGAGCTGGTGTAAGG + Intergenic
918715237 1:187778348-187778370 GTGTGTAGACATCTAGAGGAAGG + Intergenic
920396131 1:205647495-205647517 GTGAGGACACAGCGAGAAGATGG - Intergenic
920590742 1:207216264-207216286 GTGGGGACAGATCTTGAGGAGGG + Intergenic
920771753 1:208892992-208893014 GAGGGGTTACAGCTGGAGGACGG + Intergenic
921285934 1:213609436-213609458 GTGTGGACAAAGCTGGTACATGG - Intergenic
922514178 1:226194677-226194699 GTGAGGACTCAGCCAGAGGATGG - Intergenic
922990889 1:229910175-229910197 GTGTGGAAACAGCAAGAAGAAGG + Intergenic
923103430 1:230835890-230835912 GTAAGGACACAGCAGGAAGAGGG + Intergenic
923306973 1:232697341-232697363 GTGTGTCCACAGCTGAAGTACGG + Intergenic
923772400 1:236948939-236948961 GAGTGGACACAGTTGGATGGAGG - Intergenic
924119249 1:240779506-240779528 GTGAGGACACAGTAGGAAGATGG + Intronic
924608337 1:245553923-245553945 GTGGGGACACTGCTGGGAGAGGG + Intronic
924808174 1:247378358-247378380 GTGAGGACACAGCAAGAGGGTGG + Intergenic
1062886588 10:1021138-1021160 GTGTGTGCACATCTGCAGGAAGG - Intronic
1063252795 10:4292524-4292546 GTGAGGACACAGCTAGAAGGTGG - Intergenic
1063448184 10:6133479-6133501 GTGAGGAAACAGGTGGAGGAAGG + Intergenic
1063559128 10:7110204-7110226 GTGAGGACACAGGTAGAAGATGG - Intergenic
1063958647 10:11287971-11287993 ATGTGGCAGCAGCTGGAGGAAGG - Intronic
1064428817 10:15254148-15254170 GGGTGGACACAGATGGCAGAGGG + Intronic
1067302973 10:45031342-45031364 GTGGGGGCACAGCTGGGGGGTGG - Intergenic
1067452383 10:46390299-46390321 GTGAGGGTACAGCAGGAGGAAGG - Intronic
1067584851 10:47469456-47469478 GTGAGGGTACAGCAGGAGGAAGG + Intronic
1069095516 10:64254515-64254537 GTGTGGACAGAGCAGGCTGAGGG + Intergenic
1070714281 10:78707927-78707949 GTGTGCATACAGAAGGAGGAAGG - Intergenic
1070780311 10:79133740-79133762 GTCTGGGCACTGCTGGAGGAGGG - Intronic
1071457272 10:85860529-85860551 GTGAGGAGAGAGCTGGAAGAGGG + Intronic
1071873073 10:89816172-89816194 GTGAGGACACAGCCTCAGGAAGG + Intergenic
1071884133 10:89931018-89931040 GTGAGGACACAGCAAGAAGATGG + Intergenic
1072690489 10:97569722-97569744 GTGAGGACACAGCAAGAAGACGG - Intronic
1074532224 10:114305549-114305571 GAGGGGACACAGATGCAGGAGGG + Intronic
1074532324 10:114305906-114305928 GAGGGGACACAGGTGCAGGAGGG + Intronic
1074935798 10:118180356-118180378 GTGGGGACACAGCTAGAATATGG - Intergenic
1075290374 10:121224855-121224877 GGGTGGACACAGTTGGAGGCAGG - Intergenic
1075592419 10:123702589-123702611 GGGTGGGCAGAGCTGGAGAATGG + Intergenic
1075719734 10:124577651-124577673 GTGTGCACACATGTGTAGGATGG - Intronic
1076019172 10:127056433-127056455 GGGAGGCCACAGCAGGAGGATGG - Intronic
1076657360 10:132033603-132033625 GCGTGGAAACAGATGGATGATGG + Intergenic
1076732421 10:132445338-132445360 GGGTGGTCACGGCTTGAGGATGG + Intronic
1076788224 10:132762034-132762056 GAGTAGACACAGCTGGAGAAGGG + Intronic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078102843 11:8339870-8339892 GTGAGGACTCACCTGGTGGAGGG - Intergenic
1078665182 11:13318720-13318742 CTGTGGCCACATCTGGAGGGTGG + Intronic
1079119639 11:17672642-17672664 GTGTGCAGACAGCTGTAGTACGG - Intergenic
1079242944 11:18733476-18733498 GTAGGGACAAGGCTGGAGGATGG + Intronic
1082225571 11:49702879-49702901 GTGTTGCCAGAGTTGGAGGAGGG + Intergenic
1082877589 11:58003571-58003593 GGGTGGACAGAGCAGGGGGAAGG + Intergenic
1083610763 11:64003116-64003138 TTCTGGCCACAGGTGGAGGAAGG - Intronic
1083826688 11:65207983-65208005 GTGTGGAGGCAGCTGGAGGGAGG - Intronic
1083903391 11:65654764-65654786 GTGGGGCCACAGCCTGAGGAGGG + Exonic
1084147538 11:67273063-67273085 GGGTGGACACGGCAGAAGGAGGG - Intronic
1084432970 11:69121822-69121844 GAGTGGAGGCAGCTGGCGGAGGG + Intergenic
1084559353 11:69894052-69894074 GGGTGGTCACAGCAGGTGGAGGG - Intergenic
1085151276 11:74254449-74254471 GTGTCGAGGCAGCTGGAAGAAGG - Exonic
1086203570 11:84232643-84232665 GTGAGGACACAGCAGAAGGATGG + Intronic
1086549554 11:88040286-88040308 GTGAGGACACAGGGAGAGGACGG - Intergenic
1087210720 11:95444060-95444082 GTGAGGACATAGCTAGAGGGGGG - Intergenic
1088839446 11:113611598-113611620 GTGAGGACACAGCAAGAGGGAGG - Intergenic
1088972819 11:114788388-114788410 TTGCAGACACTGCTGGAGGAAGG + Intergenic
1089083534 11:115797746-115797768 GTGGAGACAAAGCTGGAGGCAGG + Intergenic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090416994 11:126547579-126547601 GAGAGGACACAGCCTGAGGAGGG - Intronic
1090986522 11:131771630-131771652 GTGTGTACACAGCTGGTGCTTGG - Intronic
1091120194 11:133051038-133051060 GTATGTACACACATGGAGGAGGG - Intronic
1091384536 12:84500-84522 GTGTGCACACATGTGCAGGATGG + Intronic
1091768625 12:3137650-3137672 GGGAGGACGCAGCTGGAGCAGGG - Intronic
1093619877 12:21276684-21276706 ATGTGGCCACTGCTGGGGGATGG - Intronic
1094024050 12:25943374-25943396 GTGTGGCCCCAGCTGGAGACTGG - Intergenic
1094362849 12:29649017-29649039 ATGTGGGCAGAGGTGGAGGATGG - Intronic
1094656006 12:32419919-32419941 GTGTGGCCACTGCTGGGAGAAGG + Intronic
1098568417 12:71961164-71961186 GTGGGGACTCAGCTATAGGAAGG - Intronic
1098606104 12:72392056-72392078 GTGAGGACAAAGCAAGAGGATGG + Intronic
1098611640 12:72466138-72466160 GTGTGGAAACAATTGGAGGCCGG - Intronic
1098750317 12:74284705-74284727 GTGAGGACACAGCCAGAAGATGG + Intergenic
1099710247 12:86214595-86214617 GTGAGGACACAGCAAGAGGCTGG - Intronic
1100095845 12:91035255-91035277 GTGAGGACACAGCAAGAAGATGG - Intergenic
1102119589 12:110429809-110429831 GTGTGGGCACAGGTGGAAGATGG + Intergenic
1102647752 12:114414699-114414721 GGGAGGACACAGGTGGAGGAGGG - Intergenic
1102784448 12:115592826-115592848 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1103038738 12:117677408-117677430 GTAAGGACACAGCAAGAGGACGG + Intronic
1103824436 12:123725536-123725558 GGGAGGCCAAAGCTGGAGGATGG + Intronic
1103965751 12:124638313-124638335 GTGAGGACACAGTGGGAAGACGG + Intergenic
1104038737 12:125115811-125115833 GACTGCACACAGATGGAGGACGG + Intronic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1104768596 12:131346210-131346232 GTGAGGTCACAGCTGCAGGGAGG + Intergenic
1104792138 12:131489996-131490018 GTGAGGATGCAGTTGGAGGAAGG + Intergenic
1104811436 12:131622379-131622401 GTGAGGTCACAGCTGCAGGGAGG - Intergenic
1105348007 13:19591429-19591451 GTGTAGACACAGCTGATGGAGGG - Intergenic
1105406889 13:20140628-20140650 GTGTGGGCATGGCTGGAAGACGG - Exonic
1105722916 13:23134665-23134687 GTGAGGGCACAGGTGGAAGATGG - Intergenic
1105730850 13:23213926-23213948 GTGTGGCCTCAGCTGCAGGAAGG + Intronic
1105853388 13:24355300-24355322 GGGTGGACACAGGAAGAGGACGG + Intergenic
1106856562 13:33860044-33860066 GTGAGGACACAGCTTGAAGGTGG + Intronic
1106868548 13:33994290-33994312 GTGTCCACTCAGCTGGAGGAAGG + Intergenic
1106950165 13:34874558-34874580 GTGAGGACACAGCCGGAAGGGGG - Intergenic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1107721926 13:43258388-43258410 GTGGTGAAACAGCTGGAAGAAGG + Intronic
1107793778 13:44029442-44029464 GTGTGGACACAGTAAGATGACGG + Intergenic
1109013450 13:56978551-56978573 GTGAGGACACAGCCAGAGGTTGG + Intergenic
1111835618 13:93385255-93385277 GAGTGGACACCACTGGAGAAGGG + Intronic
1111914891 13:94350710-94350732 TTCTGCACACAGCTGGAAGATGG - Intronic
1112369750 13:98784395-98784417 GTGAAGACACAGGGGGAGGATGG - Intergenic
1112445872 13:99463571-99463593 GTGAGCACACAGCAGCAGGAAGG + Intergenic
1112769444 13:102779994-102780016 GTGTGGTCACATATGGAGGGTGG + Intergenic
1113017110 13:105840268-105840290 CTGAGGACACAGCCAGAGGAGGG + Intergenic
1113536886 13:111075206-111075228 GTGAGGACAAGGCAGGAGGATGG - Intergenic
1113599431 13:111558149-111558171 GGGTTGACCCTGCTGGAGGAAGG + Intergenic
1114570757 14:23666062-23666084 GTGAGGACACAGCCAGAAGATGG + Intergenic
1114690075 14:24573343-24573365 ATGTGGACACAGGGAGAGGATGG + Intergenic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1117646987 14:57863690-57863712 GAGAGGAGAAAGCTGGAGGAGGG - Intronic
1118618496 14:67593248-67593270 GGGAGGCCACAGCAGGAGGATGG + Intronic
1118725670 14:68627387-68627409 GTGTGTCCACAGTTGGAGCAGGG + Intronic
1118865710 14:69702011-69702033 GTGAGGGCACAGCTGCAGGGTGG + Intronic
1118900632 14:69982571-69982593 GTGTTAACACACCTGAAGGAGGG + Intronic
1119326785 14:73764582-73764604 GAGAAGACACAGCTGGTGGAGGG - Intronic
1119842057 14:77800480-77800502 GAGTGGGCAGAGCTGGAGGAGGG + Intronic
1120851996 14:89180030-89180052 GTGTAGAAGCAGCTGGCGGATGG + Intronic
1121173453 14:91873086-91873108 GGGTGGACCCAGGTGGAGGCCGG - Intronic
1121678066 14:95770491-95770513 GTGAGGACACAGCAAGAAGATGG + Intergenic
1121904118 14:97724060-97724082 ATGTAGCCACAGCTCGAGGAAGG - Intergenic
1122474069 14:101993715-101993737 GTGTGGGCACAGCATGGGGAAGG - Intronic
1122810671 14:104286256-104286278 GTGAGGACACAGCCAGAAGACGG - Intergenic
1122906503 14:104804046-104804068 GTCTCGAGACAGCTGGGGGAGGG + Exonic
1124154085 15:27209871-27209893 GTGAGGACACAGCAGGAAGGTGG - Intronic
1124362069 15:29044961-29044983 GTGTGGACACAGAAAGAAGATGG - Intronic
1124623857 15:31297137-31297159 GTGAGGCCACACCCGGAGGAGGG - Intergenic
1125732242 15:41899617-41899639 CTGTGGACACAGGTGAATGAGGG - Exonic
1128825354 15:70710798-70710820 ATGTGGAGGCACCTGGAGGATGG - Intronic
1129120405 15:73393078-73393100 GTGAGGACACAGCTAGACGTTGG - Intergenic
1129609764 15:77043880-77043902 GTGTGGAGGCAGCAGGAGGGAGG + Exonic
1129670139 15:77603216-77603238 GTGTGGTCTCAGCTGCAGGAAGG - Intergenic
1130063189 15:80584193-80584215 ATGAGTACACTGCTGGAGGAAGG + Intronic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1131781710 15:95866724-95866746 CTGTGGACCAAGCAGGAGGAAGG + Intergenic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1134364875 16:13568089-13568111 GTCTGGATATAGCTGGAGAAGGG - Intergenic
