ID: 1019720231

View in Genome Browser
Species Human (GRCh38)
Location 7:2565374-2565396
Sequence CAGGCTGGAGGCAGCACGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1649
Summary {0: 1, 1: 1, 2: 5, 3: 61, 4: 1581}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019720221_1019720231 15 Left 1019720221 7:2565336-2565358 CCTGACTGCGTTTCACCTCTTCC 0: 1
1: 0
2: 0
3: 13
4: 107
Right 1019720231 7:2565374-2565396 CAGGCTGGAGGCAGCACGGCTGG 0: 1
1: 1
2: 5
3: 61
4: 1581
1019720225_1019720231 -6 Left 1019720225 7:2565357-2565379 CCCTGCACTATGACCGGCAGGCT 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1019720231 7:2565374-2565396 CAGGCTGGAGGCAGCACGGCTGG 0: 1
1: 1
2: 5
3: 61
4: 1581
1019720226_1019720231 -7 Left 1019720226 7:2565358-2565380 CCTGCACTATGACCGGCAGGCTG 0: 1
1: 0
2: 0
3: 8
4: 154
Right 1019720231 7:2565374-2565396 CAGGCTGGAGGCAGCACGGCTGG 0: 1
1: 1
2: 5
3: 61
4: 1581
1019720222_1019720231 0 Left 1019720222 7:2565351-2565373 CCTCTTCCCTGCACTATGACCGG 0: 1
1: 0
2: 2
3: 8
4: 114
Right 1019720231 7:2565374-2565396 CAGGCTGGAGGCAGCACGGCTGG 0: 1
1: 1
2: 5
3: 61
4: 1581
1019720220_1019720231 20 Left 1019720220 7:2565331-2565353 CCGGTCCTGACTGCGTTTCACCT 0: 1
1: 0
2: 1
3: 14
4: 123
Right 1019720231 7:2565374-2565396 CAGGCTGGAGGCAGCACGGCTGG 0: 1
1: 1
2: 5
3: 61
4: 1581

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019720231 Original CRISPR CAGGCTGGAGGCAGCACGGC TGG Intronic
900085399 1:892072-892094 CAGGCATGAGGCACCACGCCTGG + Intergenic
900085525 1:893497-893519 CAGGCAGGAGCCACCACGCCTGG - Intergenic
900184887 1:1328367-1328389 CAGACTGGGGGCAGGACAGCCGG + Exonic
900259603 1:1718911-1718933 CAGGCTTGAGCCACCACGCCCGG + Intronic
900273566 1:1807984-1808006 CAGGCGGGAGCCACCACGCCCGG + Intronic
900281598 1:1873175-1873197 CAGGCATGAGGCAGCACTCCTGG + Intronic
900436690 1:2634393-2634415 CAGGCTGGGGGCTGCTGGGCTGG - Intergenic
900493238 1:2963410-2963432 CAGGCATGAGCCACCACGGCTGG - Intergenic
900607626 1:3530954-3530976 TAGGCTGGAGGGAGCAGGGCGGG - Intronic
900643760 1:3699467-3699489 CAGGCTGGAGGGAGAAGGCCAGG + Intronic
900724912 1:4209805-4209827 CAGACTGAAGGCTGCACTGCTGG - Intergenic
900727361 1:4225670-4225692 CAGGCATGAGGCACCACGCCCGG + Intergenic
900819908 1:4878718-4878740 CAGACTGAAGGCTGCACTGCTGG + Intergenic
900907147 1:5567220-5567242 CAGGCTGGAGCCTGCTCGGATGG - Intergenic
901070496 1:6514788-6514810 CAGGCTTGAGCCACCGCGGCTGG - Intronic
901148154 1:7082158-7082180 CAGGCCTGAGCCACCACGGCTGG - Intronic
901552480 1:10005838-10005860 CAGGCATGAGCCACCACGGCTGG + Intronic
901714185 1:11139965-11139987 CAGGCGTGAGCCAGCACGCCCGG + Intronic
901855228 1:12040120-12040142 CAGGCTTGAGCCACCACGCCCGG - Intergenic
902031762 1:13428184-13428206 CAGGCGTGAGCCACCACGGCCGG - Intergenic
902307391 1:15552208-15552230 CAGGCTTGAGTCACCACGCCTGG - Intronic
902343321 1:15798730-15798752 CAGGCATGAGCCACCACGGCAGG - Intergenic
902352877 1:15871243-15871265 CAGGCTTGAGCCACCACGCCTGG + Intronic
902466375 1:16621100-16621122 CAGGCATGAGTCAGCACGCCCGG + Intergenic
902508303 1:16952206-16952228 CAGGCATGAGTCAGCACGACCGG - Intronic
902580060 1:17402499-17402521 CAGGGTTGGGGCAGCAGGGCTGG + Intergenic
902657984 1:17882667-17882689 CAGGCTTGAGCCACCACGCCCGG + Intergenic
902704648 1:18196200-18196222 GAGGCTGGAGGCAGGGAGGCCGG + Intronic
902807071 1:18867824-18867846 CAGGCGTGAGCCAGCACGCCTGG + Intronic
902832985 1:19029656-19029678 CAGGCAGGATGGAGCAAGGCAGG - Intergenic
902877419 1:19349297-19349319 CTGGGTGGAGTCAGCTCGGCAGG + Intronic
902906261 1:19560165-19560187 CAGGCATGAGCCACCACGGCTGG - Intergenic
903188070 1:21640578-21640600 CAGCCTGCAGGCAGCTGGGCTGG + Intronic
903320784 1:22541993-22542015 CAGGCTTGAGCCACCACGCCCGG - Intergenic
903514096 1:23898615-23898637 CAGGCTTGAGCCACCACGCCTGG + Intronic
903542083 1:24102208-24102230 CAGGCTGGGGGCTGCATGGTGGG - Intronic
903583454 1:24390001-24390023 CAGGCTGAGGGCACCAGGGCTGG + Intronic
903666864 1:25013426-25013448 CAGGCTGGTGTCAGGACAGCAGG - Intergenic
903719149 1:25391462-25391484 CAGGCTTGAGCCACCACGCCTGG + Intronic
903719406 1:25393341-25393363 CAGGCTTGAGCCACCACGCCCGG - Intronic
903808572 1:26022150-26022172 CAGGCTGGAGGGAGCTGGGCTGG - Exonic
903848120 1:26290540-26290562 AAGGCTGGAGGCAGAAGTGCAGG + Intronic
903871021 1:26434936-26434958 CAGGCTTGAGCCACCACGTCCGG + Intronic
903871313 1:26436891-26436913 CAGGCGTGAGCCAGCACGCCCGG - Intronic
903960330 1:27052988-27053010 CAGGCGTGAGCCAGCACGGCCGG - Intergenic
904045908 1:27608093-27608115 CAGGCGGGAGCCACCACGCCTGG - Intergenic
904089018 1:27931486-27931508 CAGGCTTGAGCCACCACGCCTGG - Intergenic
904114885 1:28154532-28154554 CAGGCGTGAGCCACCACGGCCGG - Intronic
904121743 1:28202857-28202879 CAGGCTTGAGCCACCACGCCCGG + Intronic
904124887 1:28231436-28231458 CAGGCTTGAGCCACCACGCCTGG - Intronic
904179008 1:28652572-28652594 CAGACTGAAGGCTGCACGGTCGG - Intergenic
904181997 1:28672498-28672520 CAGGCTTGAGCCACCACGCCCGG + Intronic
904207411 1:28863989-28864011 CAGGCTTGAGCCACCACGCCTGG - Intergenic
904213938 1:28904754-28904776 CAGGCATGAGCCACCACGGCTGG - Intronic
904583744 1:31567160-31567182 CAGGCATGTGGCACCACGGCTGG - Intergenic
904653139 1:32021791-32021813 CAGGCAGGCGGCACCACGCCTGG + Intronic
904673852 1:32185675-32185697 CAGGCTTGAGCCACCACGCCTGG + Intronic
904732306 1:32603403-32603425 CAGGCGTGAGCCAGCACGCCCGG + Exonic
904739671 1:32663851-32663873 CAGGCTTGAGCCACCACGCCTGG + Intronic
904802078 1:33100042-33100064 CAGGCTTGAGCCACCACGCCTGG - Intronic
905009936 1:34740365-34740387 CAGGCCGCGGGCATCACGGCTGG - Intronic
905054325 1:35079832-35079854 CAGGCTTGAGGCACCACGCCCGG - Intronic
905190570 1:36230538-36230560 CAGGCTGGAGCCACCGCGCCCGG + Intronic
905233114 1:36527732-36527754 CAGGCATGAGCCACCACGGCCGG + Intergenic
905413102 1:37785597-37785619 CAGGCGGGAGCCACCACGCCAGG + Intergenic
905428698 1:37905121-37905143 CAGGCTTGAGCCACCACGCCTGG - Intronic
905439901 1:37989012-37989034 CAGGCTTGAGCCACCGCGGCCGG - Intronic
905449363 1:38046879-38046901 GAGGCGGGAGGCAGCTCCGCGGG - Intergenic
905825563 1:41023699-41023721 CAGGCTGGAGGCAGCACGCTAGG - Intergenic
906148626 1:43575026-43575048 CAGGAAGCAGGCAGCAGGGCAGG + Intronic
906252949 1:44325350-44325372 CAGGCTTGAGCCACCACGCCCGG + Intronic
906275668 1:44513330-44513352 CATGCGGGAGGCAGCCTGGCTGG - Intronic
906313469 1:44770476-44770498 CAGGCTTGAGCCACCACGCCCGG - Intergenic
906433407 1:45774534-45774556 CAGGCAGGAGCCACCACGTCTGG - Intergenic
906573311 1:46863204-46863226 CAGGCGTGAGGCACCACGCCCGG - Intergenic
906586428 1:46983164-46983186 CAGCCTGGTGGCAGCAAGGGTGG + Intergenic
906872714 1:49502204-49502226 CAGACTGGAGGCTGCACTGTTGG + Intronic
906985887 1:50682814-50682836 CAGGCTTGAGCCACCACGCCCGG - Intronic
907104600 1:51871037-51871059 CAGGCCTGAGGCACCACGCCCGG - Intronic
907220642 1:52904838-52904860 CAGGATGGAGGGAGCAGGGTGGG + Intronic
907245169 1:53103777-53103799 AAGGCAGGAGGCAGCGTGGCTGG - Intronic
907329116 1:53659945-53659967 CAGCCAGGAGGGAGCAGGGCAGG - Intronic
907512287 1:54970630-54970652 CAGGCTTGAGCCACCACGCCCGG + Intergenic
907624134 1:56011714-56011736 CAGGCATGAGGCACCACGCCTGG - Intergenic
908134618 1:61117904-61117926 CAGGCTTGAGCCACCACGCCCGG - Intronic
908193631 1:61727963-61727985 CAGGCTTGAGCCACCACGCCAGG - Intergenic
908697848 1:66865143-66865165 CAGGCGTGAGCCATCACGGCTGG - Intronic
908776376 1:67644933-67644955 CAGGCTGGAGGGATCACAGAGGG - Intergenic
908786991 1:67744910-67744932 CAGGCTGGAGCCAGAATGTCTGG + Intronic
908880743 1:68729747-68729769 CAGGCGGGAGCCACCACGCCTGG + Intergenic
910299946 1:85694735-85694757 CAGGCATGAGCCACCACGGCTGG + Intronic
910888035 1:91987195-91987217 CAGGCATGAGGCACCACGCCTGG + Intronic
910910332 1:92227263-92227285 CAGGCTTGAGCCACCACGCCCGG - Intronic
911054361 1:93697700-93697722 CAGGCTTGAGTCACCACGCCCGG - Intronic
911075224 1:93866864-93866886 CAGGCAGGAGCCACCACGTCTGG - Exonic
911417992 1:97599901-97599923 CAGGCATGAGCCAGCACGCCCGG - Intronic
911430926 1:97785968-97785990 CAGGCTTGAGCCACCACGTCCGG + Intronic
912127145 1:106553573-106553595 CAGGCGTGAGGCACCACGGCTGG - Intergenic
912217943 1:107637343-107637365 CAGGCGTGAGTCAGCACGCCTGG - Intronic
912364947 1:109125659-109125681 CAGGCGGGAGCCACCACGCCCGG + Intronic
912605232 1:110982830-110982852 CAGGCAGGTGTCAGCAGGGCAGG + Intergenic
912666036 1:111580569-111580591 CAGGCTTGAGCCACCACGCCCGG - Intronic
913205760 1:116537111-116537133 CAGGCAGGAGCCATCATGGCTGG - Intronic
913348868 1:117835823-117835845 CAGGCTTGAGACACCACGCCCGG - Intergenic
914714058 1:150239567-150239589 CAGGCTTGAGCCACCACGCCTGG + Intergenic
914726827 1:150334844-150334866 CAGGCTTGAGCCACCACGCCTGG + Intronic
914802088 1:150969296-150969318 CAGGCATGAGCCATCACGGCCGG - Intronic
914843911 1:151269954-151269976 CAGGCTTGAGCCACCACGCCCGG + Intergenic
914933071 1:151951486-151951508 CAGGCACGAGCCAGCACGCCTGG + Intergenic
915038527 1:152948632-152948654 GAGGCGGGGGGCAGCACTGCTGG - Intergenic
915286427 1:154856229-154856251 CAGGGAGGAGGCAGCAGGGAGGG + Intronic
915366134 1:155317556-155317578 CAGGCATGAGGCATCACAGCCGG - Intronic
915407390 1:155671151-155671173 CAGGCGTGAGCCAGCACGCCTGG - Intronic
915453302 1:156021779-156021801 CAGGCTTGAGCCACCACGCCCGG + Intergenic
915518373 1:156427030-156427052 CAGGCTTGAGGCTGCACAGGGGG + Intronic
915534043 1:156523741-156523763 CAGGCATGAGGCACCACGCCTGG + Intergenic
915543865 1:156584940-156584962 AAGGCAGGAAGCAGCACAGCAGG + Exonic
915658808 1:157383782-157383804 CAGGCATGAGGCACCACGCCGGG - Intergenic
915782957 1:158573914-158573936 CAGGCTTGAGCCACCACGTCTGG + Intergenic
916034983 1:160913738-160913760 AAGGCTGGAGGTAGGACAGCAGG + Intergenic
916043059 1:160977905-160977927 CAGGCTTGAGCCACCACAGCTGG - Intergenic
916231453 1:162545019-162545041 CAGGCATGAGCCACCACGGCCGG - Intergenic
916298415 1:163246291-163246313 CAGGCGTGAGGCACCACGCCTGG - Intronic
917087148 1:171315147-171315169 CAGGCAGGCGGCACCACGCCTGG - Intronic
917091155 1:171354639-171354661 CAGGCAGGAGCCACCACGCCCGG + Intergenic
917109065 1:171526613-171526635 CAGGCGTGAGGCACCACGCCTGG + Intronic
917388440 1:174504248-174504270 CAGGCATGAGCCAGCACGCCTGG + Intronic
917630781 1:176889275-176889297 CTGGCTGCAGGGAGCATGGCTGG + Intronic
917887221 1:179398564-179398586 CAGAGTGGAGGCAGCACAGCTGG + Intronic
917927890 1:179804082-179804104 CAATCTGGAGGCAGCAGGGGAGG - Intronic
918012109 1:180596627-180596649 CAGGCGTGAGCCACCACGGCTGG + Intergenic
918333966 1:183488959-183488981 CAGGCTTGAGCCACCACGCCTGG + Intronic
918884755 1:190177453-190177475 CAGGCGTGAGGCACCACGCCCGG + Intronic
919631706 1:199965978-199966000 CAGGCTTGAGCCAGCTCGCCTGG + Intergenic
919703407 1:200654134-200654156 CAGGCTTGAGCCACCACGCCCGG - Intronic
920005243 1:202828508-202828530 CAGGCGGGAGCCACCACGCCCGG - Intergenic
920196244 1:204229044-204229066 CAACCTGGAGGCAGCCCTGCGGG - Exonic
920310647 1:205046392-205046414 TAGGCTGGAGGAAGCCCAGCAGG - Intronic
920353097 1:205350715-205350737 CCAGCTGGAAGCAGCAGGGCTGG - Intronic
920449040 1:206043492-206043514 CAGGCGTGAGCCACCACGGCCGG - Intronic
921506945 1:215983237-215983259 CAGGCTTGAGCCACCACGCCTGG + Intronic
921716510 1:218422496-218422518 CAGGCGTGAGGCACCACGCCTGG + Intronic
921853885 1:219960031-219960053 CAGGCTGAAGGCAGTCAGGCAGG - Intergenic
921871076 1:220140705-220140727 CAGGCGTGAGGCACCACGCCTGG - Intronic
922019039 1:221685335-221685357 CAGACTGAAGGCAGCACTGTTGG - Intergenic
922475182 1:225902030-225902052 CAGGCTTGAGCCACCACGCCCGG - Intronic
922738236 1:228001202-228001224 CCTCCTGGAGGCAGCACAGCAGG - Intergenic
923373800 1:233339759-233339781 CAGGCTTGAGGCACCACATCTGG + Intronic
923632856 1:235665330-235665352 CAGGCATGAGGCACCACGCCTGG - Intronic
923742486 1:236668555-236668577 CAGGCTTGAGCCACCACGCCCGG - Intergenic
923799969 1:237199333-237199355 CAGACTGAAGGCTGCACTGCTGG - Intronic
923825390 1:237494250-237494272 CAGGCTGAAGGCTGCACTTCTGG - Intronic
924049880 1:240070132-240070154 CAGGCTTGAGCCACCACGCCCGG + Intronic
924280688 1:242434110-242434132 GAAGCTGCAGGCAGCAAGGCTGG + Intronic
924371287 1:243353211-243353233 CAGGCATGAGCCACCACGGCTGG - Intronic
924476694 1:244388204-244388226 CAGGCTTGAGCCACCACGCCTGG + Intronic
924546154 1:245029736-245029758 CAGGCAGGAGCCACCACGCCTGG + Intronic
924726557 1:246676639-246676661 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1062775291 10:139852-139874 CAGGCAGGAGCCACCACGCCTGG + Intronic
1062917575 10:1253627-1253649 CAGGGAGAAGGCAGCATGGCAGG + Intronic
1063224939 10:4006716-4006738 CAGGCATGAGGCACCACGCCTGG + Intergenic
1063298583 10:4831274-4831296 AAGGCAGGAAGCAGCACGGCAGG + Intronic
1063540714 10:6931276-6931298 CAGGCATGAGCCACCACGGCTGG - Intergenic
1063815666 10:9768476-9768498 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1063838685 10:10045989-10046011 CAGGCAGGAGTCACCACGCCCGG - Intergenic
1064103635 10:12483639-12483661 CAGGCTGGAGTCATCACACCTGG + Intronic
1064198139 10:13262184-13262206 CAGGCAAGAGGCACCACGCCTGG + Intergenic
1064592214 10:16905833-16905855 CAGGCATGAGCCACCACGGCTGG - Intronic
1064757155 10:18581547-18581569 CAGGCATGAGCCACCACGGCTGG - Intronic
1065337891 10:24673582-24673604 CAGGCGTGAGCCACCACGGCCGG - Intronic
1065412799 10:25448365-25448387 CAGGCGTGAGCCACCACGGCTGG + Intronic
1065929725 10:30469026-30469048 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1066065602 10:31759424-31759446 CAGGCTTGCGGAAGCACGGGAGG + Intergenic
1066214986 10:33277494-33277516 CAGGCTGGTGGCAGCGCTGGTGG - Intronic
1066552660 10:36576797-36576819 CAGGCATGAGCCACCACGGCCGG + Intergenic
1066562975 10:36690577-36690599 CAGGCGTGAGCCACCACGGCTGG - Intergenic
1066564481 10:36707080-36707102 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1066602393 10:37123599-37123621 CAGGCGTGAGCCAGCACGCCCGG - Intergenic
1066661701 10:37742776-37742798 CAGGCTTGAGACACCACGCCCGG + Intergenic
1067169396 10:43894091-43894113 CAGGCTGAAGGCTGCACTGTTGG - Intergenic
1067318908 10:45198909-45198931 CACGGTGGAGGCTGCAGGGCTGG + Intergenic
1067318967 10:45199213-45199235 CAAGGCGGAGGCTGCACGGCTGG + Intergenic
1067429627 10:46234492-46234514 TAGGCTGGAGGCAGCACCCAGGG - Intergenic
1067444024 10:46329435-46329457 CAGGCTGGAGGCAGCACCAAGGG + Intronic
1067471623 10:46542161-46542183 CAGGCAGAAGGCTGCAGGGCAGG + Intergenic
1067527941 10:47049611-47049633 CAGCCTGGAGGCTGTACTGCAGG + Intergenic
1067549902 10:47226954-47226976 GAGGCTGGAGGCAGCCAGGGAGG + Intergenic
1067728370 10:48790745-48790767 CAGGCTGCTGGCAGCAGGGCTGG - Exonic
1067756245 10:49008066-49008088 CAGGCATGAGGCACCACGCCTGG + Intergenic
1068169863 10:53379369-53379391 CAGGCGGGAGCCACCACGCCTGG - Intergenic
1068614671 10:59100401-59100423 CAGGCGTGAGGCACCACGCCCGG - Intergenic
1068635592 10:59344557-59344579 CAGGCTTGAGCCATCACGCCCGG + Intronic
1068805537 10:61190683-61190705 CAGGCGTGAGCCAGCACGCCCGG + Intergenic
1068976537 10:63016124-63016146 CAGGCGGGAGCCACCACGCCTGG + Intergenic
1069163210 10:65115763-65115785 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1069163530 10:65119520-65119542 CAGGCTGAAGGCTGCACTGTCGG + Intergenic
1069496719 10:68910676-68910698 CAGGCGTGAGCCACCACGGCTGG + Intronic
1069718333 10:70534667-70534689 CAGGGTCAAGGCAGAACGGCAGG - Intronic
1069939568 10:71945230-71945252 CAGGCGGGAGCCACCACGCCTGG - Intergenic
1070814671 10:79315211-79315233 CAGGCTGTAGGCACCACGCACGG - Exonic
1071057852 10:81531566-81531588 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1071285250 10:84138727-84138749 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1071551696 10:86571023-86571045 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1071562819 10:86656665-86656687 CAGGCGGGAGCCACCACGCCTGG - Intronic
1071580723 10:86767097-86767119 CAGGCGTGAGGCACCACGCCCGG + Intronic
1072360500 10:94654443-94654465 CAGGCTGGAGGAAAGAAGGCAGG - Intergenic
1072696170 10:97604596-97604618 CAGGCATGAGCCACCACGGCTGG + Intronic
1072829797 10:98645699-98645721 CAGGCTTGAGCCACCACGCCTGG - Intronic
1073018053 10:100417820-100417842 CAGGCTTGAGCCACCACAGCCGG + Intergenic
1073113468 10:101076749-101076771 CAGGCGTGAGCCAGCACGCCTGG - Intergenic
1073355205 10:102848345-102848367 GAGGCTGGAAGGAGCATGGCAGG + Intergenic
1073393222 10:103196094-103196116 CATGCTGGAGCCACCACGCCCGG - Intergenic
1073412070 10:103350727-103350749 GAGGCTGGAGGGAGGCCGGCAGG - Exonic
1073474589 10:103744539-103744561 GAAGCTGGAGGCAGCCCAGCAGG - Intronic
1073534385 10:104262431-104262453 CAGGCTTGAGCCACCACGCCCGG - Intronic
1074206452 10:111287060-111287082 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1074506360 10:114074432-114074454 CAGGCATGAGCCACCACGGCCGG + Intergenic
1074745562 10:116528788-116528810 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1074821343 10:117181529-117181551 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1074822693 10:117192995-117193017 CAGGCGTGAGGCACCACGCCTGG + Intergenic
1075125962 10:119699108-119699130 CAGGCAGGAGCCACCACGACTGG - Intergenic
1075252166 10:120889515-120889537 CAGGCAGGAGCCAGCACACCCGG + Intronic
1075343088 10:121662739-121662761 CAGGCTGCTGACAGCACTGCAGG + Intergenic
1075639071 10:124051219-124051241 CAGGCATGAGGCACCACGCCTGG + Intronic
1075656249 10:124163032-124163054 CAGGCAGGAGGAAGGAAGGCAGG + Intergenic
1075742584 10:124704893-124704915 CAGGGTGGTGGCAGCGGGGCTGG + Intronic
1075817560 10:125276956-125276978 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1076307303 10:129474307-129474329 CAGGATGGTGGCAGCAGGCCTGG + Intronic
1076805817 10:132858342-132858364 CAGGTTGGAGGCAGGGCGGTGGG + Intronic
1076805840 10:132858397-132858419 CAGGTTGGAGGCAGGGCGGTGGG + Intronic
1076922264 10:133460114-133460136 CGGGCTGGGGGCGGCACGACTGG + Intergenic
1077054799 11:586136-586158 CAGGCTTGAGCCACCACGCCTGG + Intronic
1077090494 11:776401-776423 CAGGCTGGGGGCAGCACTTCAGG - Intronic
1077469336 11:2749530-2749552 CAGGCGTGAGGCAGCACGCCCGG - Intronic
1077508674 11:2943884-2943906 TGAGCTGGAGGCAGCAGGGCGGG + Intergenic
1077516479 11:3004828-3004850 CAGGCTTGAGCCACCACGCCTGG - Intronic
1077613104 11:3656767-3656789 CAGGCTGGAGCCACCATGGCTGG + Intronic
1077625433 11:3767236-3767258 CAGGCAGGAGCCAGCATGCCCGG + Intronic
1078209530 11:9259279-9259301 CAGGCTTGAGTCACCACGCCTGG - Intronic
1078247049 11:9583335-9583357 CAGGCGTGAGGCACCACGCCCGG - Intronic
1078315755 11:10292402-10292424 CAGGCTTGAGCCACCACGCCCGG - Intronic
1078525059 11:12094099-12094121 AAGGCTAGAGACAGCACGGGAGG + Intronic
1078699199 11:13665019-13665041 CAGGCGTGAGCCAGCACGCCTGG - Intergenic
1079243251 11:18735536-18735558 CAGGCTTGAGCCACCACGCCCGG - Intronic
1079762037 11:24341164-24341186 CAGACTGAAGGCAGCACTGTGGG - Intergenic
1079967783 11:26999955-26999977 CAGGCTTGAGCCATCACGCCTGG - Intergenic
1080920885 11:36708345-36708367 CAGGCGTGAGCCACCACGGCCGG - Intergenic
1081160971 11:39747723-39747745 CAGGCTTGAGGCACCGCGCCTGG + Intergenic
1081631785 11:44694322-44694344 CAGGCTGGGGGAAGCAGGGGAGG - Intergenic
1081964120 11:47159230-47159252 CAGGCGTGAGGCACCACGCCTGG - Intronic
1082043349 11:47705366-47705388 CAGGCTTGAGCCACCACGCCTGG - Intronic
1082593605 11:55046295-55046317 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1082853471 11:57785822-57785844 CAGGCTTGAGCCACCACGCCCGG + Intronic
1082930270 11:58595850-58595872 TAGGCTTGAGCCAGCACGCCTGG + Intronic
1083307650 11:61769524-61769546 CAGGCGGGTGGCATCACCGCGGG - Intronic
1083395115 11:62385585-62385607 CAGGCGTGAGGCACCACGCCTGG - Intronic
1083449135 11:62730848-62730870 CAGGCTTGAGCCACCACGCCTGG + Intronic
1083648213 11:64185449-64185471 CAGCCAGGAGGCAGGAGGGCCGG + Exonic
1083648902 11:64189083-64189105 CAGGCGTGAGCCAGCACGCCCGG - Intronic
1083850798 11:65365486-65365508 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1083929953 11:65836263-65836285 CAGGCTTGAGCCACCACGCCTGG - Intronic
1084075233 11:66770020-66770042 CAGGCGTGAGCCACCACGGCTGG + Intronic
1084171474 11:67403134-67403156 CAGGCCTGAGCCACCACGGCAGG - Intronic
1084299471 11:68237511-68237533 CAGGCGGGAGCCACCACGCCCGG + Intergenic
1084412921 11:69014393-69014415 GAGGCTGGAGGCAGCAGGCAGGG + Intergenic
1084433201 11:69122872-69122894 CAGGGAGGAGGCCGCACAGCAGG - Intergenic
1084457591 11:69277513-69277535 CTCGCTGCAGGCAGCACAGCTGG - Intergenic
1084472916 11:69373682-69373704 CAGGCGGGAGCCACCACGCCTGG - Intergenic
1084615020 11:70229979-70230001 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1084663085 11:70558465-70558487 CAGGCTGGAGCCAGCCTGCCAGG + Intronic
1084933861 11:72576677-72576699 CAGGCAGGAGGAAGCATGGCTGG + Exonic
1085017788 11:73186524-73186546 CAGGCAGGAGCCAGCAAGTCTGG - Intergenic
1085048577 11:73367807-73367829 CAGGCTGAAGGCAGGTGGGCGGG - Exonic
1085056624 11:73408146-73408168 CAGGCATGAGGCACCACGCCCGG + Intronic
1085322892 11:75585467-75585489 CAGGCTGTGGGGAGGACGGCTGG - Intergenic
1085352358 11:75807294-75807316 CAGGCGTGAGCCAGCACGCCCGG + Intergenic
1085409903 11:76284693-76284715 CAGGGTGAAGACAGCAGGGCGGG + Intergenic
1085527695 11:77173752-77173774 CAGGCAGGAGGCAGCAGGAGGGG - Intronic
1086080723 11:82900407-82900429 CAGGCTGGAGACTGCAGTGCGGG + Exonic
1086082557 11:82919998-82920020 CAGGCGTGAGGCACCACGCCCGG + Intronic
1086181376 11:83955881-83955903 CAGACTGAAGGCTGCACTGCTGG + Intronic
1086311189 11:85537837-85537859 CAGGCTTGAGCCACCACGCCTGG - Intronic
1086355796 11:85998057-85998079 CAGGCGGGAGGCACCATGCCTGG + Intronic
1086575581 11:88336261-88336283 CAGGCGGGAGTCACCACGCCTGG - Intronic
1087032730 11:93722189-93722211 CAGGCGTGAGGCACCACGCCTGG - Intronic
1087294655 11:96356901-96356923 CAAGCTGGAGGCAGAAAGACAGG + Intronic
1087444909 11:98238761-98238783 CAGGCGTGAGCCACCACGGCTGG - Intergenic
1087531103 11:99383130-99383152 CAGGCAGGAGCCACCACGCCTGG + Intronic
1088679811 11:112229667-112229689 CAGGCTTGAGCCACCACGCCTGG + Intronic
1088692376 11:112338757-112338779 GAGGCTGGGGGAAGCACAGCTGG + Intergenic
1089046003 11:115503152-115503174 GAGGCTGGGTGCAGCACAGCCGG + Intronic
1089151440 11:116367377-116367399 CAGGCAGGAAGCAGAAGGGCCGG - Intergenic
1089245160 11:117113867-117113889 CAGGCAGGTGCCAGCACGCCCGG - Intergenic
1089310172 11:117552735-117552757 CTTGCTGGAGGCAACAAGGCTGG + Intronic
1089462802 11:118662617-118662639 CAGCCTGGAGGTGGCAGGGCAGG + Intronic
1089812348 11:121142405-121142427 CAGGGTGGAGGCAGCATGCGTGG + Intronic
1090002291 11:122972151-122972173 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1090117925 11:123994533-123994555 CAGGCTAGACGCAGCATGGCAGG + Exonic
1090126725 11:124093973-124093995 CAGGCTAGAGGTAACACTGCAGG + Intergenic
1090197632 11:124830647-124830669 CAGGCATGAGCCACCACGGCTGG - Intergenic
1090343325 11:126045301-126045323 CAGGCGTGAGCCAGCACGCCCGG + Intronic
1090360059 11:126165877-126165899 CAGGCTGGAGGCCTCCGGGCAGG + Intergenic
1090370572 11:126248645-126248667 CAGGCGTGAGCCAGCACGCCCGG + Intronic
1090420288 11:126570637-126570659 CAGGCTGGAGAAGGCAGGGCTGG - Intronic
1090438057 11:126703174-126703196 ATGGCAGGAAGCAGCACGGCTGG - Intronic
1090481085 11:127069193-127069215 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1091217906 11:133914738-133914760 CAGGAGGGAGGAAGCAGGGCAGG + Intronic
1091248318 11:134119201-134119223 CAGGCATGAGTCAGCACGACTGG + Intronic
1091254847 11:134174111-134174133 CAGGCTTGAGTCACCACAGCAGG - Intronic
1091359732 11:134968468-134968490 CAGGCAGGAGCCACCACAGCTGG - Intergenic
1091604068 12:1935529-1935551 CAGGCTGGGCGCTGCACCGCCGG + Intergenic
1091663596 12:2402443-2402465 CAGGCAGGAGGTGGCACTGCAGG + Intronic
1091702133 12:2670581-2670603 CAGGCACGAGCCAGCACGCCTGG - Intronic
1091743117 12:2974142-2974164 CAGGCTTGAGCCACCACGCCTGG + Intronic
1091771083 12:3151732-3151754 AAGGCTGGAGGGAGCAAGGAAGG - Intronic
1091842442 12:3630721-3630743 CATCCTGGAGGCAGCACGGATGG - Intronic
1091940946 12:4481520-4481542 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1092110792 12:5962824-5962846 CAGGCGTGAGCCAGCACGCCCGG + Intronic
1092288226 12:7142303-7142325 AAGGCTAGAGGCAGCTTGGCTGG + Intronic
1092345193 12:7708856-7708878 CAGGCGGGAGCCACCACGCCCGG + Intergenic
1092370585 12:7913784-7913806 CAGGCATGAGCCAGCACGCCCGG + Intergenic
1092382796 12:8011634-8011656 CAGGCGTGAGCCAGCACGCCCGG - Intergenic
1092487985 12:8919336-8919358 CAGGCAGGAGCCACCACGCCTGG + Intronic
1092636949 12:10461650-10461672 CAGGCATGAGCCACCACGGCTGG + Intergenic
1093023539 12:14224222-14224244 CAGGCTTGAGCCACCACAGCTGG + Intergenic
1093127889 12:15352371-15352393 CAGGCTTGAGCCACCACGCCTGG - Intronic
1093557545 12:20493905-20493927 CAGGCGTGAGCCAGCACGCCTGG + Intronic
1093740399 12:22679207-22679229 CAGACTGAAGGCAGCACTGTCGG - Intronic
1094466646 12:30760962-30760984 CAGGCATGAGCCAGCACGCCTGG - Intergenic
1094523196 12:31214874-31214896 CAGACTGAAGGCCGCACTGCTGG - Intergenic
1094559677 12:31540374-31540396 CAGGCATGAGGCATCACGCCTGG - Intronic
1095336112 12:41028307-41028329 CAGGCATGAGCCACCACGGCTGG + Intronic
1095783293 12:46084381-46084403 CTGGCTGGAGCCAGCATTGCAGG + Intergenic
1095976368 12:47943189-47943211 CAGGCTGCAGGGAGCGGGGCTGG + Intergenic
1096162834 12:49394792-49394814 CAGGCGTGAGGCACCACGCCCGG - Intronic
1096269828 12:50156122-50156144 CAGGCGTGAGCCACCACGGCCGG - Intronic
1096271786 12:50171353-50171375 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1096277289 12:50220335-50220357 CAGGCTTGAGCCACCACGCCCGG + Intronic
1096296111 12:50385621-50385643 CAGGCTTGAGCCACCACGCCCGG - Intronic
1096297181 12:50393567-50393589 CAGGCTTGAGCCACCACGCCTGG - Intronic
1096778731 12:53979798-53979820 CAGGCGGCAGGCAGGAAGGCAGG - Intergenic
1096827422 12:54290580-54290602 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1096971301 12:55668548-55668570 CAGGCAGGAGCCACCACGCCTGG - Intergenic
1097000649 12:55873625-55873647 CAGGCGTGAGCCACCACGGCTGG - Intergenic
1097058643 12:56266449-56266471 CAGACTGAAGGCTGCACTGCCGG + Intergenic
1097273587 12:57795375-57795397 CAGGCGTGAGCCACCACGGCTGG + Intronic
1097326616 12:58284283-58284305 CAGGCTTGAGTCACCACGCCCGG + Intergenic
1097850897 12:64408383-64408405 CAGGCATGAGCCAGCACGCCTGG + Intronic
1098308032 12:69120975-69120997 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1098525847 12:71486039-71486061 CAGGCGTGAGCCAGCACGCCAGG + Intronic
1098548683 12:71739373-71739395 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1098954702 12:76677442-76677464 CAGGCGGGAGCCACCACGCCCGG + Intergenic
1099390670 12:82074828-82074850 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1099518372 12:83627787-83627809 CAGGCTTGAGACACCACGCCTGG - Intergenic
1099535091 12:83833516-83833538 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1100300233 12:93300266-93300288 CAGGCTTGAGCCACCACGACCGG - Intergenic
1100611243 12:96193869-96193891 CAGGCGTGAGCCAGCACGCCCGG + Intergenic
1100761300 12:97810528-97810550 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1100945666 12:99780557-99780579 CAGGCTTGAGCCACCACGCCCGG + Intronic
1101366001 12:104071081-104071103 CAGGCTTGAGCCACCACGCCCGG + Intronic
1101381641 12:104218299-104218321 CAGGCTTGAGCCACCACGCCCGG + Intronic
1101662045 12:106774609-106774631 CGGGTTGGAGGCAGGACGGAGGG + Intronic
1101702882 12:107191883-107191905 GAGGCTGGAAGCAGCAAGGAAGG - Intergenic
1101984018 12:109431625-109431647 AAGGCTGGAAGCAGCACAACCGG - Intronic
1102020639 12:109679911-109679933 CAGGCTGCAGGCAGCAGGATAGG + Intergenic
1102261288 12:111444986-111445008 CAGGCAGGTGGCAGCCAGGCTGG + Intronic
1102343223 12:112140141-112140163 CAGGCTTGAGCCACCACGCCCGG - Intronic
1102897509 12:116610407-116610429 CAGGCAGGAGCCACCACGTCCGG - Intergenic
1102948156 12:117008821-117008843 CAGGCATGAGCCAGCACGCCTGG - Intronic
1103069975 12:117933311-117933333 CAGGCATGAGCCACCACGGCTGG - Intronic
1103091339 12:118100225-118100247 CAGGCAGGAGCCACCACGCCCGG - Intronic
1103265698 12:119628436-119628458 CAGGCGTGAGCCAGCACGCCCGG + Intronic
1103328206 12:120135638-120135660 CAGGCTTGAGCCACCACGCCCGG + Intronic
1103329178 12:120142047-120142069 CAGGCTTGAGCCACCACGCCTGG - Intronic
1103474703 12:121210032-121210054 CCGGAAGGAGGCAGCACGGGCGG - Intronic
1103555045 12:121761254-121761276 CAGGCGGGAGCCACCACGCCTGG + Intronic
1103677691 12:122669195-122669217 CAGGCGGGAGCCACCACGCCCGG + Intergenic
1103710143 12:122906449-122906471 CAGGCGTGAGCCACCACGGCTGG - Intergenic
1103753309 12:123182521-123182543 CAGGCTTGAGCCACCACGCCTGG + Intronic
1103843848 12:123887644-123887666 CAGGCAGGAGGCACCACACCTGG - Intronic
1103948180 12:124538487-124538509 AGGGCTGGAGGCAGCAGGGGCGG + Intronic
1103960161 12:124604316-124604338 CAGAGTGGAGACAGCAGGGCAGG - Intergenic
1104241387 12:126993422-126993444 CAGGCTGAAGGCTGCACTGTCGG + Intergenic
1104337249 12:127910920-127910942 CAGGCTTGAGCCACCACGTCTGG - Intergenic
1104445349 12:128828659-128828681 CAGGCTAGAGCCACCACGCCCGG + Intergenic
1104566861 12:129893150-129893172 CAGGCAGGAGCCACCACGCCTGG + Intronic
1104729614 12:131097738-131097760 CAGGCAGGAGCCAGCCTGGCCGG + Intronic
1104968732 12:132521565-132521587 GAGGCTGGAGGCATCGTGGCCGG + Intronic
1105040396 12:132956441-132956463 TAGGATGGAGCCAGCACTGCTGG + Intergenic
1105062793 12:133169220-133169242 CAGGCGTGAGCCACCACGGCAGG - Intronic
1105461649 13:20595565-20595587 CAGGCAGGAGCCACCACGCCTGG + Intronic
1105506497 13:21014672-21014694 CAGGCTGATGGCAGCAGTGCTGG - Intronic
1105538826 13:21297149-21297171 GAAGCTGGAAGCAGCAAGGCCGG - Intergenic
1105779206 13:23691695-23691717 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1106170001 13:27280642-27280664 CAGTCTGGACGCAGCTTGGCTGG - Intergenic
1106237404 13:27875256-27875278 CAGACAGGAGGCAGCAGGGGAGG - Intergenic
1106295819 13:28412837-28412859 CAGGCCAGAGCCACCACGGCCGG + Intronic
1107067544 13:36231525-36231547 AAGGCTGGAAGCAGCATGTCAGG + Intronic
1107160154 13:37215944-37215966 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1107259871 13:38477226-38477248 CAGGCATGAGCCAGCACGCCCGG + Intergenic
1107536603 13:41341438-41341460 CAGGCATGAGCCACCACGGCTGG - Intronic
1107537069 13:41345849-41345871 CAGGCGTGAGCCAGCACGCCGGG + Intronic
1107710526 13:43146290-43146312 CAAGCTGGAGGCAGTGCTGCGGG + Intergenic
1108002545 13:45917479-45917501 CAGGCTTGAGCCACAACGGCTGG - Intergenic
1108103764 13:46986343-46986365 CAGGCTTGAGACAGCACAGCTGG + Intergenic
1108193204 13:47964578-47964600 CAGGCTTGAGCCACCACGCCTGG - Intronic
1109250729 13:60017124-60017146 CAGGCAGGAGCCACCACGCCTGG - Intronic
1109289836 13:60460725-60460747 CAGGCTTGAGCCACCACGCCTGG - Intronic
1109565114 13:64102968-64102990 CAGGCTGAAGGCTGCACTGTTGG + Intergenic
1109619783 13:64888766-64888788 CAGGCTTGAGCCACCACGCCAGG - Intergenic
1109748765 13:66662328-66662350 CAGGCATGAGCCACCACGGCTGG - Intronic
1110041603 13:70767155-70767177 CAGGCATGAGGCACCACGCCAGG - Intergenic
1110077097 13:71259574-71259596 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1110211543 13:72979644-72979666 CAGGCTTGAGCCACCACGCCCGG - Intronic
1111488737 13:88941136-88941158 CAGGCGTGAGCCACCACGGCCGG + Intergenic
1111543664 13:89701292-89701314 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1111600531 13:90468386-90468408 CAGGCTTGAGCCACCACGCCAGG + Intergenic
1112105583 13:96235986-96236008 CAGGCTGAAGGCTGCACTGTTGG - Intronic
1112238207 13:97655440-97655462 CAGACTGGAGGCTGCACTGTTGG - Intergenic
1112323777 13:98429959-98429981 CAGGCATGAGGCACCACGCCCGG - Intronic
1112564715 13:100543480-100543502 CAGGCATGAGCCAGCACGCCTGG + Intronic
1113065963 13:106374695-106374717 CAGGCTTGAGGCACCATGCCTGG + Intergenic
1113099226 13:106699013-106699035 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1113767655 13:112891038-112891060 GTGGCTGGAGGGAGCAGGGCAGG - Intergenic
1113771847 13:112915130-112915152 CAGGCTTGAGCCACCACGCCCGG - Intronic
1113837343 13:113337014-113337036 CAGGCTTGAGCCACCACGCCTGG - Intronic
1113841321 13:113363348-113363370 CAGGCAGGAGCCACCACGCCCGG + Intronic
1113843371 13:113372387-113372409 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1113857854 13:113458553-113458575 CAGGATTGAGGCAGCAGTGCAGG - Intronic
1114538741 14:23439343-23439365 CAGGCTGCAGACAGGAGGGCCGG + Intergenic
1114917334 14:27285350-27285372 CAGGCTGGACCCAGTACAGCTGG - Intergenic
1115014278 14:28590887-28590909 CAGGCTGAAGGCTGCACTGTTGG + Intergenic
1115479828 14:33850324-33850346 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1115507022 14:34102519-34102541 CAGGCTGGATGGAGCAAGGAGGG - Intronic
1115573095 14:34685511-34685533 CAGGCATGAGCCACCACGGCCGG + Intergenic
1115593258 14:34884737-34884759 CAGGCATGAGGCACCACGCCCGG + Intergenic
1115607980 14:35024304-35024326 CAGGCTTGAGCCACCACGTCCGG + Intronic
1116451734 14:45074826-45074848 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1116545393 14:46159379-46159401 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1116727237 14:48575973-48575995 CAGCCAGGTGGCAGCAAGGCTGG - Intergenic
1116819376 14:49613060-49613082 CAGGCTTGAGCCACCACGCCTGG - Intronic
1117020947 14:51569777-51569799 CAGGCTTGAGGCATCATGCCCGG + Intronic
1117398725 14:55338629-55338651 CAGGCGTGAGGCACCACGCCTGG - Intronic
1117636997 14:57754380-57754402 CAGGCTTGAGCCACCACGCCTGG + Intronic
1117681026 14:58203022-58203044 CAGGCGTGAGCCACCACGGCTGG - Intronic
1117906621 14:60595690-60595712 CAGGCTGGAGCCACCACGCCTGG + Intergenic
1117913870 14:60657343-60657365 CAGGCCGGCGGCGGCGCGGCCGG + Intronic
1118336704 14:64859465-64859487 CAGGCATGAGCCACCACGGCTGG - Intronic
1118410677 14:65474459-65474481 CAGGTGGGAGCCAGCACGCCTGG - Intronic
1118647216 14:67851583-67851605 CAGCCTGGGGGCAGCAGGGGTGG + Intronic
1118787488 14:69058239-69058261 CAGGCTTGAGCCACCACGCCCGG - Intronic
1119006307 14:70932887-70932909 CAGGCTTGAGCCACCACGCCCGG + Intronic
1119257044 14:73207865-73207887 CATGCTGGCTGCAGCAGGGCAGG + Intronic
1119283452 14:73430662-73430684 CAGGCTTGAGCCACCACGCCTGG - Intronic
1119305030 14:73600859-73600881 CAGGCGTGAGCCAGCACGCCTGG - Intergenic
1119385705 14:74257195-74257217 CAGGCCCGAGTTAGCACGGCTGG + Intronic
1119440564 14:74625672-74625694 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1119509977 14:75203376-75203398 CAGGCATGAGCCACCACGGCTGG - Intergenic
1119527378 14:75333531-75333553 CAGGCGTGAGCCAGCACGCCCGG + Intergenic
1119536560 14:75407718-75407740 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1119543355 14:75455004-75455026 CAGGCTGGAGGCAGCAGGGATGG + Intronic
1119686650 14:76637945-76637967 CAGGCATGAGGCACCACGCCTGG + Intergenic
1119923878 14:78473123-78473145 CAGGCTTGAGCCACCACGCCCGG - Intronic
1120142421 14:80943714-80943736 CAGGCTTGAGTCAGCACCCCTGG - Intronic
1120194336 14:81466206-81466228 CAGGCATGAGCCACCACGGCTGG - Intergenic
1120420594 14:84281267-84281289 CAGGCATGAGTCACCACGGCTGG - Intergenic
1121273985 14:92655682-92655704 CAGGACGGAGGCAGCACAGATGG + Intronic
1121523660 14:94603446-94603468 CAGGCTTGAGCCAGCAGGCCTGG - Intronic
1121576952 14:94996251-94996273 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1121620714 14:95346261-95346283 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1121628839 14:95408123-95408145 CATCCTGGAGGCAGCAGGTCGGG - Intronic
1121857553 14:97283953-97283975 TGGGCTGGAGGCAGCATGTCAGG - Intergenic
1122181432 14:99957746-99957768 CAGGCGTGAGCCAGCACGCCTGG + Intergenic
1122181903 14:99961404-99961426 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1122296466 14:100708979-100709001 CTGGCTGGAGGGCGCACGGGAGG - Intergenic
1122582233 14:102777866-102777888 GAGGCGGGAGGCAGCCCGGCTGG - Intronic
