ID: 1019709465

View in Genome Browser
Species Human (GRCh38)
Location 7:2511681-2511703
Sequence CTGAAGACAAGGCTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019709465_1019709481 12 Left 1019709465 7:2511681-2511703 CCCAGCCCCAGCCTTGTCTTCAG No data
Right 1019709481 7:2511716-2511738 GGACCACCTGGAGGCTGTGGGGG No data
1019709465_1019709489 25 Left 1019709465 7:2511681-2511703 CCCAGCCCCAGCCTTGTCTTCAG No data
Right 1019709489 7:2511729-2511751 GCTGTGGGGGTGGTGGGGGATGG No data
1019709465_1019709485 18 Left 1019709465 7:2511681-2511703 CCCAGCCCCAGCCTTGTCTTCAG No data
Right 1019709485 7:2511722-2511744 CCTGGAGGCTGTGGGGGTGGTGG No data
1019709465_1019709478 9 Left 1019709465 7:2511681-2511703 CCCAGCCCCAGCCTTGTCTTCAG No data
Right 1019709478 7:2511713-2511735 CTGGGACCACCTGGAGGCTGTGG No data
1019709465_1019709486 19 Left 1019709465 7:2511681-2511703 CCCAGCCCCAGCCTTGTCTTCAG No data
Right 1019709486 7:2511723-2511745 CTGGAGGCTGTGGGGGTGGTGGG No data
1019709465_1019709480 11 Left 1019709465 7:2511681-2511703 CCCAGCCCCAGCCTTGTCTTCAG No data
Right 1019709480 7:2511715-2511737 GGGACCACCTGGAGGCTGTGGGG No data
1019709465_1019709488 21 Left 1019709465 7:2511681-2511703 CCCAGCCCCAGCCTTGTCTTCAG No data
Right 1019709488 7:2511725-2511747 GGAGGCTGTGGGGGTGGTGGGGG No data
1019709465_1019709473 -10 Left 1019709465 7:2511681-2511703 CCCAGCCCCAGCCTTGTCTTCAG No data
Right 1019709473 7:2511694-2511716 TTGTCTTCAGGTCCTAAGGCTGG No data
1019709465_1019709474 -9 Left 1019709465 7:2511681-2511703 CCCAGCCCCAGCCTTGTCTTCAG No data
Right 1019709474 7:2511695-2511717 TGTCTTCAGGTCCTAAGGCTGGG No data
1019709465_1019709483 15 Left 1019709465 7:2511681-2511703 CCCAGCCCCAGCCTTGTCTTCAG No data
Right 1019709483 7:2511719-2511741 CCACCTGGAGGCTGTGGGGGTGG No data
1019709465_1019709492 30 Left 1019709465 7:2511681-2511703 CCCAGCCCCAGCCTTGTCTTCAG No data
Right 1019709492 7:2511734-2511756 GGGGGTGGTGGGGGATGGAGGGG No data
1019709465_1019709490 28 Left 1019709465 7:2511681-2511703 CCCAGCCCCAGCCTTGTCTTCAG No data
Right 1019709490 7:2511732-2511754 GTGGGGGTGGTGGGGGATGGAGG No data
1019709465_1019709475 0 Left 1019709465 7:2511681-2511703 CCCAGCCCCAGCCTTGTCTTCAG No data
Right 1019709475 7:2511704-2511726 GTCCTAAGGCTGGGACCACCTGG No data
1019709465_1019709491 29 Left 1019709465 7:2511681-2511703 CCCAGCCCCAGCCTTGTCTTCAG No data
Right 1019709491 7:2511733-2511755 TGGGGGTGGTGGGGGATGGAGGG No data
1019709465_1019709477 3 Left 1019709465 7:2511681-2511703 CCCAGCCCCAGCCTTGTCTTCAG No data
Right 1019709477 7:2511707-2511729 CTAAGGCTGGGACCACCTGGAGG No data
1019709465_1019709487 20 Left 1019709465 7:2511681-2511703 CCCAGCCCCAGCCTTGTCTTCAG No data
Right 1019709487 7:2511724-2511746 TGGAGGCTGTGGGGGTGGTGGGG No data
1019709465_1019709479 10 Left 1019709465 7:2511681-2511703 CCCAGCCCCAGCCTTGTCTTCAG No data
Right 1019709479 7:2511714-2511736 TGGGACCACCTGGAGGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019709465 Original CRISPR CTGAAGACAAGGCTGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr