ID: 1019717013

View in Genome Browser
Species Human (GRCh38)
Location 7:2543757-2543779
Sequence GGGGGTGGCCGCGGAGCACA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019717001_1019717013 19 Left 1019717001 7:2543715-2543737 CCCGAAGGTCGTGGTCAGGACGT 0: 1
1: 0
2: 0
3: 9
4: 47
Right 1019717013 7:2543757-2543779 GGGGGTGGCCGCGGAGCACAAGG 0: 1
1: 0
2: 0
3: 24
4: 285
1019717010_1019717013 -10 Left 1019717010 7:2543744-2543766 CCTGAGTGACCTTGGGGGTGGCC 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1019717013 7:2543757-2543779 GGGGGTGGCCGCGGAGCACAAGG 0: 1
1: 0
2: 0
3: 24
4: 285
1019717002_1019717013 18 Left 1019717002 7:2543716-2543738 CCGAAGGTCGTGGTCAGGACGTT 0: 1
1: 0
2: 0
3: 5
4: 33
Right 1019717013 7:2543757-2543779 GGGGGTGGCCGCGGAGCACAAGG 0: 1
1: 0
2: 0
3: 24
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019717013 Original CRISPR GGGGGTGGCCGCGGAGCACA AGG Exonic
900172111 1:1274168-1274190 GGGCGTGGGAGCGGAGGACAAGG - Intergenic
900220066 1:1503682-1503704 TGGGGAGGCCGGGGCGCACATGG + Intergenic
900222369 1:1516109-1516131 TGGGGAGGCCGGGGCGCACATGG + Intronic
900323180 1:2095031-2095053 GGGTGTGGCGGAGCAGCACATGG - Intronic
900895870 1:5482490-5482512 CGAGGTGGCGGTGGAGCACATGG - Intergenic
901054423 1:6442121-6442143 GGGGGTGGCACCAGAGCCCAGGG + Intronic
901805576 1:11736452-11736474 GGAGGTGGCAGCGGAGGGCAAGG + Intronic
902479892 1:16706215-16706237 GGGGGTGGCACCAGAGCCCAGGG - Intergenic
902603607 1:17556275-17556297 GGGGGGGGCCTGGGAGCACAGGG + Intronic
903768524 1:25749825-25749847 AGGGGTGGCTGTGGAGGACAAGG - Intronic
904532302 1:31177128-31177150 CGGGGTGGCCGCCGGGCAGAGGG - Intergenic
904760924 1:32804267-32804289 CGGGGTGGCCGCCGGGCAGAGGG + Intronic
904935864 1:34129110-34129132 GGGGGTGGCAGCGGGACCCATGG - Intronic
905202181 1:36322718-36322740 GGGGTTGGCTGCGGGGCACAGGG + Exonic
905233520 1:36530146-36530168 GGGGGTGGGGGTGGGGCACATGG + Intergenic
906308885 1:44738848-44738870 TGGGGTGGCGGCGGGGCAGAGGG - Intergenic
906356902 1:45115172-45115194 CGGGGTGGCCGCCGGGCAGAGGG + Intronic
907434076 1:54432700-54432722 GGGGGTGGGGGTGGATCACAAGG + Intergenic
908128254 1:61050843-61050865 GCGGGAGGCCGCGGAGAACCGGG + Intronic
908355577 1:63322979-63323001 GGGGGCTGCCACGGAGCTCAGGG - Intergenic
908595812 1:65687844-65687866 GCAGGTGGCAGCAGAGCACAAGG - Intergenic
915033259 1:152901994-152902016 GAGGGTGGCTTCGGAGCACAGGG + Intergenic
916037437 1:160933620-160933642 CGGGGTGGCGGCGGGGCAGAGGG - Intergenic
916104262 1:161419530-161419552 GGTGGTGGCCTGGGAGCAAATGG - Intergenic
916663747 1:166947400-166947422 GGGGCTGGCCACGGAGGAAAGGG - Intronic
918216283 1:182394232-182394254 GGGGCTGGCCAAGGAGGACAAGG - Intergenic
920036600 1:203069703-203069725 GGGGGTGGTGGCAGTGCACAGGG + Intronic
920065483 1:203266657-203266679 CGGGGTGGCAGCTGAGCAGAGGG + Intronic
