ID: 1019704479

View in Genome Browser
Species Human (GRCh38)
Location 7:2490986-2491008
Sequence ATTTATACTCAGATGAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019704479_1019704481 -6 Left 1019704479 7:2490986-2491008 CCAGGGTTCATCTGAGTATAAAT No data
Right 1019704481 7:2491003-2491025 ATAAATTCAAGGAATGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019704479 Original CRISPR ATTTATACTCAGATGAACCC TGG (reversed) Intergenic
No off target data available for this crispr