ID: 1019701200

View in Genome Browser
Species Human (GRCh38)
Location 7:2475716-2475738
Sequence CCGGGCCCCAGCGGCCGTAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019701190_1019701200 13 Left 1019701190 7:2475680-2475702 CCCCCGGGGCCAGCGGGAAGATG 0: 1
1: 0
2: 0
3: 6
4: 135
Right 1019701200 7:2475716-2475738 CCGGGCCCCAGCGGCCGTACTGG 0: 1
1: 0
2: 0
3: 12
4: 129
1019701187_1019701200 25 Left 1019701187 7:2475668-2475690 CCTCAAAGGGCTCCCCCGGGGCC 0: 1
1: 0
2: 1
3: 17
4: 206
Right 1019701200 7:2475716-2475738 CCGGGCCCCAGCGGCCGTACTGG 0: 1
1: 0
2: 0
3: 12
4: 129
1019701193_1019701200 10 Left 1019701193 7:2475683-2475705 CCGGGGCCAGCGGGAAGATGCTA 0: 1
1: 0
2: 0
3: 14
4: 123
Right 1019701200 7:2475716-2475738 CCGGGCCCCAGCGGCCGTACTGG 0: 1
1: 0
2: 0
3: 12
4: 129
1019701194_1019701200 4 Left 1019701194 7:2475689-2475711 CCAGCGGGAAGATGCTAGACACC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1019701200 7:2475716-2475738 CCGGGCCCCAGCGGCCGTACTGG 0: 1
1: 0
2: 0
3: 12
4: 129
1019701192_1019701200 11 Left 1019701192 7:2475682-2475704 CCCGGGGCCAGCGGGAAGATGCT 0: 1
1: 0
2: 2
3: 15
4: 186
Right 1019701200 7:2475716-2475738 CCGGGCCCCAGCGGCCGTACTGG 0: 1
1: 0
2: 0
3: 12
4: 129
1019701191_1019701200 12 Left 1019701191 7:2475681-2475703 CCCCGGGGCCAGCGGGAAGATGC 0: 1
1: 0
2: 2
3: 10
4: 127
Right 1019701200 7:2475716-2475738 CCGGGCCCCAGCGGCCGTACTGG 0: 1
1: 0
2: 0
3: 12
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019701200 Original CRISPR CCGGGCCCCAGCGGCCGTAC TGG Exonic
901075792 1:6554138-6554160 CCGGGGCCCACGGGCCGCACCGG + Exonic
901465364 1:9417801-9417823 CGGGGCCCCAGAGGCTGTCCTGG - Intergenic
903628228 1:24745980-24746002 CCGGGCCCCGGCGCCCGGGCGGG - Intronic
904782868 1:32964064-32964086 CCGGGCACCAGCGGCAGTCGGGG + Exonic
905318355 1:37097719-37097741 CCCGGCCCTAGCAGCCGTAATGG + Intergenic
909001412 1:70221673-70221695 CCGGGCCCCAGCGGCGGGCCCGG + Exonic
910146516 1:84086308-84086330 CTGGGCCCCAGGGGCCAGACAGG - Intronic
920616338 1:207496298-207496320 CCGGGCGCCGGCGGCCCGACAGG - Exonic
921060182 1:211578740-211578762 AGGGGCCCCCGCGGCCGCACGGG + Exonic
923678627 1:236101181-236101203 CCGGGCCCCTGAGGCCGCCCTGG + Intergenic
1066064218 10:31750511-31750533 CCGGGGCCCAGCGGCTGCCCAGG - Intergenic
1067769696 10:49114724-49114746 CAGGGCAGCAGGGGCCGTACTGG - Intronic
1069705830 10:70458642-70458664 CCCGGCCCCGGCGGCGGGACCGG - Intergenic
1070116043 10:73529819-73529841 CTGGGCCCCAGCGCTTGTACTGG + Exonic
1070140141 10:73732783-73732805 CCGGGCCCCAGCCGCAGGGCTGG - Intergenic
1070954415 10:80454731-80454753 CCGAGCAGCAGCGGCCGTCCAGG - Intronic
1073101853 10:101010639-101010661 CCCGGCCCCTGCGGCCTAACTGG - Intronic
1076948186 10:133665619-133665641 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076949175 10:133668929-133668951 CCGGGCCCCTGCAGCCGCCCAGG + Intronic