920294957 1:204950421-204950443 TGGGGAGGGCGCTGAGCACAGGG - Intronic
920336590 1:205249257-205249279 GGGAGTGGACGGAGAGCACAGGG - Intronic
920742542 1:208595315-208595337 GGAGGTGGCCTCTGAGCAAAAGG + Intergenic
921068100 1:211637132-211637154 GGGGGAGGCAGAGGAGCATAGGG + Intergenic
922542575 1:226430099-226430121 GGGGATCCCCGCGGGGCACAGGG + Intergenic
923733945 1:236583079-236583101 GAGGGTGGCCGTGGAGGACTCGG - Exonic
1063609027 10:7547601-7547623 GCTTGTGGCCGTGGAGCACAGGG - Intergenic
1065903705 10:30229865-30229887 GGGTGTGGCAGGGGAACACATGG + Intergenic
1067830912 10:49610594-49610616 TCAGGTGGCCGCGGAGCTCATGG - Exonic
1067836406 10:49644301-49644323 GGAGGTGGCCATGGAGCCCACGG + Intronic
1068774741 10:60857481-60857503 GGGGATGGGAGAGGAGCACAGGG + Intergenic
1069438516 10:68407249-68407271 GGTGGTGGCCGCCGAGCGCCTGG - Intronic
1069831485 10:71284810-71284832 GGTGGTGCCCGCGGAGCTCCAGG - Exonic
1070147507 10:73785751-73785773 GGGGGTGGCCGGGGCGCTCAGGG - Exonic
1072071669 10:91923970-91923992 GGCCCAGGCCGCGGAGCACAGGG - Exonic
1072641143 10:97212078-97212100 GGGGGTGGGAGGGGAGCAGAGGG - Intronic
1073019570 10:100431825-100431847 GGGGGCGGGTGCGGATCACAAGG - Intergenic
1075645302 10:124092752-124092774 GGGTGTGGGGGCGGAGCGCAAGG + Intronic
1076497292 10:130905475-130905497 GGGGATGGCCAGGGAGGACAGGG - Intergenic
1077108291 11:851229-851251 GGGGGTGGCCGAGGATGACCTGG + Intronic
1079536226 11:21518652-21518674 GGTGGTGGCCAGGGAGCAAAGGG - Intronic
1080458442 11:32434951-32434973 GGGGGTGGCGGCGGAGCCGGTGG + Exonic
1082784086 11:57307350-57307372 CGGGGTGGTGACGGAGCACAGGG - Intronic
1082813680 11:57494231-57494253 TGGGATGGCCGCCGAGCACTAGG - Intronic
1083809420 11:65095474-65095496 GGGTGGGGGCGCGGATCACAAGG - Intronic
1084667630 11:70585009-70585031 GGTGGTAGCCACGGAGCTCAGGG - Intronic
1084706819 11:70820534-70820556 CGAGGTGGCCGTGGAGCAGACGG + Intronic
1086420234 11:86631275-86631297 GGGGGAGGCAGGAGAGCACAGGG - Intronic
1087499140 11:98929179-98929201 GGGGGTGGTGGGGGGGCACAGGG - Intergenic
1088401312 11:109424114-109424136 GGTGGAGGCGGAGGAGCACAGGG - Exonic
1088789115 11:113208631-113208653 GGGGGTGGTCGCAGTGCAGAGGG - Intronic
1089247583 11:117133462-117133484 AGGGGTGGCTGCGGATCACAAGG + Intergenic
1090663958 11:128902514-128902536 GGAGGGGGCTGGGGAGCACAGGG + Exonic
1093195392 12:16124404-16124426 GGGTGAGGCCGGGGGGCACAGGG + Intergenic
1093980063 12:25466327-25466349 GGGGGTGTACGCAAAGCACACGG + Intronic
1094670352 12:32563204-32563226 GGGGGTGGCTGCCGGGCAGAGGG + Intronic
1095441002 12:42238471-42238493 GGGGGTGGCCGCGGTGGCCGCGG + Intronic
1096105890 12:48997061-48997083 GGGGCTGGGCGCGGACCCCAGGG - Exonic
1097154571 12:57003504-57003526 GGATGTGGCCCCGGACCACATGG + Exonic
1097686238 12:62693725-62693747 GGAGGTGGGCGGTGAGCACAAGG - Intronic
1101038894 12:100733923-100733945 GGGGGTGGCTGGGGAGGAGAGGG + Intronic