1122591523 14:102855651-102855673 CAGGCTGGTGCCACCACGCCTGG - Intronic
1122718051 14:103707074-103707096 CTGGCCGGACGCAGCTCGGCAGG - Exonic
1122734448 14:103828741-103828763 CAGACTGGAAACAGCAGGGCCGG + Intronic
1122866935 14:104610493-104610515 CATGGTGGAGGCAGAAGGGCAGG - Intergenic
1122879139 14:104682217-104682239 CAGGCAGGAGGCAGCAGTGTGGG + Intergenic
1123499545 15:20867269-20867291 CAGGCAGGGGGCACCACAGCAGG - Intergenic
1123556797 15:21440999-21441021 CAGGCAGGGGGCACCACAGCAGG - Intergenic
1123593020 15:21878235-21878257 CAGGCAGGGGGCACCACAGCAGG - Intergenic
1123846040 15:24302972-24302994 CAGGCTTGAGGCACCACGCCTGG + Intergenic
1123865077 15:24510683-24510705 CAGGCTTGAGGCACCACTCCTGG + Intergenic
1124071549 15:26397914-26397936 CAGGCGTGAGCCAGCACGCCCGG + Intergenic
1124651150 15:31474892-31474914 CAGGCGCGAGCCAGCACGCCTGG - Intergenic
1124702989 15:31933216-31933238 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1124843403 15:33265901-33265923 CAGGCTTGAGCCACCACGTCTGG - Intergenic
1125022512 15:34999248-34999270 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1125025562 15:35025955-35025977 CAGGCGCGAGCCACCACGGCTGG + Intergenic
1125796177 15:42405587-42405609 CAGGCATGAGCCAGCACGCCCGG + Intronic
1125805399 15:42489756-42489778 CAGGCTTGAGCCACCACGCCCGG - Intronic
1125871822 15:43109165-43109187 CAGGCTTGAGCCACCACGCCCGG - Intronic
1125973987 15:43935200-43935222 CAGGCGGGAGCCACCACGCCTGG - Intronic
1126014181 15:44333990-44334012 CAGGCGTGAGGCACCACGCCCGG + Intronic
1127084633 15:55413479-55413501 CAGGCGTGAGACACCACGGCCGG - Intronic
1127119314 15:55757685-55757707 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1127428635 15:58880841-58880863 CAGGCAGGAGCCACCACGCCCGG + Intronic
1127446012 15:59064256-59064278 CAGGCGTGAGGCACCACGCCCGG - Intronic
1127512943 15:59661057-59661079 CAGGCTTGAGCCACCACGCCCGG - Exonic
1127595998 15:60482812-60482834 CAGGCGTGAGGCACCGCGGCCGG - Intergenic
1127970106 15:63951960-63951982 CAGGCATGAGCCAGCACGCCTGG - Intronic
1128041374 15:64576659-64576681 CAGGCTTGAGCCACCACGCCTGG - Intronic
1128161453 15:65425362-65425384 CAGGCGTGAGCCAGCACGCCTGG + Intergenic
1128214796 15:65926909-65926931 CGGGCAGGAGCCAGCAGGGCAGG + Intronic
1128300785 15:66565293-66565315 CAGGCTGGGGGCCGCCCGGAAGG - Exonic
1128542379 15:68545049-68545071 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1128812642 15:70583873-70583895 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1129146942 15:73656741-73656763 CAGGCTTGAGCCAACACGCCCGG + Intergenic
1129179764 15:73866764-73866786 CAAGCTGGAGGCAGCACTGATGG - Intergenic
1129523649 15:76200920-76200942 GAGGCTGGAGGCAGCACAGAAGG - Intronic
1129852533 15:78801968-78801990 CAGGCGTGAGGCACCAAGGCTGG + Intronic
1130135880 15:81181621-81181643 GAGGCCAGAGGCACCACGGCAGG + Intronic
1130213859 15:81950485-81950507 CAGGCGTGAGGCACCACGCCTGG - Intergenic
1130313454 15:82774351-82774373 CAGGCATGAGCCAGCACGTCTGG + Intronic
1130674405 15:85939290-85939312 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1130899065 15:88193308-88193330 CATGCTGGAGGCATAACTGCAGG + Intronic
1130986989 15:88851092-88851114 GAGGCTGGGGGCAGCATGGCTGG - Intronic
1131164542 15:90132984-90133006 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1131255851 15:90861802-90861824 CAGGCATGAGCCACCACGGCTGG - Intergenic
1131349690 15:91687801-91687823 CAGGCATGAGCCACCACGGCCGG - Intergenic
1131743919 15:95424185-95424207 CAGGATGGAGGTAGCAGGGGAGG + Intergenic
1131803736 15:96099735-96099757 CAGGCGTGAGGCATCACGCCCGG + Intergenic
1131870628 15:96760238-96760260 CAGGCGTGAGGCACCACGCCCGG - Intergenic
1132085199 15:98902689-98902711 CAGGCTTGAGCCACCACGCCCGG + Intronic
1132367137 15:101265831-101265853 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1202965140 15_KI270727v1_random:168188-168210 CAGGCAGGGGGCACCACAGCAGG - Intergenic
1132601179 16:773856-773878 CAGGCATGAGGCACCACGCCCGG + Intronic
1132661713 16:1064452-1064474 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1132752551 16:1465476-1465498 CTGGGTGGGGGCAGCAGGGCTGG + Intronic
1132898552 16:2240486-2240508 CAGGCATGAGCCAGCACGCCCGG + Intronic
1133159384 16:3899985-3900007 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1133390797 16:5408382-5408404 CAGGCTGGGGGCAGCATGGGAGG + Intergenic
1133502387 16:6378411-6378433 CATGCTGGAAGCAGCACCGATGG + Intronic
1133535917 16:6702274-6702296 CAGGCATGAGCCACCACGGCTGG - Intronic
1133548865 16:6834352-6834374 CAGGCATGAGGCACCACGCCTGG + Intronic
1133721939 16:8502765-8502787 CAGGCTGAAGGCTGCATGGTCGG - Intergenic
1133734779 16:8606822-8606844 CAGGCGTGAGCCACCACGGCTGG - Intergenic
1134013232 16:10870601-10870623 CAGGCTGGAGGCTGGACAGCTGG + Intergenic
1134067048 16:11235217-11235239 CAGGCTTGAGTCACCACGCCTGG - Intergenic
1134152156 16:11813479-11813501 CAGGCATGAGGCACCACGCCTGG - Intergenic
1134252560 16:12584677-12584699 CAGGCCTGAGTCACCACGGCAGG + Intergenic
1134608605 16:15590277-15590299 CAGGCTTGAGCCACCACGCCCGG - Intronic
1134627420 16:15732238-15732260 CAGGCTTGAGCCACCACGCCTGG + Intronic
1134905007 16:17972488-17972510 GAGGCTGGAGGCACAAAGGCAGG + Intergenic
1135270473 16:21065436-21065458 CAGGCAGGAGCCACCACGCCTGG + Intronic
1135333893 16:21584671-21584693 CAGGCGTGAGCCAGCACGCCTGG - Intergenic
1135418605 16:22288784-22288806 CAGGCGTGAGGCACCACGCCTGG - Intergenic
1135431117 16:22384338-22384360 CAGGCGTGAGGCACCACGCCCGG - Intronic
1135785263 16:25343170-25343192 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1135959524 16:26984227-26984249 CAGACTGGAGGCTGCACTGTGGG - Intergenic
1136105407 16:28026569-28026591 CAGGCTGGACGCAGCTCAGCTGG + Intronic
1136139402 16:28278946-28278968 CAGGCATGAGCCACCACGGCTGG - Intergenic
1136369706 16:29828655-29828677 CAGGCTTGAGCCACCACGCCCGG + Intronic
1136372115 16:29842998-29843020 CAGGCTGCAAACAGCAGGGCGGG - Intronic
1136395652 16:29991296-29991318 CAGGCTGGAGGGGGCATGCCTGG - Intronic
1136460163 16:30405428-30405450 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1136582008 16:31158400-31158422 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1136594159 16:31235860-31235882 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1137244743 16:46693522-46693544 CAGGCGGGAGCCACCACGCCTGG - Intronic
1137428080 16:48396694-48396716 CAGGCTTGAGCCACCACGCCCGG - Intronic
1137691615 16:50431945-50431967 GAGGCTGTGGGCAGCAGGGCTGG + Intergenic
1137988211 16:53128457-53128479 CAGGCTTGAGCCACCACGCCTGG + Intronic
1138193741 16:55036818-55036840 AAGGGTGGAGGAAGCAGGGCCGG + Intergenic
1138412552 16:56851585-56851607 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1138613719 16:58147771-58147793 CAGGGTGCAGGCAGCACTGAGGG - Intergenic
1138670857 16:58613307-58613329 CAGGCTTGAGTCACCACGCCTGG + Intronic
1138971188 16:62145445-62145467 CAGGCTGAAGGCTGCACTGTTGG + Intergenic
1139705861 16:68739890-68739912 CAGGCATGAGCCAGCACGCCTGG + Intronic
1139708883 16:68761298-68761320 CAGGCTTGGGGCAGCCCCGCTGG + Intronic
1139743373 16:69054654-69054676 CAGGCTTGAGCCACCACGCCCGG - Intronic
1139785836 16:69391306-69391328 CAGGCATGAGGCACCACGCCTGG - Intronic
1139814591 16:69658203-69658225 CAGGCATGAGCCAGCACGCCTGG - Intronic
1139965495 16:70742765-70742787 CAGGCTGGGACCAGCCCGGCTGG + Intronic
1140952801 16:79835346-79835368 CAGGCAGGAGCCACCACGCCCGG + Intergenic
1141023454 16:80520482-80520504 CAGGCGTGAGCCACCACGGCAGG - Intergenic
1141092962 16:81142767-81142789 CAGGCATGAGCCAGCACGCCCGG + Intergenic
1141096871 16:81169162-81169184 CAGCCTGAAGCCAGCAAGGCTGG - Intergenic
1141226653 16:82122611-82122633 CAGGCGGGAGCCACCACGCCCGG - Intergenic
1141447779 16:84073407-84073429 CAGGCTTGAGCCAACACGCCTGG + Intronic
1141674046 16:85508309-85508331 CAGGCAGGAGCCACCACGCCCGG + Intergenic
1141711603 16:85702709-85702731 CAGGCAGGAGACACCACGCCTGG + Intronic
1141820545 16:86442533-86442555 CAGGAGGGAGGCAGCATGGGGGG - Intergenic
1141911613 16:87063398-87063420 CAGGCAGGAGCCACCACGCCTGG + Intergenic
1141955888 16:87371016-87371038 CAGGCTGGTGGCTGCAGAGCTGG - Intronic
1142117851 16:88369395-88369417 CAGGATGGAGGCAGCCCAGTAGG + Intergenic
1142160920 16:88557047-88557069 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1142164528 16:88578963-88578985 CAGGCGTGAGGCACCACGCCCGG + Intronic
1142177544 16:88651931-88651953 GAGGCCGGAGGCAGCAATGCTGG + Exonic
1142245798 16:88969541-88969563 CAGGCTGGGGTCAGCGTGGCCGG + Intronic
1142257941 16:89024290-89024312 CAGGGTCCAGGCAGAACGGCTGG + Intergenic
1142309642 16:89305055-89305077 CAGGCAAGAGGCAGCAGGGGCGG - Intronic
1142354285 16:89594958-89594980 CAGTCTTGTGGCAGCACAGCGGG + Intronic
1203113257 16_KI270728v1_random:1465578-1465600 CAGGCAGGAGCCAGCATGCCCGG + Intergenic
1142512858 17:408722-408744 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1142533241 17:596654-596676 TAGGCAGGAGGCAGCCCTGCAGG - Intronic
1142604635 17:1074677-1074699 AAGGCTGGAGGCAGGGAGGCTGG + Intronic
1142629234 17:1213666-1213688 CAGGCGTGAGGCACCACGCCCGG + Intronic
1142635316 17:1253558-1253580 CAGGCTTGAGCCAGCGCGCCCGG + Intergenic
1142723286 17:1792314-1792336 CAGGCTTGAGCCACCACGCCTGG + Intronic
1142892614 17:2954379-2954401 CAGGCTTGAGCCACCACGCCTGG + Intronic
1143047621 17:4094873-4094895 AAGTCTGGAGGCAGCTGGGCTGG - Intronic
1143444252 17:6997835-6997857 CAGGCTTGAGCCACCACGCCCGG + Intronic
1143481282 17:7228857-7228879 CAGGCTCGAGCCACCACGCCCGG + Intronic
1143814450 17:9500723-9500745 CAGGCGTGAGCCAGCACGCCCGG - Intronic
1143865887 17:9923182-9923204 CAGGCGTGAGCCACCACGGCCGG + Intronic
1143889967 17:10095437-10095459 CAGGCGTGAGTCACCACGGCTGG + Intronic
1144529088 17:16018783-16018805 CAGGCATGAGGCATCACGCCTGG + Intronic
1145037541 17:19551828-19551850 CAGGCTGGGGGCAGCTCGTCTGG + Intronic
1145043873 17:19596962-19596984 GAGGCTGGAGGCAGCACGCAGGG + Intergenic
1145075828 17:19853846-19853868 CAGGCGGGAGCCACCACGCCCGG + Intronic
1145242059 17:21245836-21245858 CAAGGAGGAGGCAGCAGGGCTGG - Intronic
1145770076 17:27486581-27486603 CAGGCTGGAGGCAGCAGCCCCGG + Intronic
1145775459 17:27524801-27524823 AAGGCTGCAGGCAGAGCGGCAGG + Intronic
1145860018 17:28201871-28201893 CAGGCATGAGCCACCACGGCCGG - Intergenic
1146152856 17:30491379-30491401 CAGGCGGGAGCCACCACGCCTGG - Intronic
1146443826 17:32920404-32920426 CAGGCGTGAAGCACCACGGCTGG + Intergenic
1146550535 17:33776936-33776958 CAGGATGGAGGGAGCGAGGCTGG - Intronic
1146578899 17:34019182-34019204 CAGGCTTGAGCCACCACGCCTGG + Intronic
1146638123 17:34520918-34520940 AAGGCTGGAGGTAGTGCGGCAGG + Intergenic
1146705990 17:35001181-35001203 CAGGCTTGAGCCACCACGCCCGG + Intronic
1146723922 17:35142257-35142279 CAGGATGGCGGCAGCAGTGCCGG - Exonic
1146728302 17:35173401-35173423 CAGGCGGGAGCCACCACGCCTGG + Intronic
1146888941 17:36492422-36492444 CAGGCGTGAGCCAGCACAGCTGG + Intronic
1147028134 17:37607509-37607531 CAGGCTTGAGTCACCACGCCCGG - Intronic
1147151612 17:38518514-38518536 CAGGCATGAGGCACCACGCCTGG + Intergenic
1147336055 17:39727525-39727547 CAGGCTGGGGGCTGCAGGTCAGG - Exonic
1147342117 17:39759136-39759158 CAGGCGTGAGGCACCGCGGCTGG - Intergenic
1147428575 17:40357653-40357675 GGGGGTGGAGGCAGCAAGGCTGG - Intergenic
1147444573 17:40467001-40467023 CTGGATGGAGGCAGGACAGCAGG - Intergenic
1147583910 17:41641817-41641839 CAGGCTTGAGGCATCGCGCCCGG - Intergenic
1147623831 17:41886289-41886311 CAGGTTGGAGGCATCAAGCCTGG - Exonic
1147647669 17:42043483-42043505 CAGGCTGGGGGCAGCCCGCCAGG + Intronic
1147699193 17:42381446-42381468 CAGGCGTGAGCCAGCACGCCTGG - Intronic
1147795179 17:43037118-43037140 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1147839088 17:43357776-43357798 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1147854296 17:43467111-43467133 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1148079961 17:44962240-44962262 TGGGCTGGAGGCAGCACTGCAGG + Intronic