1076950159 10:133672228-133672250 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076951144 10:133675527-133675549 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076952134 10:133678837-133678859 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076953122 10:133682147-133682169 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076954106 10:133685446-133685468 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076955090 10:133741798-133741820 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076956080 10:133745108-133745130 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076958057 10:133751727-133751749 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076959041 10:133755026-133755048 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076960030 10:133758336-133758358 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076961014 10:133761635-133761657 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1077250185 11:1557412-1557434 CGGGGCCCCGGCGGCAGGACTGG + Exonic
1077453890 11:2666498-2666520 CCAGGCCACAGCGGCCTTGCTGG - Intronic
1081709996 11:45210342-45210364 CAGGGCCCCAGCGGCCGAGGCGG + Intronic
1082811610 11:57482288-57482310 CCGGGCACCAGCGGCCTTCCCGG + Intergenic
1083886559 11:65576132-65576154 GCGGGCCCCAGCGGCGGCAGCGG + Exonic
1083945066 11:65919092-65919114 GCGGGCCTCAGCGGCCGCAGCGG + Exonic
1086001067 11:81986821-81986843 CCGGGCCTCAGCTGCCTCACGGG - Intergenic
1091023804 11:132124262-132124284 CAGGGCCCCAGGGGCTGGACAGG - Intronic
1091218197 11:133916466-133916488 CCAGGACCCAGCAGCCGTACCGG + Intronic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1103474804 12:121210426-121210448 CTGGGCCCCAGCCGCCGCGCCGG + Intronic
1103792241 12:123479845-123479867 CAGGGCCCCAGCGTCCTTTCTGG + Intronic
1105799580 13:23891818-23891840 CCGGGCCCCATGGGCCCTATTGG - Exonic
1105849467 13:24321217-24321239 CCGGGCCCCATGGGCCCTATTGG + Exonic
1112505166 13:99970904-99970926 CCGGGCCGCCGCTGCCGTCCGGG + Exonic
1115782655 14:36786829-36786851 CCAGGCCCCAGCCTCTGTACAGG + Intronic
1122481513 14:102050351-102050373 CCGGGCCCCATCAGCTGTCCCGG + Intronic
1122582315 14:102778098-102778120 CCGGGCCCCCCCGGCCGGCCCGG - Intronic
1125609505 15:40960997-40961019 CCGGGCCCCAGCCGCTGGGCTGG - Intergenic
1127995482 15:64151382-64151404 CCGGGCCTCAGCGCCGGTCCTGG - Intergenic
1129410809 15:75349259-75349281 CAAGGTCCCAGCGGCCGAACCGG - Exonic
1132398260 15:101489623-101489645 CCGGGCCCCGGCCGCCGCCCCGG - Exonic
1132541018 16:509770-509792 CCGGGCCCCAGAGGCTGTGAGGG - Intronic
1132619287 16:856714-856736 CCAGGCCCCAGCGGCCTGAAGGG + Intronic
1133020546 16:2964992-2965014 CCAGCCCCCAGCGGCCGTGGGGG - Exonic
1133212644 16:4272042-4272064 CCGGGCCGCGGCGCCCCTACCGG + Intronic
1134529971 16:14975362-14975384 CCGGGCCCCAGCCGCCCTCCCGG - Intronic
1135691292 16:24539837-24539859 CCGGGCCCCAGCCGGCGGCCGGG - Intronic