1101239511 12:102824342-102824364 GGAGGCGGCCGCGGAGCCCCCGG - Intergenic
1102253799 12:111405148-111405170 GGGGGTGGGCGCAGAGGCCACGG + Intergenic
1102960620 12:117091099-117091121 GGTGGTGGCCACGGAGCACTAGG - Intronic
1103698593 12:122835797-122835819 GGGGGCGGCAGCGGAGCTCTCGG - Intronic
1103738184 12:123073894-123073916 GTGGGTGGCCGTGGAGTGCAGGG + Intronic
1105251134 13:18699098-18699120 GGGGGTGGGCGCAGAGCCCATGG - Intergenic
1106009142 13:25801228-25801250 TGGGATGGCTGCGGAGCCCAGGG + Intronic
1106028479 13:25977018-25977040 GGGGGTGGGGGTGGATCACAAGG - Intronic
1111388639 13:87561889-87561911 CGGGGTGGCGGCGGGGCAGAGGG - Intergenic
1112306667 13:98280470-98280492 TGGGGTGAGCGGGGAGCACATGG - Intronic
1112734367 13:102400527-102400549 GGGGGCGGCCGCGGAGCTGTGGG - Intronic
1113786159 13:113003193-113003215 GGGGTTGGCTGTGGAGCACTGGG + Intronic
1118030418 14:61812844-61812866 GGGGGAGGCCGCGGTGCCCAGGG + Intergenic
1118095144 14:62527995-62528017 AGGGGTGGCCAGGGAGTACATGG + Intergenic
1119383094 14:74240834-74240856 GGGGCTGGCCGCGCAGGGCAGGG + Intronic
1120200587 14:81533933-81533955 GGGGGTGGGCGGGGAGACCATGG - Intergenic
1122635399 14:103127354-103127376 GGAGGCGGCCGAGGAGCGCATGG + Exonic
1122853320 14:104548229-104548251 GGTGGTGGCTGCGGACAACATGG - Intronic
1125269433 15:37921810-37921832 GGGGGTGGGGGCGGAGGGCATGG - Intergenic
1125919285 15:43515966-43515988 GGGGGTGGCAGCTGAGAATATGG + Intronic
1127207150 15:56733167-56733189 GGAGGTGGCGGAGGAGCAGAAGG + Intronic
1127849075 15:62897304-62897326 GGTGGGGGCCGCGGGGCAGAGGG + Intergenic
1128099849 15:64989760-64989782 GGGGCGGGCGGCGGAGCACTCGG + Exonic
1128249870 15:66156511-66156533 GGGAGTGGTGGCCGAGCACAGGG - Intronic
1129752782 15:78077571-78077593 GGGGGCGGCCGCGGAGCCCGGGG - Exonic
1129905885 15:79186815-79186837 GCCGGTGGGCCCGGAGCACAGGG - Intergenic
1132223114 15:100119679-100119701 GGGTCTGGAGGCGGAGCACATGG + Intronic
1132583125 16:694329-694351 GGGGGTGGCCCCGGGGCAGTTGG + Exonic
1135040601 16:19114423-19114445 GGCGGTGGCCGAGCAGCCCAGGG - Exonic
1136631013 16:31489307-31489329 GGGGATGGGCGCGGTGCACAGGG - Exonic
1137438978 16:48482964-48482986 CGGGGTGGCCGCCGGGCAGAGGG + Intergenic
1137456887 16:48624155-48624177 GGGGGGGGGCGCGGATCACGAGG + Intergenic
1138026917 16:53529108-53529130 GCAGGTGGCTGCGGAGCCCAGGG - Intergenic
1139521734 16:67486680-67486702 GGGTGTGGGCCCGGAACACAGGG + Intergenic
1140602929 16:76500086-76500108 CGGGGTGGCGGCGGGGCAGAGGG + Intronic
1141595731 16:85095788-85095810 GGGGGTGGCCGCCTCCCACAGGG - Intergenic
1141839939 16:86567907-86567929 GGGGGTGGCCGGGGCGCCCTTGG - Exonic
1142486278 17:249483-249505 GGGGGTGGCGGTGGTGCCCATGG - Intronic
1142593630 17:1019095-1019117 GGGGGTGGCCTCCCAGCACCAGG - Intronic
1142876271 17:2853608-2853630 GGTGGAGGACGCGGGGCACAGGG - Intronic
