ID: 1019712040

View in Genome Browser
Species Human (GRCh38)
Location 7:2522193-2522215
Sequence CTGGGGGAAGGGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019712025_1019712040 20 Left 1019712025 7:2522150-2522172 CCGAGAGGCTGTGTGAGGCAACA 0: 1
1: 0
2: 0
3: 13
4: 185
Right 1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG No data
1019712024_1019712040 21 Left 1019712024 7:2522149-2522171 CCCGAGAGGCTGTGTGAGGCAAC 0: 1
1: 0
2: 2
3: 24
4: 179
Right 1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG No data
1019712023_1019712040 22 Left 1019712023 7:2522148-2522170 CCCCGAGAGGCTGTGTGAGGCAA 0: 1
1: 0
2: 0
3: 31
4: 207
Right 1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019712040 Original CRISPR CTGGGGGAAGGGAGGGAGGA GGG Intronic
No off target data available for this crispr