1135044150 16:19141008-19141030 GTGAGGACACAGCGGGACGGTGG + Intronic
1135052879 16:19206705-19206727 GTGAGGACAGAGGTGGAGGCTGG - Intronic
1135134041 16:19874661-19874683 GGGTTGTCACAGTTGGAGGAGGG - Intronic
1135488579 16:22887375-22887397 GTGAGGACACAGCAAGAAGATGG - Intronic
1135724806 16:24846085-24846107 GTGAGGACCCTGGTGGAGGACGG + Exonic
1135763008 16:25152721-25152743 GTGGGGACAGAACTGGAGGATGG - Intronic
1136328453 16:29551295-29551317 GTGATGACACTGATGGAGGAGGG + Intergenic
1136443138 16:30291309-30291331 GTGATGACACTGATGGAGGAGGG + Intergenic
1137627304 16:49917497-49917519 GGGAGGCCACAGCAGGAGGATGG - Intergenic
1138239391 16:55414787-55414809 GGGTAGACAGAACTGGAGGAAGG + Intronic
1138681452 16:58686240-58686262 GTGAGGACACAGCAGGAAGATGG - Intergenic
1139065107 16:63303039-63303061 GTGTAGACAGAGCCTGAGGAAGG + Intergenic
1139424285 16:66869534-66869556 GTGAACACACAGCTGGGGGAGGG + Intronic
1139718768 16:68836086-68836108 GTGTGGGCCAAGCTGAAGGACGG + Intergenic
1141089456 16:81120289-81120311 CTGTGGAGGCAGTTGGAGGAGGG + Intergenic
1141604705 16:85146098-85146120 GTGTGGACACCCATGGAAGAAGG + Intergenic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1142046155 16:87926583-87926605 GGGAGGACACACCTGGGGGATGG - Intronic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142225505 16:88875337-88875359 GGGTGGGCAGGGCTGGAGGATGG + Exonic
1142268206 16:89075098-89075120 GTGTGGACCCGGCTGAAGGCAGG + Intergenic
1142985736 17:3694565-3694587 GTGAGGACACAGCGAGAGGGTGG + Intronic
1143352816 17:6301443-6301465 GTCTGGCCACATCTGGAGGAAGG + Intergenic
1143471418 17:7178223-7178245 GTGTGGGAACAGCTGGAAGCTGG - Intronic
1144579236 17:16448764-16448786 TTGAGGACACAGGAGGAGGAGGG + Intronic
1145031380 17:19507571-19507593 GTGGGGACGCGGGTGGAGGAGGG - Intronic
1145231162 17:21174376-21174398 CTGTGGCTAAAGCTGGAGGAAGG - Intronic
1145240863 17:21240535-21240557 GTGTGGACCCAGCTGGCCGCTGG - Exonic
1145984919 17:29039208-29039230 GTGGGGACAGAGATAGAGGAGGG - Intronic
1146006349 17:29163064-29163086 GTGTGGACACAGTTGATGGATGG + Intronic
1146030717 17:29363883-29363905 GTGAGGACACAGCTGGAAGTTGG - Intergenic
1146098977 17:29960186-29960208 GTGAGGCCACTGCTGGGGGATGG + Intronic
1146178058 17:30679467-30679489 GTGAGGACAGAGGGGGAGGATGG + Intergenic
1146625538 17:34432283-34432305 GTGAGGACACAGCAAGACGATGG + Intergenic
1146631332 17:34471966-34471988 GTGTGGACAGAGGTAGAGGCAGG + Intergenic
1147167886 17:38603070-38603092 GTGTGGTCAGAGCTAGAGGGTGG - Intronic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1148467371 17:47872987-47873009 GTGTGGCCACAGCTGGAGAAGGG - Intergenic
1148960677 17:51390269-51390291 GTGAGGACACAGCGAGAAGAGGG - Intergenic
1149531772 17:57401551-57401573 TTGAGGACACAGCTGTAGCAGGG - Intronic
1149615459 17:57993866-57993888 ACGAGGAAACAGCTGGAGGAGGG - Intronic
1150632682 17:66891009-66891031 GTGGGGAGACAGTTGGAGGAAGG + Intergenic
1151784221 17:76267195-76267217 GGATGGCCACAGCTGGTGGAAGG - Intronic
1151816490 17:76473867-76473889 ATGTGGGCACCGCTGGAGGCTGG + Exonic
1152314743 17:79573598-79573620 AAGTGGTCACAGCTGTAGGATGG - Intergenic
1152591792 17:81217183-81217205 GTGGGCACACAGCTGGGGCAAGG + Intronic
1152719423 17:81915623-81915645 GTGTGGACACTGCTTCAGAAAGG - Exonic
1152896531 17:82914470-82914492 GTGCAGACACAGCTGGAGGCCGG - Intronic
1152900462 17:82938093-82938115 GAGCAGACACAGCTGCAGGAGGG - Exonic
1153987859 18:10368942-10368964 GCCTAGACACAGCTGGAGGAGGG - Intergenic
1154157022 18:11951758-11951780 GTGTGGGGAGAGCTGGAGGGAGG - Intergenic
1154973097 18:21429995-21430017 GTGAGGACACAGCAAGAAGACGG - Intronic
1155032791 18:21998793-21998815 GTGTGGACACTGTTGGCAGAAGG + Intergenic
1155606244 18:27609424-27609446 GTGTGGTCAGAGCTGAGGGATGG + Intergenic
1157501989 18:48197406-48197428 GTGTGGAGAGGGCTGGAGCAGGG - Intronic
1158208824 18:55023790-55023812 TGGTGGCCACAACTGGAGGACGG + Intergenic
1158511981 18:58098528-58098550 GTGGTCACACAGCTGGAAGATGG - Intronic
1160074425 18:75658716-75658738 ATATGGAGACAGCTGGAGGGAGG + Intergenic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1162616398 19:11804282-11804304 GTGAGGACACAGCAAGAGGATGG - Intronic
1163115679 19:15187560-15187582 GTGGGGCCACAGCTGGGGGCGGG - Intronic
1163169014 19:15517845-15517867 GTGTGGGCACAGCTGAGGAAAGG + Intronic
1164131556 19:22367446-22367468 CTGGGCACACAGCTAGAGGAAGG + Intergenic
1165341778 19:35217692-35217714 GTGAGGACACAGCAAGAAGATGG - Intergenic
1165805417 19:38577873-38577895 GTGTAGACACAGCTGGAGTGTGG - Intronic
1166745634 19:45140673-45140695 GAGAGGACACTGCAGGAGGAGGG + Intronic
1166853564 19:45771479-45771501 GTGTATAGACACCTGGAGGAGGG - Intronic
1167050433 19:47074774-47074796 GTGCTGTCACAACTGGAGGAGGG + Intronic
1167123487 19:47533043-47533065 GTGTGGACGCAGCTGAAAGCAGG + Intronic
1167763160 19:51462035-51462057 GTGTGGACAGTGCTGTGGGAGGG - Intergenic
1167886903 19:52507683-52507705 GTCAGGACACAGCAGGAAGACGG - Intronic
1167989763 19:53348415-53348437 GTCAGGACACAGCAGGAAGATGG - Intronic
1168289817 19:55352200-55352222 GTGTGGACTCAACTACAGGAGGG - Exonic
1168397996 19:56065302-56065324 GTGTGTACACATCTGGAGACAGG - Intergenic
1168495378 19:56843460-56843482 GTGTGGAGAATACTGGAGGAAGG - Intergenic
926426884 2:12746361-12746383 GTGAGGACACAGCGGGAAAACGG - Intergenic
926694091 2:15758580-15758602 GTGAGGACACAGCGGGAAGGTGG + Intergenic
926750861 2:16197538-16197560 GCCTGGACACAGCTGCAGGTTGG - Intergenic
926777472 2:16436863-16436885 GTGTGGTGACAGCCGGAGGGAGG + Intergenic
927114742 2:19888966-19888988 GTGTGGAGGCAGATGGAGCAAGG - Intergenic
927523447 2:23716837-23716859 GTGAGGGCACAGTTGGAGGTGGG - Intergenic
927667294 2:25041772-25041794 GCCTGGACAGAACTGGAGGAGGG + Intergenic
927960528 2:27238283-27238305 GTCTGGAGACAGCAGGAGGAGGG + Intronic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
929470748 2:42190263-42190285 GGGGGGACTCAGCAGGAGGAGGG - Intronic
929537399 2:42792389-42792411 GTGAGGGCGCAGATGGAGGAGGG + Intronic
929639125 2:43558495-43558517 GTGTTTACCCAGGTGGAGGATGG - Intronic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931288113 2:60849613-60849635 GGCTGGTCCCAGCTGGAGGATGG - Intergenic
931666025 2:64609841-64609863 GGGTGGACAGAGCGGGAGGGTGG + Intergenic
932418344 2:71586913-71586935 GGGTGGACTCAGCTGCAGGCAGG - Intronic
932419227 2:71591835-71591857 GGCTGCACAGAGCTGGAGGATGG - Intronic
936072787 2:109382518-109382540 CTGGGGACACAGCTGCAAGACGG - Intronic
936262463 2:110973653-110973675 GAGTGGACACAGCTGGAGGTGGG + Intronic
936574773 2:113643943-113643965 TTGTGGTCTCAGCTGGAGGCCGG + Intergenic
938059159 2:128238731-128238753 GTGCGGACACAGCGGGAAGATGG - Intronic
938469089 2:131543633-131543655 GTGTCGACAGAGCGGTAGGAGGG + Intergenic
938873899 2:135512052-135512074 GTGCGGACACAGTTGCATGAGGG - Intronic
939029847 2:137059135-137059157 GTGAGGACACAGCAAGAAGATGG - Intronic
939980649 2:148776775-148776797 GTGAGGACAAAGTGGGAGGATGG + Intronic
942066186 2:172274035-172274057 GAATGGATACAGCTGTAGGAGGG + Intergenic
942459504 2:176159569-176159591 GTGTGGCCCCGGCTGGGGGAGGG + Intronic
942975877 2:182016227-182016249 ATGTGGTCACTGCTGGAGAATGG + Intronic
943381600 2:187156656-187156678 GTGAGGACACAGAGAGAGGATGG - Intergenic
943844972 2:192634417-192634439 ATATGGCCACTGCTGGAGGATGG - Intergenic
945406480 2:209454985-209455007 GTGGGGACACAGCAAGAAGATGG - Intronic
945756498 2:213853874-213853896 TTGTGGACAAAGCTTGAGGAGGG + Intronic
945837882 2:214853944-214853966 GTGAGGACACAGCAGGAAGATGG + Intergenic
946023994 2:216660833-216660855 GTGGGGTCTCAGCTGGAGGAGGG + Intronic
946043656 2:216803592-216803614 GTCGGGACACAGCTGTAGAAAGG - Intergenic
946210238 2:218141970-218141992 GGCTGGAGAGAGCTGGAGGATGG + Intergenic
946773873 2:223117474-223117496 GCCTGTACACTGCTGGAGGAAGG + Intronic
947009285 2:225547666-225547688 ATGTGGCCACTGCTGGGGGATGG + Intronic
947178086 2:227387730-227387752 GTGTGGCTACAGCTGTGGGAAGG - Intergenic
947348793 2:229221343-229221365 GTGGGGACAGAAGTGGAGGAAGG - Intronic
947654327 2:231813371-231813393 GTGAGGACACAGCAAGAAGATGG - Intergenic
948138787 2:235657922-235657944 GTGAGGACACAGGGGGAAGACGG + Intronic
948524845 2:238565096-238565118 GTGAGGACACAGCGGGAGGATGG + Intergenic
948618000 2:239213833-239213855 ATGAGTACACAGCTGGATGAGGG + Intronic
1169041485 20:2499143-2499165 GTTTGGACAGAGTTGGAGGTAGG + Intronic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1169376892 20:5073469-5073491 GTGTGGTCAGAGCTGCTGGAGGG + Intronic
1169594577 20:7183291-7183313 GTGAGGACACAGCTAGAAGTTGG + Intergenic
1170555145 20:17508941-17508963 CTGCGGAGTCAGCTGGAGGAGGG - Exonic
1170882900 20:20313214-20313236 GTGAGGACACAGCAGGAAGGTGG + Intronic
1171229934 20:23476028-23476050 GTGTGCCCACCGCAGGAGGAAGG - Intergenic
1171310973 20:24144295-24144317 CTGTGGACACTGCTGGCTGAGGG - Intergenic
1171796204 20:29568226-29568248 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1171852032 20:30315941-30315963 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1172705842 20:36881405-36881427 GTGAGGTCATTGCTGGAGGAAGG + Intronic
1172972566 20:38884054-38884076 GTGTGGACACTCCTGGCCGAAGG + Intronic
1173152768 20:40581962-40581984 GTTTGGACACAGTGGGAGTATGG - Intergenic
1173487858 20:43454925-43454947 TGGTTGTCACAGCTGGAGGAGGG - Intergenic
1175351357 20:58322035-58322057 GTGAAGCCACAGCAGGAGGATGG - Intronic
1175401964 20:58706156-58706178 GTGTGGACACTGCAGGAGAAGGG + Intronic
1175514437 20:59559948-59559970 GTCATGACCCAGCTGGAGGAAGG - Intergenic