1143289815 17:5820269-5820291 GGGTGGGGGCACGGAGCACATGG - Intronic
1143566624 17:7725666-7725688 GGGGGTGGGGGCGAATCACAGGG - Intronic
1144942306 17:18950196-18950218 GAGGGTGGCAGCGGAGGACATGG - Intergenic
1145243089 17:21251070-21251092 GGGAGTGGCTGTGCAGCACAGGG - Intronic
1146271362 17:31487949-31487971 GGGGGCGGGGGCGGAGGACAGGG - Intronic
1146818112 17:35961043-35961065 GGGGGTGGGGGCGGATCACGAGG + Intergenic
1147123889 17:38352494-38352516 GGGGGCGGCTGAGGAGGACACGG - Exonic
1147248686 17:39139529-39139551 GGGGTTGGCCCCGGAGGACAGGG - Intronic
1147534313 17:41308960-41308982 GGTGGTGGCCTCACAGCACACGG + Exonic
1147613141 17:41813033-41813055 GGGGGGGCCCGCGGGGAACATGG - Exonic
1150616305 17:66775161-66775183 GGGGGTGGGCACTGACCACAGGG - Intronic
1152077458 17:78168423-78168445 GGCTGTGGCCGCGGAGCACCCGG - Intergenic
1152269727 17:79317116-79317138 GGGGGTGGCCGTGGGGGAGATGG - Intronic
1152699344 17:81811348-81811370 CGGGGCGGCCGCAGAGGACAGGG + Intronic
1152732004 17:81977195-81977217 GGAGGTGGACGCTGACCACAGGG + Intronic
1155054258 18:22170822-22170844 GGGGGTGGGCGGGGAGGACGCGG + Intronic
1157275718 18:46310020-46310042 GGGGGTGCACACAGAGCACAAGG + Intergenic
1157654210 18:49369356-49369378 GGGGGTGGCCTCCTAACACATGG + Intronic
1158938327 18:62384860-62384882 GGCGGCGGCTGCGGAGCCCATGG + Exonic
1160040106 18:75337441-75337463 GGTGGGGGCCGAGGGGCACAGGG + Intergenic
1160122898 18:76146364-76146386 GAGGGTGGCGGCAGAGCCCAGGG - Intergenic
1160765149 19:804357-804379 TGGGCTGGCCGCGCAGCACAGGG - Exonic
1160778267 19:866627-866649 GCGGGTGGACGGGGAGGACATGG - Intergenic
1160778284 19:866678-866700 GCGGGTGGACGGGGAGGACATGG - Intergenic
1160778318 19:866780-866802 GCGGGTGGACGGGGAGGACATGG - Intergenic
1160823213 19:1067718-1067740 AGGGCTGGCCGCGGGGCCCAGGG + Intronic
1160905564 19:1450226-1450248 CGGGGTGGCCTCGGAGCGCGCGG - Intronic
1160940749 19:1619417-1619439 CGGCGTGGCTGCGGAGCACGTGG + Exonic
1161159664 19:2754930-2754952 GGGGGTGGCAGACGAGCCCACGG - Exonic
1161252034 19:3285652-3285674 GGGGGTGGGGGCGGACCCCATGG - Intronic
1161264747 19:3359105-3359127 GTGGGTGTCCGCCGGGCACACGG - Intergenic
1162410649 19:10503133-10503155 GGGGATGGCCGGGGCGCGCAGGG + Intronic
1162421585 19:10568750-10568772 GGGCGCGGCCGCGGTGCACCCGG + Exonic
1162872900 19:13599546-13599568 GGGGGTGTCCGGGGGGCATAAGG + Intronic
1163406608 19:17126894-17126916 GGGGGTGGGGGTGGATCACAAGG - Intronic
1163720415 19:18895836-18895858 CGCAGTGGCCGCGGAGCGCAGGG + Exonic
1165448726 19:35870391-35870413 GGGCGTGGCCAATGAGCACAAGG + Intronic
1165721461 19:38082319-38082341 GGGGGCGGCGGCGGAGCCAAGGG + Exonic
1167744016 19:51340499-51340521 GGGCGTGGTCGCTGCGCACAGGG + Exonic
1168404240 19:56102710-56102732 AGGGGTGGCCCAGGAGCGCAGGG - Intronic
1168679129 19:58300997-58301019 TGGGGAGGGCGTGGAGCACAAGG - Exonic