1148103880 17:45109077-45109099 TAGGCTGGAGCCAGGACGACAGG + Exonic
1148121053 17:45211596-45211618 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1148147863 17:45377351-45377373 CAGGCGGGAGCCACCACGCCCGG + Intergenic
1148211794 17:45813209-45813231 CAGGGAGGAGGCAGCAGGACAGG - Intronic
1148216241 17:45835389-45835411 CAGGGTGAAGGCAGCAAGGCAGG - Exonic
1148343404 17:46887485-46887507 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1148864129 17:50619786-50619808 CAGGCTGGGGGCAGAAGGGAAGG - Exonic
1148959717 17:51383371-51383393 CAGGCATGAGGCACCACGCCGGG + Intergenic
1149155058 17:53618796-53618818 CAGGCGTGAGCCACCACGGCCGG + Intergenic
1149317063 17:55448548-55448570 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1149329024 17:55562477-55562499 CAGGCGGGAGTCACCACGCCTGG - Intergenic
1149397676 17:56261573-56261595 CAGACTGGAGGCTGCACTGTTGG - Intronic
1149553906 17:57559644-57559666 CAGGCTGTCGTCAGCACAGCTGG - Intronic
1149782290 17:59407635-59407657 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1149790114 17:59469248-59469270 CAGGCGTGAGGCACCACGCCCGG + Intergenic
1149833417 17:59891410-59891432 CAGGCTTGAGCCACCACGCCCGG + Intronic
1150152790 17:62824203-62824225 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1150220149 17:63491465-63491487 CCAGCTGGAGCCAGCAGGGCAGG + Intronic
1150463107 17:65369466-65369488 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1150496979 17:65615437-65615459 CAGGCGTGAGGCACCACGCCTGG + Intronic
1150768437 17:68020943-68020965 CAGGCAGGAGCCACCACGCCCGG - Intergenic
1151137867 17:71965038-71965060 CAGGCTTGAGCCACCACGACCGG - Intergenic
1151161498 17:72169519-72169541 CAGGCTTGCGGCAGCACTGTGGG + Intergenic
1151209145 17:72531018-72531040 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1151227833 17:72659876-72659898 CAGGCTTGAGCCACCATGGCTGG + Intronic
1151387590 17:73764595-73764617 CAGGCAGGAGGCAGCCTGGAAGG + Intergenic
1151471682 17:74322299-74322321 CAGGCTGCAGGCAGCAGTGATGG + Intergenic
1151519857 17:74620192-74620214 CAGGCTTGAGGCACCACACCCGG - Intronic
1151545532 17:74790682-74790704 CAGGGAGGAGACAGCAAGGCAGG - Intronic
1151600057 17:75100536-75100558 CGGGCTGATGGCAGGACGGCCGG + Exonic
1151790044 17:76299457-76299479 CAGGCTGGAGCCACCGCGCCCGG - Intronic
1151790574 17:76303159-76303181 CAGGCTGGAGCCACCGCGCCCGG + Intronic
1151843506 17:76634594-76634616 CAGGCGTGAGGCACCACGCCTGG - Intronic
1152100229 17:78297180-78297202 CAGGCGTGAGGCAGCGCGCCCGG - Intergenic
1152403350 17:80082722-80082744 TTGGCTGGTAGCAGCACGGCTGG - Intronic
1152594659 17:81232371-81232393 CTGGCTGAAGGCATCATGGCAGG + Intronic
1152724841 17:81940093-81940115 CAGGCTGGAGGTGGCGCGGGTGG - Exonic
1152728272 17:81958256-81958278 CAGGGAGGAGGCAGGACGGCAGG - Intronic
1152748398 17:82051602-82051624 CAGGCTGGGGGCAGCGGGCCGGG + Exonic
1152756415 17:82088873-82088895 CAGCCTGGGGGCGGCAGGGCAGG + Exonic
1152911210 17:83005859-83005881 CAGGCTGGAGGGGGCCGGGCAGG - Intronic
1153086667 18:1296446-1296468 GAGGCTGGAGCCAGCACTTCTGG + Intergenic
1153117386 18:1676024-1676046 CAGGCATGAGCCAGCACGTCCGG + Intergenic
1153311416 18:3680508-3680530 CAGGCGTGAGCCAGCACGCCCGG - Intronic
1153589672 18:6659842-6659864 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1153854232 18:9129216-9129238 CAGGCTTGAGCCACCACGCCCGG + Intronic
1153886801 18:9474992-9475014 CAGACTGGGGGCCGCCCGGCTGG - Exonic
1154048683 18:10932643-10932665 CAGGCTTGAGCCACCACGCCTGG - Intronic
1154113805 18:11593361-11593383 CAGGCAGGAGACACCACGCCCGG - Intergenic
1154153267 18:11924217-11924239 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1154392229 18:13948041-13948063 CAGGCGTGAGCCACCACGGCTGG + Intergenic
1154457604 18:14544144-14544166 CAGGCAGGGGGCACCACAGCAGG - Intergenic
1154475054 18:14747740-14747762 CACGGTGGAGGCTGCAGGGCTGG - Intronic
1154495370 18:14953542-14953564 CAGGCTTGAGCCACCACAGCTGG + Intergenic
1154987540 18:21567440-21567462 CAGGCTTGAGCCACCACGACCGG + Intronic
1155138848 18:23024160-23024182 CAGGCTCGAGCCACCACGCCCGG + Intronic
1155367323 18:25061422-25061444 CGGGCTGGAGGAACCAAGGCTGG + Intergenic
1155383382 18:25249432-25249454 CAGGCTTGAGCCACCACGCCGGG + Intronic
1155421460 18:25661192-25661214 CAGGCGTGAGCCACCACGGCTGG - Intergenic
1155905310 18:31443699-31443721 CAGGCTCGAGCCACCACGCCCGG + Intergenic
1156074813 18:33261358-33261380 CAGGCTTGAGCCACCACGCCCGG + Intronic
1156253532 18:35374772-35374794 CAGGCTTGAGCCACCACGCCAGG + Intronic
1156276316 18:35586099-35586121 CAGGCATGAGGCACCACGCCTGG + Intronic
1157268461 18:46249507-46249529 CAGGCTTGAGCCACCACGCCCGG + Intronic
1157668893 18:49511829-49511851 CAGGCGTGAGCCACCACGGCTGG + Intergenic
1157678698 18:49586989-49587011 CAGGCTTGAGCCACCACGCCCGG - Intronic
1157934697 18:51859891-51859913 CAGGCTTGAGCCACCATGGCTGG + Intergenic
1157938702 18:51902076-51902098 TAGGCTGGAGGCTGCTCTGCTGG + Intergenic
1158722356 18:59936645-59936667 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1158946111 18:62448273-62448295 CAGACTGGAGGCTGCACTGTCGG + Intergenic
1158974277 18:62696729-62696751 AAGGATGGAGGCAGCAAGGCAGG - Intergenic
1158991703 18:62875229-62875251 CAGGCATGAGGCACCACGTCCGG + Intronic
1159113504 18:64087812-64087834 CAGGCGTGAGCCAGCACGCCTGG - Intergenic
1159274638 18:66200794-66200816 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1159348122 18:67233977-67233999 CAGGCAGGAGCCACCACGACTGG - Intergenic
1159549802 18:69882943-69882965 CAGGCAGGAGCCACCACGCCTGG + Intronic
1159870697 18:73757174-73757196 CAGGCTGGGGGCAGGAGGGTTGG + Intergenic
1159953923 18:74506411-74506433 CAGGCTTGAGCCACCACGCCGGG + Intronic
1160304190 18:77716933-77716955 CAGGCGTGAGGCACCACGCCAGG + Intergenic
1160729872 19:636701-636723 CAGGCGGGAGCCACCACGCCCGG - Intergenic
1160767637 19:815462-815484 CAGCCTGTGGGCACCACGGCTGG - Intronic
1160767681 19:815617-815639 CAGCCTGTGGGCACCACGGCTGG - Intronic
1160770986 19:831014-831036 CAGGCTGAGGGCGGCACAGCAGG + Intronic
1161000136 19:1906571-1906593 CAGGCGTGAGCCACCACGGCCGG - Intronic
1161022717 19:2018095-2018117 CAGGCGGGAGCCATCACAGCCGG + Intronic
1161049021 19:2152262-2152284 CAGGCGTGAGCCACCACGGCTGG - Intronic
1161165368 19:2784238-2784260 CAGGCGTGAGCCACCACGGCCGG - Intergenic
1161191787 19:2961487-2961509 CAGGCATGAGCCACCACGGCCGG - Intergenic
1161250075 19:3275758-3275780 CAGAGTGGAGGCGGCAGGGCAGG - Intronic
1161313980 19:3609316-3609338 CAGTCTGGAGGGAGCAGAGCTGG - Intergenic
1161357422 19:3826713-3826735 CAGGCGTGAGGCACCACGCCCGG + Intronic
1161398269 19:4056205-4056227 GAGGCTGGGGGCAGGACAGCTGG - Intronic
1161526885 19:4761587-4761609 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1161794836 19:6380721-6380743 CAGGCAGGAGGCAGAACCCCTGG + Intronic
1161908477 19:7175234-7175256 CAGGCAGGAGCCACCACGCCCGG - Intronic
1161926280 19:7302621-7302643 CAGGCGTGAGCCAGCACGCCCGG + Intergenic
1162539013 19:11282381-11282403 CAGGCTTGAGCCATCACGCCTGG + Intergenic
1162596809 19:11635761-11635783 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1162889395 19:13721579-13721601 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1162891163 19:13734203-13734225 CAGGCGTGAGCCAGCACGCCTGG + Intronic
1162924842 19:13925301-13925323 CAGGCGTGAGCCAGCACGCCTGG - Intronic
1162987020 19:14277421-14277443 CAGGCTTGAGCCACCATGGCCGG - Intergenic
1163123165 19:15230446-15230468 CAGGCAGGAGCCACCACGCCTGG + Intronic
1163135152 19:15305184-15305206 CAGGCAGGAGCCACCACGCCTGG + Intronic
1163141977 19:15355877-15355899 CAGGCAGGAGCCACCACGCCCGG + Intronic
1163169373 19:15520065-15520087 CAGGCTTGAGCCACCACGCCGGG - Intronic
1163182655 19:15615285-15615307 CAGGCTGGGGGTGGCAGGGCTGG + Intronic
1163190425 19:15673140-15673162 CAGGCTGGGGGTGGCAGGGCTGG + Intronic
1163246199 19:16096204-16096226 CAGGCTTGAGCCATCACGCCTGG + Intronic
1163304099 19:16466623-16466645 CAGGCAGGAGGCACCGCGCCTGG - Intronic
1163329972 19:16629850-16629872 CAGGCTTGAGCCACCACGTCCGG - Intronic
1163660793 19:18576021-18576043 CAGGCGTGAGCCAGCACGCCTGG + Exonic
1163703330 19:18798079-18798101 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1163839706 19:19599558-19599580 CAGGCGTGAGCCACCACGGCTGG - Intronic
1164096564 19:22015304-22015326 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1164297448 19:23925467-23925489 CAGGCTTGAGCCACCACGCCCGG + Intronic
1164637771 19:29804022-29804044 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1164767213 19:30781252-30781274 CAGGCAGGAGGCAGAAATGCAGG + Intergenic
1164994876 19:32713436-32713458 CAGGCTTGAGCCACCACGCCTGG + Exonic
1165103025 19:33450189-33450211 CAGCCAGTAGGCAGCACGGGGGG - Intronic
1165250180 19:34525854-34525876 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1165304913 19:34997787-34997809 CAGGCATGAGCCAGCACGCCTGG - Intronic
1165371370 19:35408457-35408479 CACGGAGGTGGCAGCACGGCGGG + Intergenic
1165384652 19:35503195-35503217 CGGGCTGGAGGAGGCCCGGCAGG - Intronic
1165418385 19:35709601-35709623 CAGGCATGAGGCACCACGCCTGG - Intronic
1165597173 19:37019495-37019517 CAGGCTTGAGCCACCACGCCTGG - Intronic
1165676267 19:37726641-37726663 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1165805938 19:38580580-38580602 CAGGCTGGAGGCACCACGCCCGG - Intronic
1165865061 19:38931873-38931895 CAGGCGTGAGCCACCACGGCTGG - Intronic
1166044534 19:40222337-40222359 CAGGCAGGCGGCGGCAAGGCTGG + Exonic
1166116931 19:40662206-40662228 CAGCCTAGAGCCATCACGGCGGG + Intergenic
1166787609 19:45378336-45378358 CAGGCGTGAGGCACCACGCCCGG + Intergenic
1166887158 19:45968879-45968901 CAGGCGTGAGCCAGCACGCCCGG - Intronic
1166970721 19:46565474-46565496 CAGCCTGAAGTCAGCAGGGCAGG - Intronic
1167378139 19:49122996-49123018 CAGGCAGGAGCCACCACGCCCGG + Intronic
1167504923 19:49866275-49866297 CAGGCTTGAGCCACCACGCCCGG + Intronic
1167617451 19:50543219-50543241 CATGCAGGTGGCAGCGCGGCGGG + Intronic
1167645918 19:50704788-50704810 CAGGCTTGAGCCACCACGCCTGG - Intronic
1167648285 19:50717366-50717388 CAGGCTGGGGCCAGGAGGGCAGG - Intronic
1167974913 19:53217668-53217690 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1168009297 19:53517773-53517795 CAGGCTGAAGGCTGCACTGTTGG - Intergenic
1168095560 19:54112813-54112835 CAGGCTTGAGCCACCACGCCTGG - Intronic
1168107669 19:54174310-54174332 CCGGCTGGAGTCAGCCCTGCGGG - Exonic
1168374620 19:55866307-55866329 CAGGCTTGAGCCACCACGCCCGG + Intronic
1168510808 19:56972198-56972220 CAGGCATGAGCCAGCACGCCCGG + Intergenic
1168639574 19:58021731-58021753 CAGGCTGGAGCCACCATGCCGGG + Intergenic
1168640422 19:58027910-58027932 CAGGCTAGAGCCACCATGGCTGG - Intergenic
925000826 2:401530-401552 CAGCTGGGAGGCAGCACAGCGGG - Intergenic
925017696 2:543948-543970 GAGGCTGGAGGCAGGGAGGCAGG + Intergenic
925072073 2:977492-977514 CAGGGTGGAGGCAGCGGGTCAGG - Intronic
925081707 2:1074153-1074175 CTGCCGGGAGGCAGCAAGGCTGG - Intronic
925245934 2:2382905-2382927 CAGACTGAAGGCTGCACTGCTGG + Intergenic
925329537 2:3047780-3047802 CAGGCTGAAGGCTGCACTGTCGG + Intergenic
925540025 2:4956843-4956865 CAGACTGGAGGCTGCACTGTTGG - Intergenic
925730585 2:6917469-6917491 CAGGCGGGAGGCGGCAGGGCTGG + Exonic
925899296 2:8496870-8496892 CAGGCAGGAGGCAGCTGGCCGGG + Intergenic
926713399 2:15902482-15902504 CAGGCGTGAGCCAGCACGCCTGG - Intergenic
926942651 2:18154551-18154573 CAGACTGAAGGCTGCACTGCCGG - Intronic
926948636 2:18216820-18216842 CAGGCTGGAGCCACCGCGTCCGG - Intronic
927132837 2:20074982-20075004 CAGGATGGAGGCAGGGTGGCTGG - Intergenic
927262531 2:21106808-21106830 CAGGCGTGAGGCACCACGCCTGG + Intergenic
927421297 2:22933998-22934020 CAGGCTTGAGCCACCACGCCCGG - Intergenic
927484663 2:23480207-23480229 CAGGCGTGAGCCACCACGGCCGG - Intronic
927502630 2:23592557-23592579 CAGGCTGCAGCCAGCCTGGCAGG - Intronic
927520484 2:23695378-23695400 CAGGCTGCAGCCAGCCCTGCAGG - Intronic