1136349328 16:29696880-29696902 CCGCGCCCCAGCTGCAGTGCTGG + Intronic
1136579374 16:31142558-31142580 CCGCCCCCTGGCGGCCGTACAGG + Exonic
1137668663 16:50266646-50266668 CCCGGCCCCAGCAGCCGGCCAGG - Intronic
1139866376 16:70065592-70065614 CCGGGCCCCAGCCGCCCTCCCGG + Intergenic
1143165194 17:4894047-4894069 CCGGGACCCAGCCCCCATACGGG + Exonic
1143598438 17:7929338-7929360 CCGGGCCCCGGGGGCGGTAATGG - Exonic
1144753546 17:17666355-17666377 CCGGGCCCCTGCTGGCCTACAGG + Intergenic
1146356968 17:32142580-32142602 GCGGGCCCCGGCGGCCGAAGAGG + Exonic
1148154283 17:45413777-45413799 CCTGGCCCCAGCAGCCCTGCTGG - Intronic
1148166941 17:45490447-45490469 CGGGGCCACAGCGGCGGTGCAGG + Intronic
1148795596 17:50195248-50195270 CAGGGCCCCGGCGGCCCTCCTGG - Exonic
1150398120 17:64836851-64836873 CGGGGCCACAGCGGCGGTGCAGG + Intergenic
1151801527 17:76382467-76382489 CCGGGCCCCAGCTCCCCTCCTGG - Intronic
1152919850 17:83060768-83060790 CCGGGTCCCACAGGCTGTACAGG - Intergenic
1155526607 18:26722067-26722089 CCGGGCTGCAGCGGCCGTAAAGG - Intergenic
1160222658 18:76988672-76988694 CAGGGCCACAGCGGCTGTGCAGG + Intronic
1160453551 18:78980498-78980520 CCGGGGCCCCGCGGCCGGCCTGG - Intronic
1160909777 19:1469152-1469174 CCGGGCCCCAGGGGCCGGGCGGG + Exonic
1161033911 19:2073350-2073372 CGAGGCCCCAGCGGCGGTTCGGG + Exonic
1161959643 19:7516452-7516474 CCGGGCCCCAGCGGCGGGATGGG - Intronic
1162455838 19:10784297-10784319 CCCGGCCCCCGCGCCCCTACTGG - Intronic
1162609525 19:11738589-11738611 CGGGGCCGCAGCGGCCGAGCAGG + Intronic
1163427426 19:17246857-17246879 GCGGGCCCCAGCCCCGGTACTGG - Intronic
1163443691 19:17334416-17334438 CCGGGCCGCAGCCGCAGTGCCGG + Intronic
1166000599 19:39875419-39875441 CTGGGCCCCAGCGGCCTGACAGG + Exonic
1166003397 19:39891674-39891696 CTGGGCCCCAGCGGCCTGACAGG + Exonic
1166986113 19:46660824-46660846 CCGGGCCGCAGCGGCCCTGGAGG - Exonic
926956634 2:18308915-18308937 CCAGGCCCCAGCTCCAGTACTGG - Intronic
930011521 2:46941400-46941422 CCGGGCCCCCGCTGCCGCCCGGG + Exonic
937045119 2:118847049-118847071 CCGGGCGCCAGCGGCAGCAGCGG - Exonic
937329302 2:121015902-121015924 CCGGGCCCCAGCGACCCTGCAGG - Intergenic
946392860 2:219426771-219426793 CAGGGCCCCAGGGGCCCCACAGG - Intergenic
947549690 2:231037527-231037549 CCGGGCCGCGGCGGCCGCAGAGG + Exonic
948087626 2:235264739-235264761 CCAGTGCCCAGCGGCCCTACGGG - Intergenic
948890574 2:240905246-240905268 CCGGGCCCCTGTGGCCTTGCTGG + Intergenic
1168965218 20:1894670-1894692 CCGGGCCCCGGCTGCTGTCCCGG - Intronic
1169483523 20:6006513-6006535 CCGGGCCCCACTGGCCGCCCGGG - Exonic
1180876705 22:19178272-19178294 CCGAGCGCCAGCGGCCGGGCGGG - Intronic
1183702235 22:39457288-39457310 CCGGGCCCCCGCCGCCGCCCCGG + Intergenic
1184644827 22:45890050-45890072 CCGGGCCGCAGAGCCGGTACCGG - Intergenic
949606840 3:5662525-5662547 CCAGGCCCCAGCTTCAGTACTGG + Intergenic
950487488 3:13282028-13282050 CTGGACCCCAGCGTCCCTACCGG - Intergenic