1202713929 1_KI270714v1_random:32121-32143 GGGGGTGGCACCAGAGCCCAGGG - Intergenic
925360608 2:3278007-3278029 GAGGGAGGCCTGGGAGCACAGGG - Intronic
925615120 2:5737881-5737903 GGGCGTGGCCGAGGAGGAAATGG + Intergenic
927755673 2:25705918-25705940 TGGGGTGGCCGCCGGGCAGAGGG - Intergenic
929107831 2:38381234-38381256 GTGGGGGGGCGCGGATCACAAGG + Intergenic
929592063 2:43153903-43153925 TGTGGTGGCCGCAGAGCCCATGG + Intergenic
934552766 2:95272282-95272304 GGGGGTGGGAGTGGAGCACGTGG + Intergenic
936022103 2:109002625-109002647 GAGGGTGGCCGGGGAGCAGAGGG - Intergenic
936038142 2:109128957-109128979 GGGGGTGCGCGCGGAGGTCACGG - Intergenic
938191154 2:129281957-129281979 GGGTGTGGACAAGGAGCACAGGG - Intergenic
938341120 2:130537391-130537413 GAGGGTGGCCCCAGAGCAGAGGG + Intergenic
938348710 2:130583318-130583340 GAGGGTGGCCCCAGAGCAGAGGG - Intronic
940666422 2:156616056-156616078 GGGTGTGGCAGTGGAGAACAGGG + Intergenic
945864836 2:215163503-215163525 GGGGGTGGCTGCCGGGCAGAGGG + Intergenic
946404474 2:219485034-219485056 GGCGCTGGCCTCGGAGCCCAGGG - Exonic
947066149 2:226227700-226227722 TGGGGTGGCCTTGGAGGACAAGG + Intergenic
947619555 2:231580817-231580839 GGGGGAGGACGCGGGGCACAGGG + Intergenic
947793379 2:232880031-232880053 GGGGGTGGCAGCCGAGCACGTGG + Intronic
947793392 2:232880090-232880112 GGGGGTGGCAGCCGAGCATGTGG + Intronic
948387569 2:237591147-237591169 GGGCGTGGCCTCCGTGCACATGG + Exonic
1169214840 20:3786837-3786859 GGGGGTGGGCGCGGAGGGCGGGG - Intronic
1170991249 20:21303537-21303559 GGGGCAGGCGGCGGAGCCCATGG - Intronic
1171151090 20:22826997-22827019 GGGTGTGGCCCCGGATCCCATGG + Intergenic
1175213024 20:57373252-57373274 GGGGGCGGGGGAGGAGCACAGGG + Intronic
1175462159 20:59159797-59159819 GGGGGAGGCAGCGGAACCCAGGG - Intergenic
1175827295 20:61943062-61943084 GGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827306 20:61943112-61943134 GGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827316 20:61943162-61943184 GGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827326 20:61943212-61943234 GGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827336 20:61943262-61943284 GGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827347 20:61943312-61943334 GGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827368 20:61943412-61943434 GGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827378 20:61943462-61943484 GGGGGCGGCCACGGTGCAGAGGG - Intergenic
1175827389 20:61943512-61943534 GGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827399 20:61943562-61943584 GGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827410 20:61943612-61943634 GGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827429 20:61943712-61943734 GGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827440 20:61943762-61943784 GGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827614 20:61944739-61944761 GGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827712 20:61945339-61945361 GGGGGCGGCCACGGTGCAGATGG - Intergenic
