ID: 1019701667

View in Genome Browser
Species Human (GRCh38)
Location 7:2477241-2477263
Sequence CACCCACCTGCAGCAGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019701667_1019701670 28 Left 1019701667 7:2477241-2477263 CCTAGGGCTGCTGCAGGTGGGTG No data
Right 1019701670 7:2477292-2477314 GTGCGTGTGCAGTGATCTCGTGG No data
1019701667_1019701671 29 Left 1019701667 7:2477241-2477263 CCTAGGGCTGCTGCAGGTGGGTG No data
Right 1019701671 7:2477293-2477315 TGCGTGTGCAGTGATCTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019701667 Original CRISPR CACCCACCTGCAGCAGCCCT AGG (reversed) Intergenic
No off target data available for this crispr