927686655 2:25175790-25175812 CAGGCTTGAGCCACCACGCCTGG - Intergenic
928584460 2:32744771-32744793 CAGGCGGGAGCCACCACGCCCGG - Intronic
928828451 2:35448435-35448457 CAGGCGTGAGGCACCACGCCTGG - Intergenic
928905469 2:36362918-36362940 CAGGCATGAGACACCACGGCCGG - Intronic
929077481 2:38090365-38090387 CAGGCTCGTGGCAGCATGCCTGG + Intronic
929204561 2:39276147-39276169 CAGGCATGAGCCACCACGGCCGG + Intronic
929575722 2:43050492-43050514 CAGGCTGAAAGCAGCACAGGTGG - Intergenic
929613689 2:43291306-43291328 CAGGCTTGTGCCAGCACGCCCGG - Intronic
930023551 2:47015827-47015849 CAAGCTGGTGGCAGGAGGGCTGG - Intronic
930078029 2:47423376-47423398 CAGGCTTGAGCCACCACGCCTGG + Intronic
930793804 2:55366246-55366268 CAGGCTTGAGCCATCACGCCTGG - Intronic
931134068 2:59377077-59377099 CAGTTTGGAGGCAGCCAGGCAGG - Intergenic
931277765 2:60758704-60758726 CAGGCATGAGGCACCACGCCCGG + Intronic
932415103 2:71568836-71568858 CAGGCTTGAGTCACCACGCCTGG + Intronic
932421859 2:71605935-71605957 CAGGCAGGGGGCAGCCAGGCAGG - Intronic
932469449 2:71944391-71944413 CAGGCAGGAGGCAGGACCTCAGG - Intergenic
932667020 2:73706195-73706217 CAGGCAGGAGTCAGCACGCCAGG + Intergenic
933548774 2:83747225-83747247 CAGGCACGAGCCAGCACGCCTGG + Intergenic
933740092 2:85526477-85526499 CAGGCTCGTGCCACCACGGCTGG + Intergenic
933795649 2:85917441-85917463 CAGGCTTGAGCCACCACGCCCGG + Intergenic
934013357 2:87851108-87851130 CAGGCGGGAGCCACCACGCCCGG - Intergenic
934138902 2:89025697-89025719 CAGGCTTGAGCCACCACGTCAGG + Intergenic
934245530 2:90302154-90302176 CAGGCTTGAGCCACCACGCCGGG - Intergenic
934263216 2:91494885-91494907 CAGGCTTGAGCCACCACGCCGGG + Intergenic
934563129 2:95323462-95323484 CAGGCTGGAGCCCGCAGGCCTGG + Intronic
934587244 2:95512427-95512449 CAGGCTTGAGCCACCACGCCAGG + Intergenic
934931501 2:98429485-98429507 CAGGCAGGAGGCACCACATCCGG + Intergenic
935352998 2:102170781-102170803 CAGGCTTGAGCCACCACGCCTGG - Intronic
935402056 2:102670291-102670313 CAGGCAGGAGCCACCACGCCCGG + Intronic
935429317 2:102957672-102957694 CAGGCTTGAGCCACCACGCCTGG - Intergenic
935506836 2:103915797-103915819 CAGGCTTGAGCCACCACGCCGGG - Intergenic
936083345 2:109450066-109450088 CAGGCTTGAGCCACCACGCCTGG - Intronic
936455886 2:112674012-112674034 CAGGCGTGAGCCAGCACGCCCGG - Intergenic
937000911 2:118466772-118466794 CCGGCTTGGGGCAGGACGGCTGG - Intergenic
937156330 2:119722101-119722123 CAGGCTTGAGCCACCACAGCTGG - Intergenic
937280180 2:120712490-120712512 CAGGCTTGGGGCTGAACGGCAGG - Intergenic
937341681 2:121095410-121095432 GAGGCTGGAGGGAGGACGGACGG - Intergenic
937657340 2:124391676-124391698 CAGGCGTGAGCCAGCACGCCCGG - Intronic
937851607 2:126641404-126641426 CAGGCTTGAGCCATCACGCCCGG - Intergenic
937915865 2:127098425-127098447 CAGACTGGAGGCAGCAGTGGGGG + Intronic
938034056 2:128021169-128021191 CAGGCTTGAGCCACCACGCCCGG - Intronic
938059684 2:128242656-128242678 CAGGCATGAGGCACCACGCCCGG + Intronic
938066761 2:128285673-128285695 CAGGCAGGAGTCAGCCTGGCAGG - Intronic
938162579 2:128999278-128999300 CAGTCAAGAGGCAGCACTGCAGG - Intergenic
938272497 2:129986159-129986181 CAGACTGAAGGCTGCACGGTTGG + Intergenic
938443737 2:131359951-131359973 CAGACTGAAGGCTGCACGGGTGG - Intergenic
938509074 2:131921164-131921186 CAGACTGAAGGCTGCACTGCCGG - Intergenic
938897311 2:135765089-135765111 CAGGCTTGAGCCACCACGTCTGG + Intronic
939417705 2:141922820-141922842 CAGGCAGGAGCCACCACGCCTGG - Intronic
939823103 2:146981198-146981220 CAGGCTTGAGCCACCACGCCCGG - Intergenic
939844528 2:147227523-147227545 CAGGCCAGAGGCAGCATGGTAGG + Intergenic
940072839 2:149708808-149708830 GAGGCTAGAGCCAGCAAGGCTGG - Intergenic
940265555 2:151831759-151831781 CAGGCAGGAGCCACCACGCCCGG + Intergenic
941036358 2:160573101-160573123 CAGGCTGAAGGCTGCACTGCTGG + Intergenic
941262117 2:163310625-163310647 CAGGCTGGGGGCAGCGTGGGGGG - Intergenic
941642437 2:168003251-168003273 CAGGCTTGAGCCACCACGCCTGG + Intronic
941953829 2:171184363-171184385 CAGGCGTGAGGCACCACGCCTGG - Intronic
941965402 2:171295684-171295706 TAGGCCTGAGGCAGCACGCCCGG + Intergenic
941981367 2:171461165-171461187 CAGGCATGAGGCACCACGCCTGG - Intronic
942086723 2:172450675-172450697 CAGGCTTGAGGCACCATGCCCGG - Intronic
942287878 2:174438782-174438804 CAGGCATGAGCCAGCACGCCCGG + Intronic
942592695 2:177562538-177562560 CAGGCATGAGGCACCACGCCTGG - Intergenic
943357786 2:186879278-186879300 CAGGCTGGTGCCACCACGCCTGG + Intergenic
943568977 2:189550064-189550086 CAGGCTGGAGCCACCACGCCCGG - Intergenic
943750604 2:191505859-191505881 CAGGCTTGAGCCACCACGCCTGG - Intergenic
944572865 2:201062239-201062261 CAGGCTGGAGCCACCATGTCTGG - Intronic
944670241 2:201988382-201988404 CAGGCTTGAGCCACCACGCCCGG - Intergenic
944700593 2:202242474-202242496 CAGGCTTGAGCCACCACGCCCGG + Intergenic
944728065 2:202491679-202491701 CAGGCATGAGGCACCACGCCTGG + Intronic
944732267 2:202528462-202528484 CAGGCGTGAGCCAGCACGCCTGG + Intronic
944749528 2:202694466-202694488 CAGGCTTGAGCCACCACGCCTGG + Intronic
944802303 2:203248254-203248276 CAGGCAGGAGCCATCACGCCCGG - Intronic
944809142 2:203310617-203310639 CAGGCATGAGCCACCACGGCTGG + Intergenic
944971876 2:205002637-205002659 CAGGGTGGAGGCAGAAGAGCAGG - Intronic
945266760 2:207898474-207898496 CAGGCGTGAGCCAGCACGCCTGG - Intronic
945352047 2:208792104-208792126 CAGGCTTGAGCCACCACGCCTGG + Intronic
946303900 2:218844870-218844892 CAGGCGTGAGGCAACGCGGCTGG - Intergenic
946323310 2:218967128-218967150 CAGGCTTGAGCCACCACGCCCGG - Intergenic
946338380 2:219053613-219053635 CAGGCAGGAGCCACCACGCCCGG - Intergenic
946347002 2:219118779-219118801 AAGGCTGGAGACAGCCCGGCGGG + Intronic
946671154 2:222105869-222105891 CTGGCTGGAGGGAGCAGGGGAGG - Intergenic
946803210 2:223443011-223443033 CAGACTGGAAGCAGAACAGCAGG + Intergenic
947224884 2:227830386-227830408 CAGGCTTGAGCCACCACGCCGGG + Intergenic
947256001 2:228164248-228164270 CAGGCTGAAGGCTGCACTGTTGG + Intronic
947359653 2:229334242-229334264 CAGGCTTGAGCCACCACGCCCGG + Intergenic
947766433 2:232640860-232640882 CTGGGTGGAGGCAGCAGGGAAGG + Intronic
948056113 2:235010312-235010334 CAGGCTGGGCCCAGCACGGGAGG - Intronic
948084137 2:235232387-235232409 CAGGGTGCAGGCAGCCGGGCTGG + Intergenic
948491405 2:238315415-238315437 CAAACTGGAGGAAGCCCGGCTGG - Intergenic
948502053 2:238402619-238402641 CAGGCATGAGCCACCACGGCTGG - Intergenic
948798117 2:240416479-240416501 CAGGCATGAGGCAACAAGGCTGG - Intergenic
949006760 2:241653847-241653869 CAGGCAGGAGCCACCACGCCTGG - Intronic
949013838 2:241698165-241698187 CAGGCGTGAGCCACCACGGCGGG - Intergenic
949069285 2:242013654-242013676 AAGGCAGGACGCAGCACTGCTGG - Intergenic
1169129295 20:3156452-3156474 CAGGCAGGAGCCACCACGCCCGG + Intronic
1169148388 20:3269675-3269697 CAGGCGTGAGGCACCACGCCTGG - Intronic
1169266250 20:4168832-4168854 CAGGCTTGAGGCACCATGCCTGG + Intronic
1169293739 20:4374987-4375009 CAGGCATGAGGCAGCATGCCCGG - Intergenic
1170366011 20:15599101-15599123 CAGGCATGAGCCACCACGGCCGG - Intronic
1170604717 20:17867061-17867083 CAGTTTGGAGGCAACAGGGCTGG + Intergenic
1170755253 20:19197849-19197871 CAGGCGTGAGGCAGCAGGCCTGG + Intergenic
1170824502 20:19782285-19782307 CAGGCGTGAGCCACCACGGCTGG - Intergenic
1170883336 20:20317017-20317039 CAGGCTTGAGCCAGCATGCCCGG + Intronic
1171072944 20:22092751-22092773 CAGGATGGAGGGGGCATGGCAGG + Intergenic
1171294872 20:24008649-24008671 CTGCCTGGAGGCAGCAGGGCTGG - Intergenic
1171428611 20:25064441-25064463 CAGGTTGGAGGCAGAACAGAGGG - Intergenic
1171962856 20:31507478-31507500 CAGGCATGAGCCAGCACGCCCGG + Intergenic
1172105030 20:32511705-32511727 CAGGCATGAGCCAGCACGCCCGG - Intronic
1172150935 20:32789867-32789889 CAGGCGGGAGCCACCACGCCTGG + Intronic
1172248546 20:33462977-33462999 CAGGCTGGTGGCCTCAGGGCTGG + Intergenic
1172362031 20:34319579-34319601 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1172402971 20:34665615-34665637 CAGGCGGGAGCCACCACGCCTGG + Intronic
1172923910 20:38513035-38513057 CAGGCTTGAGCCACCACGCCCGG + Intronic
1173118301 20:40267582-40267604 CAGGCAGGAGCCACCACGCCTGG - Intergenic
1173669390 20:44787494-44787516 CAGCCTGGAGGTGGCAGGGCTGG + Intronic
1173890630 20:46506832-46506854 CAGGCATGAGGCACCACGCCTGG - Intronic
1174015552 20:47485362-47485384 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1174066633 20:47870453-47870475 CAGGCAGGAGCCACCACGCCCGG + Intergenic
1174255546 20:49251972-49251994 CAGGCATGAGGCACCACGCCTGG + Intronic
1174365880 20:50055938-50055960 CAGGCGGGAGCCACCACGCCTGG + Intergenic
1174387835 20:50197791-50197813 GAGCCTGGAGCCAGCATGGCTGG + Intergenic
1175112839 20:56660874-56660896 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1175384086 20:58583180-58583202 AAGGCTGGGGCCAGCAGGGCCGG + Intergenic
1175676424 20:60949963-60949985 CAGGCGGGAGCCACCACGCCCGG - Intergenic
1175736059 20:61388127-61388149 CAGGGTGGAGACGGCAGGGCTGG + Intronic
1175764177 20:61581614-61581636 CAGGAGGGAGGAAGCAGGGCGGG - Intronic
1175785366 20:61708570-61708592 GAGGCTGGAGGGAGCAGGGCTGG - Intronic
1175985899 20:62764046-62764068 CAGCCAGGTGGCAGCAGGGCTGG + Intergenic
1176077473 20:63254834-63254856 CACGCCGGAGGGCGCACGGCGGG - Intronic
1176081313 20:63274648-63274670 CAGCCTGGAGGCAGCAGACCTGG - Intronic
1176224822 20:63990929-63990951 CAGGCTTGAGCCACCACGCCAGG + Intronic
1176784412 21:13237375-13237397 CAGACTGAAGGCTGCACTGCCGG + Intergenic
1176816553 21:13609194-13609216 CAGGCAGGGGGCACCACAGCAGG + Intergenic
1177159098 21:17528683-17528705 CAAGCGTGAGGCAGCACGCCCGG + Intronic
1177269544 21:18829672-18829694 CAGGCATGAGCCACCACGGCCGG - Intergenic
1177550487 21:22614875-22614897 CAGGCGGGAGCCACCACGCCTGG - Intergenic
1177938625 21:27381612-27381634 CAGGCAAGAGCCACCACGGCCGG - Intergenic
1178135466 21:29622222-29622244 CAGGCTTGAGCCACCACGCCCGG + Intronic
1178462833 21:32818544-32818566 CAGTGTGGATGCAGCAGGGCAGG - Intergenic
1178564755 21:33672984-33673006 CGGGCGGGAGGCACCACGCCTGG + Intronic
1178853184 21:36230111-36230133 CAGGCTTGAGCCACCACGCCTGG + Intronic
1178874652 21:36404374-36404396 CAGGCTTGAGCCACCACGCCCGG + Intronic
1179323210 21:40313085-40313107 CAGGCTGGAGTCACCCAGGCTGG - Intronic
1179331121 21:40402344-40402366 CAGGCTCGAGCCACCACGCCCGG + Intronic
1179469475 21:41601090-41601112 GAGGATGGAGACAGCAGGGCTGG + Intergenic
1179642757 21:42758040-42758062 CAGGCAGCAGGCAGCTGGGCTGG + Intronic
1179668297 21:42927598-42927620 CAGGCGTGAGCCACCACGGCCGG - Intergenic
1179725791 21:43340632-43340654 CAGGCTGGAGGGCGCATGCCGGG - Intergenic
1179813165 21:43885110-43885132 CAGGGTGAGGGGAGCACGGCCGG - Intronic
1180093546 21:45544062-45544084 CCGCCTGGAGACAGCAAGGCAGG + Intronic
1180622002 22:17168635-17168657 CAGGCTGGAGCCAGCGTGCCTGG + Intergenic
1180717891 22:17884313-17884335 CAGGCAGGCAGCAGGACGGCTGG + Intronic
1180781697 22:18523865-18523887 CAGGCGTGAGCCACCACGGCTGG - Intergenic
1180793247 22:18588756-18588778 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1181003751 22:19999814-19999836 CAGGCTGGAGACAGAACCACCGG + Intronic
1181141884 22:20811734-20811756 CAGGCGTGAGCCACCACGGCTGG - Intronic
1181228490 22:21406557-21406579 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1181238581 22:21463208-21463230 CAGGCGTGAGCCACCACGGCTGG - Intergenic
1181250159 22:21528293-21528315 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1181396434 22:22626245-22626267 CAGGCAGGTGCCAGCACGCCTGG + Intergenic
1181585696 22:23852359-23852381 CAGGCTGGAGCCACCACACCTGG + Intergenic
1181678511 22:24473981-24474003 CAGGCATGAGCCAGCACGCCCGG + Intergenic
1181704562 22:24641807-24641829 CAGGCAGGTGCCAGCACGCCTGG + Intergenic
1181909331 22:26226058-26226080 CAGGGTGGTGGCAGCAGGGATGG - Intronic
1181922520 22:26331704-26331726 CAGGCTTGAGCCACCACGCCTGG - Intronic
1181991089 22:26837406-26837428 CAGGCTTGAGCCACCACGTCCGG + Intergenic