953407014 3:42664612-42664634 CCAGGCCCCAGCGGGTGCACGGG - Exonic
953931775 3:47009327-47009349 CGGGGCCCGAGCAGCCGGACTGG - Exonic
954152088 3:48662714-48662736 CCGGGCCCCTGCCGCCGCCCCGG + Exonic
968064474 3:195751030-195751052 CCGGGCCCCGAGGGCGGTACTGG + Exonic
968948866 4:3679956-3679978 CCCAGCCCCAGCGGCCGCAGTGG + Intergenic
977176558 4:93827397-93827419 CCGCGCCCCAGGGGCGGTGCAGG + Intergenic
979919505 4:126479619-126479641 CGGGGCCCCAGCGGCAGCCCTGG - Intergenic
985006902 4:185543184-185543206 ACGGGTCCCAGCGGCGGAACAGG - Intergenic
985452630 4:190069719-190069741 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
985472082 5:52955-52977 CCGGGCCCCAGGAGCCTTTCCGG - Intergenic
985675870 5:1231109-1231131 CCTGGCCCCAGCGGCAGAGCTGG - Intronic
989637933 5:43556598-43556620 CCAGCCCCCAGCGGCCTTCCCGG - Exonic
992218467 5:74548229-74548251 CTGGGCACCAGCGGCTGCACCGG - Intergenic
1006774134 6:36578641-36578663 CTGGGCCCCAGAGGCAGTATGGG + Intergenic
1007713470 6:43839230-43839252 CAGGGCCCCAGGGGCTGTGCTGG + Intergenic
1011734415 6:90296970-90296992 CCGCGCCCCAGCGGCCGGGGAGG - Intergenic
1016982129 6:149863645-149863667 GCGGGCGCCGGCGGCCGTGCGGG - Exonic
1018694535 6:166382039-166382061 CCGGTCACCTGCGGCCGTCCAGG - Intronic
1019343808 7:520202-520224 TCGGGCCCCAGCGGCGGCAGCGG + Intronic
1019457454 7:1137993-1138015 CCGGGACGCACCGGCCGCACCGG + Exonic
1019507872 7:1402280-1402302 CTGGGACCCAGCGGCCATGCTGG + Intergenic
1019701200 7:2475716-2475738 CCGGGCCCCAGCGGCCGTACTGG + Exonic
1020212410 7:6166567-6166589 CCAGGCCTCAGCGCCCGTGCTGG - Intronic
1021411277 7:20331597-20331619 CAGGGCCCCTGCGGCCCTCCCGG - Exonic
1022101790 7:27173512-27173534 CCGGGCCGCATCGGCCGAGCCGG + Exonic
1024981581 7:55161533-55161555 CCGGGCCCCAGCAGCCCTCGGGG - Exonic
1029456595 7:100675129-100675151 CCGGGCCCCAGGGGCCCGGCTGG - Intronic
1034467849 7:151240285-151240307 CCGGGGCCCTGGGGCCGTATGGG - Intronic
1035022718 7:155808747-155808769 CCCGGCCCCGGCGGCCCTGCTGG - Intronic
1035377508 7:158415218-158415240 CTGGGCCCCAGCGACAGTATTGG + Intronic
1039454200 8:37696955-37696977 CCGGGACCCAGCGGCAGTGTGGG + Intronic
1047262370 8:123274410-123274432 GCGCGCCCCAGCGGCCGTCCGGG + Exonic
1056243308 9:84669997-84670019 CCGGCACCCAGCGGCCGTGGCGG + Intronic
1057083479 9:92189363-92189385 CCGGGGCCCAGCAGCAGTCCCGG + Intergenic
1060200989 9:121651710-121651732 ACGGGCCCCATCGGCCGCTCCGG - Intronic
1060700472 9:125746541-125746563 CCGGGCCCCGGGGGCGGTGCCGG + Intergenic
1061131888 9:128713107-128713129 GCGCTCCCCAGCGGCCGCACTGG + Exonic
1061450196 9:130663555-130663577 CGGGGCCGCAGCGGCCGTCGGGG - Intergenic
1061450519 9:130664761-130664783 CGTTGCGCCAGCGGCCGTACAGG - Exonic
1062052797 9:134456193-134456215 CAGGGCCGCAGCGGCCGGAAGGG + Intergenic
1062406737 9:136400247-136400269 GCAGGCCGCAGCGGCCGTCCCGG - Intergenic
1198388174 X:136147810-136147832 CCGGGGGCCAGGGGCCGTCCCGG + Intronic