1175680988 20:60988726-60988748 GTGAGGACACAGCAAGAGAATGG + Intergenic
1175705517 20:61173710-61173732 GTGTGGAGACAGTTGATGGATGG - Intergenic
1175925914 20:62471259-62471281 GAGTGGATACAGCCAGAGGAGGG + Intronic
1176092828 20:63326528-63326550 GTGCTGACAGTGCTGGAGGAGGG + Intronic
1176105501 20:63384023-63384045 GTTTGGACACTGGGGGAGGACGG - Intergenic
1176198376 20:63848234-63848256 CTGTGGACACTGCTGGCTGAGGG - Intergenic
1176199825 20:63855252-63855274 CTGTGGCCACAGCTGGGGGGAGG - Intergenic
1176240087 20:64071923-64071945 GTGTGGAAACCGCTGGAAGGTGG + Exonic
1176521826 21:7830053-7830075 GTGTGGCCACAGCTGGGGTGCGG - Intergenic
1178231459 21:30789759-30789781 GTGGGGACACAGCAAGAAGATGG + Intergenic
1178305494 21:31487192-31487214 GTCTGAAAACAGCTGGAGGTGGG + Intronic
1178375036 21:32059628-32059650 GTGTGCAAAGAGCTGAAGGACGG + Intergenic
1178655846 21:34460065-34460087 GTGTGGCCACAGCTGGGGTGCGG - Intergenic
1178988133 21:37326246-37326268 GGGTGGCCAAAGCGGGAGGATGG + Intergenic
1179033815 21:37742929-37742951 GTGGGCACACATCTGCAGGAAGG - Intronic
1179164778 21:38926802-38926824 GTGAGGACACAGGGAGAGGACGG + Intergenic
1179551164 21:42144914-42144936 GTATGGAAACAGAAGGAGGAAGG + Intergenic
1179726508 21:43344140-43344162 GTGTGGGCAGGGCTGGAGGGGGG + Intergenic
1179806940 21:43845386-43845408 GTAAGGACAGAGCTGCAGGATGG - Intergenic
1179879160 21:44286312-44286334 GTGTGGGGACGGCTGGGGGAAGG - Intronic
1180068213 21:45423450-45423472 GTGTGGACACAGCTTTGGGAGGG - Intronic
1180086263 21:45509284-45509306 AGGAGGACACAGATGGAGGAGGG + Intronic
1180654975 22:17412753-17412775 GTGTGGAGACAGGTGGCGGGCGG + Intronic
1180713223 22:17854205-17854227 CTGTTGACACAGCTTGGGGAGGG + Intronic
1181112104 22:20608243-20608265 TTCTGGACACAGCTGGATGAGGG + Intergenic
1181118577 22:20650105-20650127 GTGAGGCCACAGCTGTAGGGAGG + Intergenic
1181579712 22:23821237-23821259 GGGTGGACACAGCTGGCCCAGGG + Intronic
1182594009 22:31403891-31403913 GTGTGGACATATCTGGACCATGG + Intronic
1183198744 22:36371359-36371381 GTGAGGACACAGTTGGCAGACGG + Intronic
1183411985 22:37660264-37660286 GTGGGGACACAGGAGGTGGAGGG - Intronic
1183507241 22:38215885-38215907 GTGTGGACAGTGTTGGGGGAGGG - Exonic
1184792998 22:46712641-46712663 GTGTGCAGACAGCAGGAAGAAGG + Intronic
1184864695 22:47195659-47195681 GGGTGCACACACCAGGAGGACGG - Intergenic
1185030593 22:48440985-48441007 GTGAGGAGACAGCTGCAGGATGG - Intergenic
1185061598 22:48609889-48609911 GTTAGGACACAGAGGGAGGACGG - Intronic
1185387768 22:50544194-50544216 CTGTGGCCGCAGTTGGAGGATGG - Intergenic
1185425400 22:50766933-50766955 TTGTGGTCTCAGCTGGAGGCCGG - Intergenic
950313999 3:11984392-11984414 GTGTGAAGACAGATGGAGGGAGG - Intergenic
950495409 3:13331076-13331098 ATGTGCACACAGCTGGTGGCAGG - Intronic
950885579 3:16359563-16359585 GTGAGGACACAGCAGGAAGGTGG + Intronic
952333761 3:32387408-32387430 GTGTGGACACAGCAAGAAGGTGG + Intergenic
953183761 3:40619860-40619882 GTGTGGACAAAGGAGGAGGTGGG - Intergenic
953373833 3:42412214-42412236 GTGTTGGCTCAGCTGGAGGCTGG + Intergenic
953537364 3:43786583-43786605 GTGTGGACTCAGCTCCAGGCAGG - Intergenic
953874712 3:46660070-46660092 GTGTGGTCACAGCAGGAAGAGGG - Intergenic
954224793 3:49174629-49174651 GTGTGCACACAGCAGGATGTGGG + Intronic
954361500 3:50125040-50125062 GGGAGGACACAGCGGCAGGACGG - Intergenic
954390553 3:50266053-50266075 GAGTGAACACAGGTGGAGGAAGG + Intergenic
954752474 3:52821435-52821457 GTGTAGAAACAGCAGCAGGAAGG + Intronic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
955237989 3:57156795-57156817 ATGTGGGCAAAGCTGGAGAAGGG - Intronic
955824298 3:62928958-62928980 GTGTGGTGGCAACTGGAGGAAGG + Intergenic
956326193 3:68055566-68055588 GTGGGGACAGATCTTGAGGAAGG + Intronic
956579005 3:70789331-70789353 GTGTGGACACAACAGCAGAATGG - Intergenic
958491460 3:94779469-94779491 GTGTAGCCACAAATGGAGGATGG + Intergenic
958916120 3:100052452-100052474 GAGTGCACCCAGTTGGAGGATGG + Intronic
960371761 3:116849521-116849543 GAGTGGAGACAGCTGGAAGTGGG - Intronic
960574973 3:119220517-119220539 GTGTCGCCACATCAGGAGGAGGG + Intronic
960729491 3:120710535-120710557 ATGTGGGCACAGATGGAGAAAGG - Intronic
960869513 3:122234499-122234521 GTTTGGAAACTGCTGGAGGATGG + Intronic
960898084 3:122527116-122527138 GCATGGGCACAACTGGAGGAAGG + Intergenic
960951975 3:123005189-123005211 GGGTGGGGACAGGTGGAGGAAGG - Intronic
961422242 3:126815648-126815670 CTGTGGACACAGATGGGGGGGGG - Intronic
964443729 3:156739080-156739102 GTGTGGACAAGTCTGGAGGATGG - Intergenic
964736239 3:159921593-159921615 GTGTGGACACAGCAAAAAGATGG - Intergenic
965559736 3:170049801-170049823 TTGTGGACACACCCTGAGGAAGG - Intronic
965917961 3:173874001-173874023 GTGAGGACACAGTGGGACGATGG + Intronic
965962449 3:174444270-174444292 GTGGGGGCACAGATGGAGGTGGG + Intronic