1175827877 20:61946389-61946411 GGGGGCGGCCACGGTGCAGATGG - Intergenic
1175828057 20:61947529-61947551 AGGGGTGGCCACGGTGCAGACGG - Intergenic
1176184860 20:63772891-63772913 GGGAGTGGCCGCGGAGCCTGAGG - Intronic
1176890003 21:14304005-14304027 GGGGGTGGGAGCGGAGCAGAAGG - Intergenic
1177775723 21:25563589-25563611 GGGGGTGTCGGCAGACCACAGGG + Intergenic
1177788237 21:25695504-25695526 CGGGGCGGCCGCGGGGCAGAGGG + Intronic
1178743413 21:35224602-35224624 GGGGGGGGGGGCGGATCACAAGG + Intronic
1178933835 21:36843429-36843451 TGGGGTGGGCGGGGAGGACAGGG - Intronic
1179573574 21:42292433-42292455 GGGGCTGGCCTTGGGGCACACGG - Intronic
1180069160 21:45427521-45427543 AGGGGTGGCCGCGGAGCAAGAGG - Intronic
1181049884 22:20233470-20233492 GGGGGTGCCCGCTGTGCACTCGG - Intergenic
1183948624 22:41340460-41340482 GAGGCTGGGGGCGGAGCACAAGG + Intronic
1184156396 22:42670259-42670281 AGGGGTGGACTCAGAGCACAAGG - Intergenic
1184302699 22:43571808-43571830 GGGGGTGACCGTGGAGCAAGGGG - Intronic
1184468952 22:44684721-44684743 GGGTGTGGGTGCAGAGCACAGGG + Intronic
1185044643 22:48522917-48522939 GGGTGGGGCTGCTGAGCACAGGG + Intronic
1185408444 22:50670938-50670960 GGGGATGGCCTGGGAGCAGAGGG + Intergenic
949772948 3:7598331-7598353 GGGGGAGGTTGAGGAGCACATGG + Intronic
950382500 3:12628756-12628778 GGGGGGGGTGGCGGGGCACATGG + Intronic
950477242 3:13221925-13221947 GATGGTAGCCGCGGAGCAGAGGG + Intergenic
952892679 3:38053661-38053683 CGGGGTGGCCGCTGGGCAGAGGG - Intronic
954338231 3:49932919-49932941 GTGGGTGGATGCGGATCACAAGG - Intergenic
954664730 3:52245789-52245811 GGGGCTGCCCGCGGAGCGCGGGG - Intronic
958987461 3:100798968-100798990 GAGGGTGGCCCAAGAGCACAGGG - Intronic
960770703 3:121190582-121190604 TGGGGTGGCGGCCGGGCACAGGG + Intronic
960921165 3:122747847-122747869 CGGGGTGGCGGCCGGGCACAGGG - Intronic
961632392 3:128310817-128310839 GGGTGGGGCAGCAGAGCACAGGG - Intronic
968048110 3:195635346-195635368 GGGGGAGGCCGCGGGGCAACCGG - Intergenic
968099292 3:195954274-195954296 GGGGGAGGCCGCGGGGCAACCGG + Intergenic
968306501 3:197654575-197654597 GGGGGAGGCCGCGGGGCAACCGG + Intergenic
968483658 4:848568-848590 GGAGGGGGCCGCACAGCACAGGG + Intergenic
968652509 4:1765871-1765893 GGAGGAGGGCGTGGAGCACAGGG + Intergenic
968684612 4:1949074-1949096 GGGGGAGCCAGGGGAGCACAGGG - Intronic
969627094 4:8311185-8311207 GAGGGTGGCCCCAGAGCCCAGGG - Intergenic
972613807 4:40679388-40679410 GGGGGTGTCCTCTGAGCACTTGG - Intergenic
975908934 4:79245846-79245868 AGGGGTGGCCGCCGGGCAGAGGG - Intronic
978366662 4:107989964-107989986 GGCGGTGGACGAGGAGGACACGG - Exonic
978778207 4:112523196-112523218 GGGGGCGGCCGCGGTGCGCCCGG + Intergenic