1182066676 22:27435995-27436017 CAGCCTGGAGCCCGCCCGGCCGG - Intergenic
1182431986 22:30304611-30304633 CAGGCTGGAGGAAGTACCCCTGG - Exonic
1182452969 22:30432273-30432295 ATGGCGGGAGGCAGCACTGCAGG - Intergenic
1182574921 22:31266566-31266588 CAGCTTGGGGGCAGCAGGGCTGG + Intronic
1182609310 22:31533248-31533270 CAGGCAGGAGCCACCACGCCCGG - Intronic
1182663277 22:31940220-31940242 CAGGCATGAGCCACCACGGCTGG + Intronic
1182665226 22:31953745-31953767 CAGAGTGGAGGCAGCACCCCTGG + Intronic
1182666655 22:31965050-31965072 CAGGCGTGAGGCACCACGCCTGG + Intergenic
1182824928 22:33256926-33256948 TAGGCTTGAGCCAGCACAGCCGG - Intronic
1182827571 22:33278993-33279015 CAGGCATGAGCCACCACGGCCGG + Intronic
1183202301 22:36394044-36394066 CAGGCGTGAGCCACCACGGCTGG - Intergenic
1183218537 22:36496901-36496923 CAGGCGTGAGTCAGCACGCCTGG - Intronic
1183317855 22:37146667-37146689 TAGGCTGGCAGCAGCAGGGCCGG + Intronic
1183318135 22:37148118-37148140 CAGCCTAGAGGCAGCCGGGCAGG + Intronic
1183489261 22:38108080-38108102 CAGCCTGGGAGCAGCCCGGCAGG + Intronic
1183492254 22:38122913-38122935 CAGGCTGGAAGGAGAAGGGCTGG - Intronic
1183553136 22:38505184-38505206 CAGGCCTGAGGCACCACGCCCGG + Intronic
1183633155 22:39045628-39045650 CAGGCAGGGGGCAGGACGGAGGG - Intronic
1183747082 22:39698232-39698254 CAGGCTGCAGGAAGCGCGGGAGG + Intergenic
1183890879 22:40927595-40927617 CAGGCTTGAGCCACCACGCCCGG - Exonic
1183891039 22:40928952-40928974 CAGAATGGAGGCTGCACAGCTGG + Exonic
1183920810 22:41166060-41166082 CAGGCGGGAGCCACCACGCCTGG + Intronic
1183945598 22:41324135-41324157 TAGGCTGGAGGCAGGAGGCCAGG + Intronic
1183999894 22:41665657-41665679 CAGGCGTGAGCCAGCACGCCTGG - Intergenic
1184052817 22:42021195-42021217 CAGGCGTGAGCCAGCACGCCTGG + Intronic
1184166494 22:42732075-42732097 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1184547847 22:45184231-45184253 CGGGCTGGAGGGAGGACGGAAGG + Intronic
1184718008 22:46292886-46292908 CAGGGTGGAGGCGGCCAGGCTGG - Exonic
1184789259 22:46689237-46689259 GGGGCAGGAGGCAGCAGGGCTGG - Intronic
1184850876 22:47119637-47119659 CAGGCACGTGGCAGCACGCCCGG + Intronic
1184853197 22:47132515-47132537 CAGGCCAGAGACAGCAGGGCGGG - Intronic
1185271789 22:49933180-49933202 CAGGCTTGAGCCACCACGACCGG + Intergenic
1185400343 22:50612337-50612359 CAGGCAGGGGTCAGCATGGCCGG + Intronic
1185422093 22:50740447-50740469 CAGCCTGGAAGCAGGAAGGCTGG - Intronic
949299155 3:2562864-2562886 AAGGCAGGAGCCACCACGGCTGG + Intronic
949470992 3:4396438-4396460 CAGGCAGGAGGCATCACCACGGG + Intronic
949840627 3:8316076-8316098 CAGGCTTGAGCCACCACGCCTGG - Intergenic
949953676 3:9250100-9250122 CACACTGGAGGCAGAACAGCTGG + Intronic
950056611 3:10030062-10030084 CAGGCTTGAGCCACCACGCCTGG + Intronic
950176416 3:10877963-10877985 TAGGCTGGTGGCAGCAGGGGTGG - Intronic
950493657 3:13321044-13321066 CACGCTGGCTGCAGCAAGGCAGG + Intronic
950516424 3:13469158-13469180 CAGGCTTGAGCCACCACGCCTGG - Intergenic
950577290 3:13839891-13839913 CAGCCAGGAGGGAGCAGGGCTGG + Intronic
950735963 3:15008377-15008399 CAGGCTCGTGCCAGCACGCCTGG - Intronic
950906864 3:16546385-16546407 CAGGCGGGCGGCTGCACTGCTGG - Intergenic
951103931 3:18721018-18721040 CAGGCTGGAAGAGGCAAGGCTGG + Intergenic
951403249 3:22261712-22261734 CAACCTGGAGGCAAAACGGCAGG - Intronic
951574146 3:24096457-24096479 CAGCCTGGAAGGAGCATGGCTGG + Intergenic
951718195 3:25671472-25671494 CAGGCATGAGCCAGCACGCCCGG + Intergenic
951805843 3:26642739-26642761 CAGGCACGAGGCACCACGCCCGG - Intronic
952155248 3:30636785-30636807 CAGGCTTGAGCCACCACGCCTGG - Intronic
952229258 3:31412555-31412577 CAGGCTGGAGCCACCATGCCTGG + Intergenic
952339006 3:32429566-32429588 CAGGCGTGAGCCATCACGGCTGG + Intronic
952511645 3:34064039-34064061 CAGGCTTGAGCCACCACGCCTGG + Intergenic
953125591 3:40088867-40088889 CTGGCTGGAGGCAGGAAGTCAGG + Intronic
953528381 3:43714408-43714430 CAGGCTTGAGCCATCACGCCTGG + Intronic
953533935 3:43762839-43762861 CAGGCTTGAGCCACCACGCCTGG - Intergenic
953679391 3:45028276-45028298 CAGGCTTGAGCCACCACGCCTGG - Intronic
954467457 3:50664619-50664641 CAGGCTTGAGCCACCACGCCAGG - Intergenic
954555575 3:51515197-51515219 CAGGCTTGAGTCACCACGCCTGG + Intergenic
954736208 3:52708906-52708928 CAGGCTTGAGGCACCATGCCTGG - Exonic
954784379 3:53082197-53082219 CAGGCATGAGCCACCACGGCTGG - Intronic
955185266 3:56709197-56709219 CAGGCTTGAGCCACCACGCCCGG - Intergenic
955226418 3:57063987-57064009 CAGGCGTGAGCCAGCACAGCTGG - Intronic
955875960 3:63490524-63490546 CAGGGTGGAGGCAGCAGAGAGGG + Intronic
956442322 3:69292566-69292588 TAGGCAGGAGGCACCAGGGCTGG - Intronic
956654081 3:71532372-71532394 CAGGCATGAGCCACCACGGCCGG + Intronic
956825083 3:72990186-72990208 CAGGCTTGAGTCACCACGCCTGG + Intronic
957486786 3:80871724-80871746 CATGCTGGCTGCAGCAGGGCAGG - Intergenic
957675917 3:83364385-83364407 CAGGCGTGAGGCACCACGCCCGG - Intergenic
958044067 3:88262545-88262567 CAGGCGGGAGGCACCATGCCTGG - Intergenic
958075139 3:88666710-88666732 CAGGCTTGAGCCACCACGCCCGG + Intergenic
958958840 3:100490034-100490056 CAGGCATGAGGCACCACGCCTGG + Intergenic
958981185 3:100721871-100721893 CAGGCGTGAGCCACCACGGCCGG - Intronic
959347720 3:105220465-105220487 CAGGCTTGAGCCACCACGCCTGG - Intergenic
959485145 3:106920107-106920129 CAGGCTTGAGCCACCACGCCCGG - Intergenic
959691832 3:109206121-109206143 CAGGCATGAGGCACCACGCCCGG - Intergenic
960632321 3:119744509-119744531 CAGGCTGGAGGGAGGACAGAGGG + Intronic
960801762 3:121547111-121547133 CAGGCGTGAGCCACCACGGCCGG - Intergenic
961126463 3:124422985-124423007 CAGGCTGAAGGAAGAAGGGCTGG - Intronic
961238026 3:125385353-125385375 CAGGCGTGAGCCACCACGGCTGG - Intergenic
961263214 3:125619116-125619138 CAGGCTGAAGGCTGCACTGTTGG + Intergenic
961447809 3:126989083-126989105 CAGGAGGCAGGCAGCATGGCGGG + Exonic
961539448 3:127590114-127590136 CCGGCTGGAGGCAGTGCGGGTGG - Intronic
961768770 3:129232718-129232740 CAGGCTTGAGCCACCACGCCTGG + Intergenic
961831997 3:129627627-129627649 CGGGGTGGAGGCAGCCCTGCGGG + Intergenic
962036115 3:131653465-131653487 AAGGCTGGAGGCAGGAGGTCTGG - Intronic
962135573 3:132728283-132728305 CAGGCATGAGCCAGCACGCCGGG - Intergenic
962163227 3:133021680-133021702 CAGGCTTGAGCCACCACGCCTGG - Intergenic
962568506 3:136688667-136688689 CAGGCAGGAGCCACCACGCCTGG + Intronic
962736057 3:138326710-138326732 CAGGCATGAGCCAGCACGCCTGG + Intronic
963153301 3:142069884-142069906 CAGGCTTGAGCCACCACGCCTGG + Intronic
963203920 3:142613335-142613357 CAGGCTTGAGCCACCACAGCTGG - Intronic
963207715 3:142653501-142653523 CAGGCTCAAGCCACCACGGCCGG + Intronic
963447042 3:145425603-145425625 CAGGCTTGAGACACCACGCCTGG + Intergenic
963748422 3:149149238-149149260 CAGGCTTGAGCCACCACGCCTGG + Intronic
963822346 3:149911378-149911400 CAGGCGTGAGCCACCACGGCAGG - Intronic
963954025 3:151233454-151233476 CAGGCGGGAGCCATCACGCCCGG - Intronic
963976950 3:151491297-151491319 CAGGCTTGAGCCACCACGCCTGG - Intergenic
964590980 3:158361428-158361450 GAGGGTGGAGGCAGCACAGCCGG + Intronic
964609118 3:158591435-158591457 CAGGCATGAGGCACCACGCCTGG + Intronic
964676312 3:159284772-159284794 CAGGCTTGAGCCACCACGCCTGG + Intronic
964764324 3:160164187-160164209 CAGGCTTGAGCCACCACGCCTGG - Intergenic
965071122 3:163916567-163916589 CAGACTGTAGGCAGCACTGTCGG + Intergenic
965076571 3:163986738-163986760 CAGGCTGAAAGCACCATGGCAGG - Intergenic
965252893 3:166365184-166365206 CAGGCATGAGGCACCACGCCCGG + Intergenic
965478199 3:169184139-169184161 CAGGCTTGAGCCACCACGCCTGG + Intronic
965494806 3:169384823-169384845 CAGGCTGGAGCCACCACACCCGG - Intronic
965703498 3:171482127-171482149 CAGGCTTGAGCCACCACGCCCGG + Intergenic
965767547 3:172147028-172147050 CAGGCGTGAGGCACCACGCCTGG - Intronic
966395596 3:179499434-179499456 CAGGCTTGAGCCACCACGCCTGG + Intergenic
966713935 3:182996903-182996925 CAGGCTTGAGCCACCACGCCTGG + Intergenic
966884227 3:184366613-184366635 CAGGCTTGAGCCACCACGCCCGG + Intronic
966894235 3:184430590-184430612 CAGCCTTGAGCCAGCACGCCTGG + Intronic
967037949 3:185662198-185662220 CAGGCTTGAGCCACCACGTCTGG - Intronic
967128606 3:186449721-186449743 CAGCCTGGTGCCACCACGGCCGG + Intergenic
967206414 3:187126439-187126461 CAGGCTTGAGCCACCACGCCCGG + Intronic
967403147 3:189086079-189086101 CAGGCTGAAGGCTGCACTGTCGG - Intronic
967744786 3:193043007-193043029 CAGGCGTGAGGCACCACGCCTGG + Intergenic
967841227 3:194006269-194006291 AAGGCTGGAGGTAGCTCTGCAGG + Intergenic
968082624 3:195857109-195857131 CAGGCTTGAGACACCACGCCCGG - Intergenic
968121839 3:196131375-196131397 CAGGCTTGAGCCACCACGCCCGG - Intergenic
968320701 3:197765582-197765604 CAGGCGTGAGCCACCACGGCTGG - Intronic
968568178 4:1325988-1326010 CAGGGCAGAGGCAGCAGGGCAGG + Intronic
968628242 4:1637615-1637637 AGGGCTGGGGGCAGCCCGGCAGG + Intronic
968648045 4:1749576-1749598 AGGGCTGGAGGCAGCACACCAGG + Intergenic
968755099 4:2411640-2411662 CAGCCAGGAGGAAGCAGGGCTGG - Intronic
968858609 4:3148518-3148540 CAGGCTTGAGCCACCACGCCCGG - Intronic
968876640 4:3271355-3271377 CAGGCGTGAGGCACCACGCCCGG + Intronic
968918753 4:3511583-3511605 AAGGCTAGAGGCAGCATGTCGGG - Exonic
969592384 4:8129355-8129377 CAAGCTGGAGGCAGCTGAGCTGG - Intronic
969598800 4:8163648-8163670 CAGGGTGGGGGCAGCAGGCCTGG - Intergenic
969615307 4:8248713-8248735 CAGGCGTGAGCCACCACGGCTGG - Intergenic
969697974 4:8746010-8746032 CAGGCTGGGGCCAGCGCTGCAGG + Intergenic
970415680 4:15854649-15854671 CAGACTGAAGGCTGCACTGCTGG - Intergenic
970440860 4:16080241-16080263 CAGGCTTGAGCCACCACGCCCGG - Intronic
970776027 4:19675144-19675166 CAGGCTTGAGCCACCACGCCCGG - Intergenic
971043980 4:22784224-22784246 CAGGCTGAAGGCTGCACTGTTGG + Intergenic
971085315 4:23267991-23268013 CAGGCTTGAGCCACCATGGCTGG + Intergenic
971322611 4:25617424-25617446 CAGGGTGGAGGCAGCCAGACTGG + Intergenic
971332341 4:25692551-25692573 CAGGCTTGAGCCACCACGCCTGG - Intergenic
971395444 4:26222876-26222898 CAGGCTTGAGCCACCACGCCTGG - Intronic
971398765 4:26255523-26255545 CAGGCTTGAGCCACCACGCCCGG - Intronic
972116814 4:35646470-35646492 CAGGCTGAAGGCTGCACTGTTGG - Intergenic
972117027 4:35649135-35649157 CAGGCTGAAGGCTGCACTGTTGG + Intergenic
972285578 4:37644735-37644757 CAGGCATGAGCCAGCACGCCCGG + Intronic
972526107 4:39913354-39913376 CAGGCATGAGCCACCACGGCTGG + Intronic
972532558 4:39974782-39974804 CAGGCTGGAGCCACCACACCAGG + Intronic
972661134 4:41117566-41117588 CAGGCGTGAGGCACCACGCCTGG + Intronic
973535971 4:51882379-51882401 CAGGTTGGAGGATGCACGACGGG + Intronic
973811253 4:54572379-54572401 CAGGCAGGAGGCATCTCTGCAGG - Intergenic
974203080 4:58666154-58666176 CAGACTGAAGGCTGCACTGCTGG - Intergenic
974320287 4:60338595-60338617 CAGGCATGAGCCAGCACGCCTGG + Intergenic
974906402 4:68063654-68063676 CAGGCTTGAGCCATCACCGCTGG + Intronic
974933012 4:68381759-68381781 CAGGCATGAGGCACCACGACTGG + Intergenic
975450075 4:74515130-74515152 CAGGCATGAGGCACCACGCCTGG - Intergenic
975583354 4:75926725-75926747 CAGGCTTGAGCCAGCACATCTGG - Intronic
976709598 4:88054929-88054951 CAGGCTTGAGCCACCACGCCCGG + Intronic
976966605 4:91050151-91050173 CAGGCTGGAGCCACCACTCCTGG - Intronic
977235922 4:94507065-94507087 CAGGCTGAAGGCTGCACTGTAGG + Intronic
977466032 4:97383641-97383663 CAGGCTGGAGGAAAGAAGGCAGG - Intronic
977691497 4:99916855-99916877 CAGGCTTGAGCCACCACGCCCGG - Intronic
978012409 4:103703821-103703843 CAGGCGTGAGCCACCACGGCCGG - Intronic
978190094 4:105900700-105900722 CAGGCAGGAAGCAGCAGGACAGG - Intronic
978371503 4:108034014-108034036 CAGGCTTCAGGCAGCACAGGTGG + Intronic
979519524 4:121650493-121650515 CAGGCATGAGCCACCACGGCTGG - Intergenic
979526446 4:121722513-121722535 CAGGCATGAGGCACCACGCCCGG - Intergenic
979758697 4:124373716-124373738 CAGCCTGGTGGCAGCAAGGGTGG + Intergenic
980053079 4:128057322-128057344 CAGGCTTGAGCCACCACGCCTGG + Intergenic
980109068 4:128617435-128617457 CAGGCTTGAGCCACCACGCCTGG - Intergenic
980340309 4:131535877-131535899 CAGGCTTGAGCCACCACGCCCGG - Intergenic