966643357 3:182215328-182215350 GTGAGGATACAGCAGGAAGATGG - Intergenic
966834750 3:184040554-184040576 TTGTGGACATGCCTGGAGGACGG - Intergenic
967427857 3:189348127-189348149 GGGAGGAGACTGCTGGAGGAAGG + Intergenic
967863496 3:194171299-194171321 GTGAGGACACATCTGTAGGTAGG - Intergenic
967935168 3:194721656-194721678 ATGTGGACACAGTTTAAGGAAGG + Intergenic
969144811 4:5113240-5113262 GTGAGGACACAGCAAGAAGATGG + Intronic
969256769 4:6007753-6007775 GAGTGGACACGGTTGGTGGATGG + Intergenic
969677327 4:8621314-8621336 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969678282 4:8626952-8626974 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969679238 4:8632590-8632612 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
970475001 4:16413036-16413058 GTGGCCACACAGCAGGAGGATGG - Intergenic
970682572 4:18527649-18527671 GTGAGGACACAGCAAGAAGATGG - Intergenic
970815377 4:20150094-20150116 GTGGGGACACAAAAGGAGGAAGG - Intergenic
971176060 4:24283781-24283803 GTGTGTACAGAGCTGAAGCAAGG - Intergenic
971689075 4:29809940-29809962 GTGTAGAGCCAACTGGAGGAAGG - Intergenic
971870403 4:32228876-32228898 TTGTGGACTCTGCTGGAGTATGG - Intergenic
972262320 4:37421941-37421963 GTGAGGACACAGCGAGAAGATGG - Intronic
972271208 4:37512085-37512107 ATGTGGCCACTGCTGAAGGATGG + Intronic
973760386 4:54109671-54109693 GGGTGGACGCAGAGGGAGGAAGG + Intronic
975106638 4:70574656-70574678 GTGTGGACACAGGTGTTAGATGG - Intergenic
975528191 4:75373947-75373969 CTGAGGACACAGCTAGAGGGAGG + Intergenic
975582702 4:75921155-75921177 GTGTGGACCCAACTGCAGGTGGG - Intronic
975663728 4:76712566-76712588 GTGTGGTCAAAGCTGGCCGATGG + Intronic
978810250 4:112841759-112841781 GTGCGGACACAGCTAGGCGAGGG - Intronic
979474020 4:121133811-121133833 ATTTGGACACAGATGGAAGATGG + Intronic
980169868 4:129276110-129276132 GTGAGGACACAGGTGGGTGATGG - Intergenic
980417911 4:132517276-132517298 GATTAGACACAGCTGGAGAAAGG + Intergenic
981818117 4:148854721-148854743 GGGTTCTCACAGCTGGAGGAAGG - Intergenic
982951195 4:161698158-161698180 GTGAGGACACAGCAAGAAGATGG + Intronic
983930396 4:173447208-173447230 GTGAGGACACAGCAAGAAGATGG - Intergenic
985124318 4:186676772-186676794 GAATGCACACAGCTGGTGGAAGG + Intronic
985494465 5:196711-196733 GTGGGGACACACCTGGAGTGGGG - Intergenic
985494483 5:196753-196775 GTGGGGACACACCTGGAGTGGGG - Intergenic
985905228 5:2830168-2830190 GGGAGGCCACTGCTGGAGGAGGG - Intergenic
986064365 5:4221260-4221282 GTGGGGCCACAGCTGGTGCACGG - Intergenic
986332585 5:6728243-6728265 GTCTGGTCACAGCAGGAAGATGG + Intronic
986720243 5:10555944-10555966 GGGAGGACACAGCAGGAGGATGG + Intergenic
986740665 5:10702487-10702509 GTCTGGCAAAAGCTGGAGGAAGG - Intronic
987774078 5:22342041-22342063 GTGAGGACACAGCAGCAAGAGGG - Intronic
988934226 5:36066560-36066582 TTGCGGACCCGGCTGGAGGAGGG - Intronic
989118180 5:37977092-37977114 GTGAGGACACAGCAAGAGGATGG + Intergenic
989359502 5:40584599-40584621 GTGTGGACACTGATGGCTGAGGG - Intergenic
990432453 5:55749644-55749666 GTGAGGACAGAGTGGGAGGAAGG - Intronic
991023699 5:62007680-62007702 GTGTGGTCACAGCTGAGTGAGGG - Intergenic
992954380 5:81892186-81892208 GTGTAGACCCAGCTAGAGAATGG + Intergenic
993124595 5:83817801-83817823 GTGTGCACATAGCTGGCGGTGGG + Intergenic
993711896 5:91233484-91233506 GTGTGCACACATCTGCAGAAAGG + Intergenic
995164080 5:109016963-109016985 GTGAGGACACAGTGGGAAGAAGG + Intronic
998668445 5:144325753-144325775 GTTAGGACACAGCTTGATGAGGG - Intronic
999410166 5:151343587-151343609 GAGTGGGCCCATCTGGAGGAAGG + Exonic
1001318860 5:170663873-170663895 GTGTACACAGGGCTGGAGGAGGG - Intronic
1001525497 5:172425780-172425802 GTGTGGAAACGGCTTGAAGAGGG + Intronic
1001686264 5:173597094-173597116 GTGTGGACACACCAGGGGCATGG - Intergenic
1001732652 5:173971908-173971930 GTGTGGAGGCAGCAGGGGGAGGG + Intergenic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1002965934 6:1966592-1966614 GTGATGACACAGCTGGAGGGTGG - Intronic
1002971540 6:2027209-2027231 AGGTGGACACAGCCAGAGGAAGG + Intronic
1003311191 6:4971215-4971237 GTGAGGACACAGCAGGAAGGTGG - Intergenic
1003843323 6:10145803-10145825 GTGTGGACACAGCGAGAAGCTGG - Intronic
1004288929 6:14348971-14348993 GTGAGGACACAGCAGGAAGGCGG - Intergenic
1005037539 6:21570406-21570428 ATGTGGCCACTGCTGGGGGATGG + Intergenic
1005161163 6:22865724-22865746 TTGAGGACACAGCAAGAGGATGG - Intergenic
1006107392 6:31724735-31724757 GGGGGGACAGAGCTGAAGGATGG - Intronic
1006327415 6:33364974-33364996 GTGGGGAAACAGCTGAGGGAAGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006439119 6:34042428-34042450 GTGAGGACATGGCAGGAGGATGG + Intronic
1006474327 6:34245012-34245034 GTGAGGGCACAGGTGGAAGATGG - Exonic
1006745231 6:36336977-36336999 GGGTGGTAACAGGTGGAGGAAGG - Intergenic
1007198266 6:40082438-40082460 GAGTGGTCCCAGGTGGAGGAGGG - Intergenic