979702578 4:123685223-123685245 GGGGGTGGCGGCCGGGCAGAGGG - Intergenic
982306532 4:153937590-153937612 AAGGGTGGCCGTGGAGCACTGGG + Intergenic
984680935 4:182608691-182608713 GGGGGTGGCCGCTCAGGTCAGGG + Intronic
985269270 4:188179000-188179022 GGGGCTGCCCGCGGCGCCCATGG + Intergenic
985542032 5:491809-491831 GGTGGTGGCCGCGTTCCACACGG + Exonic
985551296 5:534838-534860 CGGGGTGGACGCGGAGCTGAGGG + Intergenic
985743468 5:1633664-1633686 GGGGGAGGCCGCTGGGGACACGG + Intergenic
985743479 5:1633695-1633717 GGGGGAGGCCGCGGGGCAACCGG + Intergenic
985822921 5:2172603-2172625 AGGGGTGCCCGCCCAGCACAGGG + Intergenic
991000186 5:61775077-61775099 GGGAGTGGATGCTGAGCACAGGG - Intergenic
991575672 5:68100928-68100950 GGGGGTGGGAGGGGAGGACAAGG + Intergenic
999498798 5:152126044-152126066 GGGGGTGGGAGTGGAGCAGAGGG - Intergenic
1001640662 5:173242154-173242176 AGGGGTGGCAGCGGAGCCCGTGG + Intergenic
1002855659 6:1035769-1035791 GAGGATGGGCGCGCAGCACAAGG + Intergenic
1002896833 6:1384345-1384367 GCCGGGGGCCGCGGAGCAAAAGG + Intergenic
1003872331 6:10412867-10412889 GACGGTGGCCGGGGAGCGCACGG - Intronic
1004044867 6:12013084-12013106 GGGGGCGGCGGCGGAGCAGGCGG + Intronic
1006826922 6:36941940-36941962 AGGGGTGGCGGCGGGGCAGAGGG - Intergenic
1006906832 6:37538424-37538446 GGGGAGGGGCCCGGAGCACAAGG - Intergenic
1013498184 6:110719961-110719983 GGGGGGGGGGGCGGATCACAAGG - Intronic
1013803314 6:113970905-113970927 GGCGGTGGCCGGGGAGCCCATGG - Exonic
1018774357 6:166999433-166999455 AGTGGTGGCCGAGGAGGACACGG + Exonic
1018939493 6:168299752-168299774 CGCGGTGGCCCCGGAGCACATGG - Intronic
1019420708 7:949468-949490 GGCAGTGGCCTAGGAGCACAGGG + Intronic
1019495954 7:1340827-1340849 TGGGGTGGCTCTGGAGCACAAGG - Intergenic
1019511245 7:1418717-1418739 GGGGGGGGGGGTGGAGCACAGGG - Intergenic
1019717013 7:2543757-2543779 GGGGGTGGCCGCGGAGCACAAGG + Exonic
1020106000 7:5422625-5422647 GGGGCTGGGCGCGGAGTGCAGGG - Intronic
1020123201 7:5517265-5517287 GGGGGTGGCTGGGGAACAGAGGG + Intergenic
1023990505 7:45125708-45125730 GGAGCTGGCCTCGGGGCACACGG + Intergenic
1024109479 7:46130808-46130830 TGTGGTGGCCGCGGAGAAGAGGG - Intergenic
1025262250 7:57426875-57426897 GGGGGGGGGCGGGGTGCACAGGG + Intergenic
1025826771 7:65017150-65017172 GGAGGTGGGTGGGGAGCACAGGG - Intergenic
1025914322 7:65853599-65853621 GGAGGTGGGTGGGGAGCACAGGG - Intergenic
1025975436 7:66365790-66365812 GGAGGTGGGTGGGGAGCACAGGG + Intronic
1032076527 7:128838664-128838686 GGAGGTGGCCCTGGAGGACAAGG + Exonic
1032120653 7:129153217-129153239 GGGGCTGGGGGCGGAGGACAGGG + Intronic
1032156792 7:129476091-129476113 GGGGGTGGCGGCCGGGCAGAGGG + Intronic
1033514490 7:142092682-142092704 AGGGGTGGCCGCACAGCTCAGGG + Intronic
1037668795 8:20996901-20996923 GGGGGAGGCTGCGGAGCGCGGGG - Intergenic
1040059726 8:43093728-43093750 GGGGCTGGGCGCGGTGGACACGG - Intronic
