ID: 1019703792

View in Genome Browser
Species Human (GRCh38)
Location 7:2487979-2488001
Sequence CCTCACCTGGAGAAACAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019703787_1019703792 10 Left 1019703787 7:2487946-2487968 CCAGAAGAAAACAAGGGATGTGG No data
Right 1019703792 7:2487979-2488001 CCTCACCTGGAGAAACAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019703792 Original CRISPR CCTCACCTGGAGAAACAGTC TGG Intergenic
No off target data available for this crispr