1007739011 6:43999943-43999965 GCATGCACACACCTGGAGGAGGG + Intergenic
1008040271 6:46790029-46790051 GTGTGGAAATAGCTGGGGGCGGG + Intergenic
1009323345 6:62318304-62318326 GTGAGGACACAGCAGGAAGATGG + Intergenic
1009641062 6:66337445-66337467 GTGAGGACACAGCAAGAAGAAGG - Intergenic
1010712260 6:79188990-79189012 TTGTGGAATCAGCTGCAGGATGG + Intergenic
1011184296 6:84657289-84657311 GTGAGGACACGGCTAGAAGATGG + Intergenic
1011708060 6:90023405-90023427 ATGTGGCCAGAGCAGGAGGAGGG - Intronic
1013647978 6:112163958-112163980 GTGTGGGCACAGATGCAGGCGGG + Intronic
1013978749 6:116105196-116105218 GCCTGCACACAGCTGGAGTAGGG - Intronic
1014688636 6:124533870-124533892 GTGAGGACACAGAGGGAAGATGG - Intronic
1014727264 6:124986461-124986483 GGCTGAAGACAGCTGGAGGAAGG - Intronic
1016388037 6:143548161-143548183 GTGAGGACACAGCAAGAAGATGG - Intronic
1016581618 6:145634474-145634496 GTGAGGACCGTGCTGGAGGAGGG - Intronic
1016627803 6:146192867-146192889 AGGTGGGCACAGCTGGAAGAAGG + Intronic
1017184608 6:151588420-151588442 GGTTGGACACAGCTGAGGGAAGG + Intronic
1018714616 6:166521993-166522015 GTGAGGACACAGCCAGAAGATGG + Intronic
1019127424 6:169850100-169850122 GTGGGGACACAGCTGGAGGCAGG - Intergenic
1019182745 6:170201609-170201631 GTGAGGACACAGCAAGAAGATGG - Intergenic
1019265881 7:117410-117432 GTCTGGACACTGCTGGACGAGGG - Intergenic
1019377259 7:699434-699456 CAGAGGTCACAGCTGGAGGAAGG + Intronic
1019694414 7:2437172-2437194 GTGTGGACACAGCTGGAGGATGG - Intergenic
1020530661 7:9329909-9329931 GTGAGGACACAGCAAGAAGATGG + Intergenic
1020760434 7:12262072-12262094 GAGTGGAGACAGCTAGAGGCAGG + Intergenic
1021942314 7:25689802-25689824 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1022979945 7:35594776-35594798 GTTCAGACTCAGCTGGAGGAAGG + Intergenic
1023131842 7:37011330-37011352 AGGTGGGCACAGCTGGTGGAGGG - Intronic
1023181049 7:37484224-37484246 ATGTGGTGACAGCTGGAGGAAGG + Intergenic
1023662226 7:42481536-42481558 GTGTGTGCACAGCAGGAGGAGGG + Intergenic
1023895646 7:44430933-44430955 CTGAGGACACGGCAGGAGGATGG - Intronic
1024365064 7:48510710-48510732 GTGAGGACACAGGGAGAGGATGG - Intronic
1026849438 7:73715913-73715935 GTGTACACACAGCTGGAGGCTGG - Intronic
1027320285 7:77006252-77006274 GTCTGGACACAGGAGGAGGCGGG + Intergenic
1028419848 7:90620737-90620759 GTGAGGACTCATGTGGAGGATGG - Intronic
1028737807 7:94237166-94237188 GAGTTGACACAGCAGGAGAAGGG + Intergenic
1029124765 7:98288260-98288282 GTGGGGACACAGCTGGTGCTTGG + Intronic
1030222326 7:107110053-107110075 ATGCGGCCACTGCTGGAGGATGG - Intronic
1030621291 7:111794074-111794096 GTGGGGACACAGATGCTGGAGGG + Intronic
1031493903 7:122423158-122423180 CTATGGCCAGAGCTGGAGGAAGG - Intronic
1031766677 7:125786824-125786846 GTGAGGACACAGTGGGGGGATGG - Intergenic
1032071520 7:128810497-128810519 GAGTGGTCACAGCTGGTGAAAGG - Intronic
1032322489 7:130897730-130897752 GTGTGGGCACCCCAGGAGGAAGG + Intergenic
1032445235 7:131976630-131976652 GGGTGGACACAGTAGAAGGAAGG - Intergenic
1032796334 7:135279321-135279343 GTGAGGACACAGCTAGAAGGTGG + Intergenic
1033557636 7:142502463-142502485 CTGAGGCCAGAGCTGGAGGAGGG - Intergenic
1034277524 7:149830228-149830250 GGGAGGACACAGGAGGAGGAGGG - Intergenic
1034851234 7:154495840-154495862 GTGTGTACCCAGATGCAGGAAGG + Intronic
1034936961 7:155206479-155206501 GTGAGGACACAGGGAGAGGATGG - Intergenic
1035023941 7:155814629-155814651 TTGTGGGCACAGCTGGACGTGGG + Intergenic
1035416888 7:158696726-158696748 GTGTGGACTTAGGAGGAGGAGGG - Intronic
1036045851 8:5139591-5139613 GTGTTGACACAAATGGAAGATGG - Intergenic
1036126720 8:6069787-6069809 ATGAGGACACAGCTGGGAGATGG - Intergenic
1037764539 8:21764270-21764292 GTGAGGACACAGCCAGAAGATGG - Intronic
1038670316 8:29577813-29577835 GTGTGGGCACAGATGGGGGTGGG - Intergenic
1039722973 8:40184680-40184702 GTGAGGACACAGCAAGAAGACGG + Intergenic
1040416905 8:47203350-47203372 GTGTGCCCTCTGCTGGAGGAAGG - Intergenic
1040655518 8:49502999-49503021 GTGAGGACACAACTAGAAGATGG + Intergenic
1042058774 8:64794542-64794564 GTGAGGACACAGCAAGAAGATGG - Intronic
1042229473 8:66541883-66541905 GTGCGGCTACAGCTGGAGCATGG + Intergenic
1042776352 8:72436265-72436287 GTGTTGACACAGCTTGGGTATGG - Intergenic
1043033754 8:75171003-75171025 ATGTGGACACAGCTACAAGATGG + Intergenic
1043666596 8:82822482-82822504 GTGTGGACACACCTCGTTGAGGG - Intergenic
1044917665 8:97132783-97132805 ATGTGGACAGAGCTGCAGAAAGG + Intronic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1045646942 8:104308454-104308476 GTGAGGACACAGCAGGAAGGCGG + Intergenic
1045750771 8:105481408-105481430 GTGTGCACACAGCTAGAAGGTGG - Intronic
1045754855 8:105530532-105530554 GTGTGGACACAGCAAGAAGGCGG - Intronic
1046205512 8:110990354-110990376 GTGTGAACTCAGGTGGAGGGAGG - Intergenic