1040564387 8:48552950-48552972 GGGAGTGGCCTCAGAGCACCAGG + Intergenic
1040950967 8:52939133-52939155 GGGGGTGGGCGCGGCGGTCAGGG + Exonic
1046766403 8:118074511-118074533 GGTGGTGGCCGCGGTGCGCGGGG - Intronic
1047424986 8:124736931-124736953 GGGGGTGGCAGGGGAACAGAGGG + Intergenic
1047739384 8:127794546-127794568 GCGTGTGGCGGCCGAGCACATGG + Intergenic
1048843747 8:138587154-138587176 GGGGGTGGGCAGGGAGCACATGG + Intergenic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049643800 8:143727265-143727287 GGTGGAAGCCGCGGAGCGCACGG + Exonic
1055514333 9:77020841-77020863 GGCCGCGGCCGCGGAGCACACGG - Exonic
1057431209 9:94996026-94996048 GGGGGTGGAAGCAGAACACAGGG + Intronic
1060700412 9:125746313-125746335 GGGCGCGGCGGGGGAGCACACGG + Intergenic
1061479668 9:130891068-130891090 GGGCTTGGCCGCGGGGCACCGGG + Intergenic
1061480886 9:130897289-130897311 AGGGGTGCCTGCGGGGCACAGGG - Intergenic
1062043867 9:134416309-134416331 GGGGGTGGGCGCTCAGCAAAGGG - Intronic
1062084405 9:134641504-134641526 TGGGGCGGCCTCGGAGCCCAGGG - Intergenic
1062178263 9:135176327-135176349 GGGCGGGGCCGCAGAGCCCAGGG + Intergenic
1062226490 9:135455398-135455420 GGGGCTGGCTGTGCAGCACAGGG - Intergenic
1062361157 9:136188822-136188844 GGGGGTGGGGGCGGATCACGAGG + Intergenic
1185456134 X:311752-311774 CGGGGTGCCCGAGGAGCTCAGGG - Intronic
1187212454 X:17244802-17244824 CGGGGTGGCCGCCGGGCAGAGGG + Intergenic
1188661029 X:32758813-32758835 AGGGGATGCTGCGGAGCACATGG - Intronic
1189377403 X:40476242-40476264 GGGGGTGGGGGTGGGGCACATGG - Intergenic
1190554270 X:51618114-51618136 GGAGGCCGCCGAGGAGCACAAGG - Intergenic
1190560565 X:51682072-51682094 GGAGGCCGCCGAGGAGCACAAGG - Intergenic
1190563726 X:51711249-51711271 GGAGGCCGCCGAGGAGCACAAGG + Intergenic
1191894150 X:65975237-65975259 CGGGGTGGCGGCGGGGCAGAGGG + Intergenic
1193114847 X:77766384-77766406 CGGGGTGGCAGCGGGGCAGAGGG + Intronic
1194656040 X:96575029-96575051 GGGGGTGGATGAGGGGCACAAGG - Intergenic
1195626152 X:107007102-107007124 GGGGGTGGTAGTGGAGCAGAGGG - Intergenic
1196439276 X:115703611-115703633 GGCGCTGGCCGCTGAGCCCAAGG + Intergenic
1196965205 X:121047737-121047759 GTGGTTGGCCGCGGAGCCCAGGG - Exonic
1201440256 Y:14000922-14000944 TGGGGTGGCCGCCGGGCAGAGGG + Intergenic
1201444315 Y:14041786-14041808 TGGGGTGGCCGCCGGGCAGAGGG - Intergenic
1202119708 Y:21510019-21510041 GGGGATGGGCGCGGAGCTCCCGG - Intergenic
1202122161 Y:21533560-21533582 GGGGATGGGCGCGGAGCTCCCGG - Intronic
1202124691 Y:21557479-21557501 GGGGGTGCCCTGAGAGCACATGG - Intergenic
1202154317 Y:21871901-21871923 GGGGGTGCCCTGAGAGCACATGG + Intergenic
1202156846 Y:21895823-21895845 GGGGATGGGCGCGGAGCTCCCGG + Intronic
1202159292 Y:21919364-21919386 GGGGATGGGCGCGGAGCTCCCGG + Intergenic
1202185741 Y:22184279-22184301 GGGGATGGGCGCGGAGCTCCCGG + Intergenic
1202205619 Y:22402117-22402139 GGGGATGGGCGCGGAGCTCCCGG - Intronic