ID: 1019701568

View in Genome Browser
Species Human (GRCh38)
Location 7:2476922-2476944
Sequence GTCTGACCACGTGGTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019701558_1019701568 2 Left 1019701558 7:2476897-2476919 CCCCTGCCCTGGCTTCCCAGGTC No data
Right 1019701568 7:2476922-2476944 GTCTGACCACGTGGTGCTGCAGG No data
1019701560_1019701568 0 Left 1019701560 7:2476899-2476921 CCTGCCCTGGCTTCCCAGGTCCC No data
Right 1019701568 7:2476922-2476944 GTCTGACCACGTGGTGCTGCAGG No data
1019701562_1019701568 -5 Left 1019701562 7:2476904-2476926 CCTGGCTTCCCAGGTCCCGTCTG No data
Right 1019701568 7:2476922-2476944 GTCTGACCACGTGGTGCTGCAGG No data
1019701556_1019701568 6 Left 1019701556 7:2476893-2476915 CCGACCCCTGCCCTGGCTTCCCA 0: 1
1: 0
2: 18
3: 141
4: 1114
Right 1019701568 7:2476922-2476944 GTCTGACCACGTGGTGCTGCAGG No data
1019701559_1019701568 1 Left 1019701559 7:2476898-2476920 CCCTGCCCTGGCTTCCCAGGTCC No data
Right 1019701568 7:2476922-2476944 GTCTGACCACGTGGTGCTGCAGG No data
1019701561_1019701568 -4 Left 1019701561 7:2476903-2476925 CCCTGGCTTCCCAGGTCCCGTCT No data
Right 1019701568 7:2476922-2476944 GTCTGACCACGTGGTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019701568 Original CRISPR GTCTGACCACGTGGTGCTGC AGG Intergenic