1046308094 8:112397616-112397638 GTGAGGACACAGCCAGAAGACGG - Intronic
1047202025 8:122775503-122775525 GTGAGGACACAGCAAGAAGATGG - Intergenic
1047258722 8:123236969-123236991 GCGGGCAAACAGCTGGAGGATGG + Intronic
1048035262 8:130671996-130672018 GTGTGGAAAGATCTGGGGGAAGG + Intergenic
1048169860 8:132096005-132096027 GAGTTGCCACAGCTTGAGGATGG - Intronic
1048406914 8:134132547-134132569 TTGTAGACTCAGCTGTAGGAAGG - Intergenic
1048467989 8:134683528-134683550 GTGGCCAGACAGCTGGAGGAAGG + Intronic
1048635126 8:136287073-136287095 GTGAGGACACAGTGTGAGGATGG + Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049276181 8:141721189-141721211 GTGTGGACACAGCTGGGGGGAGG - Intergenic
1049433363 8:142575390-142575412 GTGTGGGCCCTGCTGGAGGTTGG - Intergenic
1049445877 8:142631267-142631289 GTGTGGGGACAGGTGGAGAAGGG - Intergenic
1049794444 8:144490137-144490159 GTGTGGACACCGCTGTGGGTTGG + Exonic
1049939621 9:532899-532921 TTGTGTACACAGCTGCAGGAGGG + Intronic
1050385732 9:5088745-5088767 GTGAGGACACAGCAAGAAGATGG - Intronic
1051253700 9:15189725-15189747 ATTTGGAAACTGCTGGAGGAAGG + Exonic
1051740627 9:20248487-20248509 GTGAGGACACAGCAGGAAGATGG - Intergenic
1052327146 9:27227578-27227600 GTGAGGACACAGCAGAAAGATGG - Intronic
1052763603 9:32618056-32618078 TTGTGGAGACAGCTGGGGGAGGG + Intergenic
1053287969 9:36862078-36862100 GTGTGGAGGCAGCTGGTAGAGGG + Intronic
1053789815 9:41679197-41679219 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054155325 9:61635559-61635581 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1054178155 9:61890887-61890909 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054659374 9:67689937-67689959 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1055342195 9:75295931-75295953 GTGGGGCCACTGCTGGGGGATGG + Intergenic
1056298773 9:85220812-85220834 GAGTGGAAACAGGTGGATGAAGG + Intergenic
1056517579 9:87370019-87370041 GTATGGAGACAGCTTAAGGAGGG + Intergenic
1056702914 9:88925683-88925705 TTTGGGACACAGATGGAGGAAGG - Intergenic
1057026341 9:91736615-91736637 GAGTAGAGACAGCAGGAGGAGGG + Intronic
1057206058 9:93173322-93173344 GTGTGGACAGAGCAGAAAGAAGG - Intergenic
1057214804 9:93221866-93221888 GTTTAGAAACAGCTGGTGGAGGG + Intronic
1057298023 9:93860730-93860752 GTGTGGACACTCCTGGAGCCCGG + Intergenic
1057727121 9:97575521-97575543 GTGTGTAAACAGCTGGGAGATGG + Intronic
1058288305 9:103207237-103207259 ATGTGGTCACACCTGGATGAAGG - Intergenic
1058669867 9:107351758-107351780 GTGTGCTCACAGAGGGAGGATGG + Intergenic
1058892316 9:109371481-109371503 TTGAGGACACAGCAGGAAGATGG + Intergenic
1058983182 9:110188875-110188897 GTGAGGACACAGCCAGAAGATGG + Intergenic
1059452333 9:114378158-114378180 GTGTGCACATAGCAGGAGCAGGG - Intronic
1060393718 9:123300794-123300816 GTGCTGACAGAGGTGGAGGAGGG + Intergenic
1060670171 9:125461819-125461841 GAGTGGACAGAGCCTGAGGAAGG + Intronic
1060850916 9:126874688-126874710 GTGTGTGCACAGCTGGAACAAGG - Intronic
1060941137 9:127543462-127543484 CTGTGGAAACATCTGGAAGATGG + Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061594035 9:131617306-131617328 GTGTGGCCACAGCAGGGTGAGGG + Intronic
1062005457 9:134236479-134236501 CTGGGGCCTCAGCTGGAGGAGGG + Intergenic
1062262617 9:135670471-135670493 GTGTGGACGGAGCTGGACGGGGG + Intergenic
1062292746 9:135804542-135804564 GTGTGGACCCAGCTGGAAAGTGG - Intergenic
1062710299 9:137971763-137971785 GTGTGTCCAGAGCTGGAGGGTGG + Intronic
1185618424 X:1437473-1437495 GTGAGGACACAGGGGGAAGACGG - Intronic
1185664472 X:1754470-1754492 GTCTGCACAGAGCTGCAGGATGG - Intergenic
1185664475 X:1754521-1754543 GTCTGGTCAGAGCTGCAGGATGG - Intergenic
1187505854 X:19877883-19877905 GTGGGGGCACTGCTGGAGGCTGG - Intronic
1188266357 X:28080716-28080738 GTGAGGACACAGCAAGAGGGTGG + Intergenic
1190047684 X:47125833-47125855 GTGAGGACACAGTGAGAGGATGG - Intergenic
1190320124 X:49175156-49175178 GAGTGGAAACAGCTGGGGCAAGG + Exonic
1192285153 X:69727464-69727486 GTGAGAACACAGCAGGAGAATGG - Intronic
1194597524 X:95877167-95877189 GTGAGGACACAGCAAGAAGATGG - Intergenic
1194783955 X:98058674-98058696 ATGTTGCCACTGCTGGAGGATGG + Intergenic
1195105914 X:101601167-101601189 GTGTGCACTCACCTGGAGGGGGG - Intergenic
1195106969 X:101612600-101612622 GTGTGCACTCACCTGGAGGGGGG + Intergenic
1195208070 X:102624438-102624460 GTTTGGAGACAGCAGAAGGAGGG + Intergenic
1195243539 X:102976720-102976742 GAGTTTACACAGCTTGAGGATGG - Intergenic
1195306138 X:103585743-103585765 GTGTGGACAGAGATGGCGGTGGG + Intronic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1197724519 X:129767776-129767798 GTGTGGACCCTCCTGGAGGAGGG - Intronic
1198596731 X:138244025-138244047 AAGCTGACACAGCTGGAGGAAGG - Intergenic
1199794117 X:151178634-151178656 GTGCTGACAGCGCTGGAGGAAGG + Intronic
1199980513 X:152918000-152918022 GTGTGGCCAAATCTGGAGGCAGG + Intronic