981093925 4:140759380-140759402 CAGGCTTGAGCCACCACGCCTGG - Intergenic
981248731 4:142573036-142573058 CAGGCTACAGGAAGCATGGCTGG + Intronic
981304186 4:143228848-143228870 CAGGCTTGAGCCACCACGCCTGG - Intergenic
981476535 4:145192504-145192526 CAGGCAGGAGGCACCATGCCCGG + Intergenic
981554565 4:145978790-145978812 CAGGCTGGATGGAGAAAGGCCGG - Intergenic
981855052 4:149279439-149279461 CAGATTGGAGCCACCACGGCTGG - Intergenic
981862180 4:149370036-149370058 CAGGCTGGGGCCACCACGTCTGG + Intergenic
981983694 4:150828240-150828262 CAGGCTGGTGGCAGAAGGGCAGG + Exonic
981986969 4:150869194-150869216 CAGGCATGAGCCACCACGGCCGG + Intronic
982421840 4:155208259-155208281 CAGGCTGGCGGGAGGAGGGCCGG - Intergenic
982428880 4:155298818-155298840 AAGGCTCAAGGCAGCAGGGCTGG + Intergenic
983017045 4:162626388-162626410 CAGGCTTGAGCCACCACGCCTGG + Intergenic
983785144 4:171720739-171720761 CAGACTGCAGGCTGCACTGCTGG + Intergenic
983816049 4:172127823-172127845 CAGGCTTGAGCCACCACGCCCGG - Intronic
983939817 4:173527298-173527320 CGGGCTGGCCGCAGCACGTCTGG - Exonic
984280757 4:177667625-177667647 CAGGCATGAGCCACCACGGCTGG - Intergenic
984805118 4:183745091-183745113 CAGGCTTGAGCCACCACGCCTGG + Intergenic
985161376 4:187048076-187048098 AAGGGCGGAGGCAGAACGGCCGG - Intergenic
985318559 4:188683907-188683929 CAGGCTGCAGGCAGCACGGCTGG - Intergenic
985651814 5:1111191-1111213 CAGGATGGAGGGAACAGGGCTGG + Intronic
985655752 5:1130615-1130637 CAGGGTGGGGGCAGCAGGGAGGG + Intergenic
985883910 5:2661425-2661447 CAGGCTTGAGCCACCACGCCCGG - Intergenic
986182690 5:5408343-5408365 CAGGCATGAGGCACCACGCCTGG + Intergenic
986243979 5:5988494-5988516 CAGGCTTGAGCCACCACGCCCGG + Intergenic
986471592 5:8081644-8081666 CTGGCTTCAGGCAGCACGGTGGG + Intergenic
986864223 5:11965856-11965878 CAGGCTGGAGCCACCGCGCCTGG + Intergenic
987005522 5:13705937-13705959 CACTCTGAAGGGAGCACGGCTGG + Intronic
987027723 5:13944455-13944477 CAGGCTGGAGTCAGCTCTTCCGG + Exonic
987152827 5:15059106-15059128 AAGGCTGGTGGCAGCATGGGTGG - Intergenic
987236760 5:15950455-15950477 CTGGCAGGAGGCCGCAAGGCTGG + Intergenic
987306109 5:16639348-16639370 CAGGCATGAGCCAGCACGCCTGG + Intergenic
987389403 5:17361943-17361965 CAGGCAGGAGCCACCACGCCCGG + Intergenic
987467375 5:18287948-18287970 CAGGCATGAGCCACCACGGCTGG + Intergenic
987806020 5:22769453-22769475 CAGGCTGAAGGCTGCACTGTTGG + Intronic
988468193 5:31511425-31511447 CAGGCGTGAGCCAGCACGCCTGG - Intronic
988585399 5:32503566-32503588 CAGGCGTGAGCCAGCACGCCCGG - Intergenic
989382650 5:40824377-40824399 CAGGCGTGAGCCACCACGGCTGG + Intergenic
990181200 5:53162667-53162689 CAGACTGAAGGCTGCACGGTTGG - Intergenic
990513145 5:56507381-56507403 CAGGCTTGAGCCAGCATGCCTGG + Intergenic
990576666 5:57129833-57129855 CAGGCTTGAGCCACCACGCCGGG - Intergenic
990751835 5:59024472-59024494 CAGGCTTGAGGCACCACGCCCGG + Intronic
991065052 5:62415743-62415765 CAGGCTTGAGCCACCACGCCCGG + Intronic
991299446 5:65114889-65114911 CAGGCATGAGGCACCACGCCTGG - Intergenic
991349569 5:65706981-65707003 CAGGCTTGAGCCACCACGCCTGG - Intronic
991358259 5:65792490-65792512 CAGGCAGAAGGCAGCCAGGCTGG - Exonic
991362654 5:65836860-65836882 CAGGCGTGAGGCACCACGCCTGG + Intronic
991401281 5:66254298-66254320 CAGGCATGAGCCACCACGGCTGG + Intergenic
991914407 5:71591712-71591734 CAGGCGTGAGCCACCACGGCTGG + Intronic
992181500 5:74202296-74202318 CAGTCAGGAGGCAGGACAGCGGG + Intergenic
992232185 5:74674324-74674346 CAGGCTTGAGCCACCACGCCTGG - Intronic
992690092 5:79233570-79233592 CAGGCTGGAGCCACCGCGCCCGG + Intronic
992730626 5:79664317-79664339 CAGGCATGAGCCACCACGGCTGG - Intronic
992870137 5:80997690-80997712 CAGGCTTGAGCCACCACGCCCGG - Intronic
992955300 5:81901886-81901908 CAGGAGGGAGGCAGGAAGGCTGG + Intergenic
993246661 5:85460103-85460125 CAGTCTGGAGGCTCCACGGCTGG + Intergenic
993290951 5:86069332-86069354 CAGGCTTGAGCCACCACGCCTGG + Intergenic
993718000 5:91294628-91294650 CAGGCGCGAGTCAGCACGCCTGG - Intergenic
994357767 5:98813374-98813396 CAGGCTGGAGCCACCATGCCTGG - Intergenic
995195809 5:109366852-109366874 CAGGCATGAGCCAGCACGCCTGG - Intronic
995291606 5:110462593-110462615 CAGACTGAAGGCTGCACTGCTGG + Intronic
995450909 5:112299535-112299557 CAGGCGGGAGCCACCACGCCTGG - Intronic
995560192 5:113372899-113372921 CAGGCTTGAGCCACCACGCCCGG - Intronic
996208911 5:120780771-120780793 CAGGCTTGAGCCCGCCCGGCCGG - Intergenic
996715400 5:126583695-126583717 CAGGCTTGTGCCACCACGGCTGG - Intronic
996718927 5:126611329-126611351 CAGGCGTGAGGCACCACGCCCGG + Intronic
996824058 5:127661263-127661285 CAGGCGTGAGCCAGCACGCCCGG + Intergenic
997002768 5:129782253-129782275 CAGGCTGGGGGCAGCAGAGAAGG - Intergenic
997044845 5:130302600-130302622 CAGGCTTGAGCCACCACGCCCGG - Intergenic
997347704 5:133204071-133204093 CAGGGTGGGGACAGCAAGGCTGG + Intronic
997463311 5:134070421-134070443 CAGGCTTGAGCCACCACGCCTGG + Intergenic
997484863 5:134221690-134221712 CAGGCTTGAGCCAGCGCGCCTGG - Intronic
997550309 5:134746808-134746830 CAGGCGTGAGGCACCACGCCTGG - Intronic
997558414 5:134821830-134821852 CAGGCAGGAGCCACCACGCCCGG + Intronic
997561372 5:134848682-134848704 CAGGCGTGAGGCACCACGCCCGG - Intronic
997712510 5:136017629-136017651 CAGGCTGAAGGCATCAAGGAAGG + Intergenic
997726313 5:136122771-136122793 CAGGCTTGAGCCACCACGCCCGG + Intergenic
997938387 5:138134655-138134677 CAGGATTGAGCCACCACGGCCGG + Intronic
997949156 5:138228261-138228283 CAGGCGTGAGCCACCACGGCTGG + Intergenic
998040002 5:138945832-138945854 CAGGCTGGAGGCAGGAGTCCAGG - Intergenic
998192786 5:140041967-140041989 CAGGCCCGCGGCAGCAGGGCAGG + Intronic
998350206 5:141495337-141495359 GAGAGTGGAGGCAGCACAGCTGG + Intronic
998408825 5:141892240-141892262 CAGGCATGAGCCACCACGGCCGG + Intergenic
998420425 5:141980218-141980240 CAGGCAGCTGGCAGCACGGCCGG - Exonic
1000197575 5:158974264-158974286 CAGGCTTGAGGCAGAAAGTCTGG + Intronic
1000317858 5:160110427-160110449 CAGGCTTGAGCCACCACGTCCGG - Intronic
1001057177 5:168459399-168459421 CAGGCTGGAGCCAGGAGAGCTGG + Intronic
1001360137 5:171075673-171075695 CAGGCTTGAGCCACCACGCCTGG - Intronic
1001373533 5:171231224-171231246 CAGGCTTGAGCCACCACGCCTGG + Intronic
1001564927 5:172693797-172693819 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1001805507 5:174582395-174582417 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1001900736 5:175426786-175426808 CAGGCTTGAGCCACCACGCCAGG - Intergenic
1002073709 5:176695956-176695978 CAGGATGGGGCCAGCCCGGCAGG + Intergenic
1002342806 5:178527761-178527783 CAGGCTGCAGGGAGCCTGGCAGG - Intronic
1002494456 5:179602315-179602337 CAGGCCAGAGGGAGCAGGGCTGG + Intronic
1002499908 5:179641602-179641624 TAGGCTTGAGCCACCACGGCTGG - Exonic
1002502063 5:179653159-179653181 TAGGCTTGAGCCACCACGGCTGG + Intergenic
1002511772 5:179724872-179724894 CAGGCTTGAGCCACCACGCCTGG - Intronic
1002588723 5:180272134-180272156 CAGGATGGTGGCTGCATGGCAGG - Intronic
1003541316 6:7020617-7020639 CAGGCATGAGGCACCACGCCCGG - Intergenic
1003548244 6:7079196-7079218 CAGGCGTGAGGCACCACGCCCGG - Intergenic
1003678430 6:8228636-8228658 CAGGCGTGAGGCACCACGCCTGG + Intergenic
1003695868 6:8405884-8405906 CAGGCTGGAGGAGGGAAGGCAGG + Intergenic
1003789967 6:9534881-9534903 CAGGCGGGAGCCACCACGCCCGG + Intergenic
1003910631 6:10740648-10740670 CAGGCAGGAGCCACCACGCCTGG + Intergenic
1003957237 6:11175134-11175156 CAGGCGTGAGCCAGCACGCCTGG - Intergenic
1003981141 6:11391016-11391038 CAGGCTTGAGCCATCACGCCCGG + Intergenic
1004363676 6:14993915-14993937 CAGGCATGAGCCAGCACGCCTGG - Intergenic
1004500870 6:16208924-16208946 CAGGCATGAGCCAGCACGGGTGG - Intergenic
1004519000 6:16344642-16344664 CAGGCTGAAGGCTGCACTGTCGG + Intronic
1004706807 6:18132052-18132074 CAGGCATGAGCCAGCACGCCAGG + Intronic
1005293538 6:24401876-24401898 CAGGCATGAGGCACCACGCCCGG + Intergenic
1005319449 6:24638481-24638503 CAGGCTGGAGCCACCACGCCCGG - Intronic
1005723807 6:28629311-28629333 CAGGCAAGAGCCACCACGGCTGG - Intergenic
1005727410 6:28663394-28663416 CAGGCGTGAGGCACCACGCCCGG - Intergenic
1005927510 6:30455984-30456006 CAGGCGTGAGGCACCACGACCGG - Intergenic
1006071912 6:31504534-31504556 CAGGCTTGAGCCACCACGCCTGG + Intronic
1006123037 6:31819030-31819052 CAGGCATGAGCCAGCACGCCCGG - Intergenic
1006547138 6:34789597-34789619 CAGGCATGAGCCACCACGGCTGG + Intergenic
1006554803 6:34856849-34856871 CATGCTGGAGGCTGAAAGGCAGG - Exonic
1006577147 6:35054916-35054938 CAGGCTGAAAGCAGCCCAGCTGG + Intronic
1006594256 6:35181565-35181587 GAGGCTGGTGGCAGGAGGGCAGG - Intergenic
1006673224 6:35743026-35743048 CAGGTTGGAGTCAGCAAGTCTGG - Intronic
1006888912 6:37406527-37406549 CAGGCATGAGCCAGCACGCCTGG + Intergenic
1006979476 6:38135465-38135487 CAGGCGTGAGCCACCACGGCCGG - Intronic
1007443606 6:41886617-41886639 CAGGCGTGAGCCACCACGGCTGG - Intronic
1007685854 6:43667019-43667041 CAGGCGTGAGCCAGCACGCCCGG + Intronic
1008170174 6:48195378-48195400 CAGGCGTGAGCCACCACGGCCGG - Intergenic
1008583972 6:52932307-52932329 TAGGCTTGAGCCACCACGGCCGG + Intergenic
1008590110 6:52985773-52985795 CAGGCTTGAGCCACCACGCCTGG - Intronic
1009963898 6:70557414-70557436 CAGGCAGGAGCCACCACGCCCGG - Intronic
1010205868 6:73322282-73322304 CAGGCAGGAGCCACCACGCCTGG - Intergenic
1010238021 6:73591188-73591210 CAGGCGTGAGCCACCACGGCGGG + Intergenic
1010704670 6:79093671-79093693 CAGGCGTGAGCCAGCACGCCTGG - Intergenic
1010785373 6:79994027-79994049 GAGGCTGAAGCCAGCATGGCTGG - Intergenic
1011178790 6:84595575-84595597 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1011663541 6:89614365-89614387 CAGGCATGAGCCACCACGGCCGG - Intronic
1011677324 6:89747612-89747634 CAGGCTTGAGCCACCACGCCCGG - Intronic
1011687059 6:89831917-89831939 CAGGCTTGAGCCACCACGCCCGG + Intronic
1012836438 6:104275232-104275254 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1012881826 6:104800130-104800152 CAGGCTGCATGCAGCCTGGCAGG - Intronic
1012881830 6:104800135-104800157 CAGGCTGCATGCAGCCTGGCGGG + Intronic
1013144450 6:107374109-107374131 CAGGCGGGCGCCACCACGGCAGG - Intronic
1013227532 6:108131223-108131245 CAGGCGTGAGCCACCACGGCTGG - Intronic
1013315303 6:108936531-108936553 CAGGCGTGAGGCACCACGCCTGG + Intronic
1013496347 6:110701263-110701285 CAGGCTTGAGCCACCACGCCCGG - Intronic
1013558429 6:111281060-111281082 CAGGCGCGAGCCACCACGGCCGG - Intergenic
1013616633 6:111849566-111849588 CAGGCTGGAGGGAGAAAGGTGGG + Intronic
1014210655 6:118704746-118704768 CAGGCTTGAGCCACCACGCCTGG + Intronic
1014258177 6:119185163-119185185 CAGGCTTGAGCCACCACGCCTGG + Intronic
1014315329 6:119857265-119857287 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1014425971 6:121307095-121307117 CAGGCTTGAGCCACCACGCCTGG - Intronic
1014949586 6:127539102-127539124 GATGCTGGAGGAAGCAGGGCAGG - Intronic
1015082148 6:129240009-129240031 CAGACTGAAGGCTGCACCGCTGG - Intronic
1015339664 6:132084098-132084120 CAGGCATGAGCCAGCACGCCCGG + Intergenic
1015469648 6:133589475-133589497 CAGGCAGAAGCCACCACGGCCGG - Intergenic
1015522017 6:134141006-134141028 CAGGCTTGAGCCATCACGCCCGG - Intergenic
1015548031 6:134382378-134382400 CAGGCTGGATACAGCAGGTCTGG + Intergenic
1015557055 6:134474078-134474100 CAGGCTTGAGCCACCACGTCCGG - Intergenic
1015678428 6:135777621-135777643 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1015904280 6:138101093-138101115 CAGGCTTGAGCCACCGCGGCTGG - Intronic
1015928168 6:138330525-138330547 CAGGCATGAGCCAGCACGCCTGG - Intronic
1016047442 6:139495293-139495315 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1016051509 6:139535321-139535343 CAGGCGGGAGCCACCACGCCCGG - Intergenic
1016051800 6:139537666-139537688 CAGGCGTGAGCCACCACGGCTGG - Intergenic
1016833326 6:148453996-148454018 CAGCCTGAAGTCAGCAGGGCAGG + Intronic
1016857863 6:148689163-148689185 CAGGCTGAAGGCTGCACTGTCGG + Intergenic
1016968284 6:149739253-149739275 CAGGCTTGAGCCACCACGCCTGG + Intronic
1017043347 6:150325128-150325150 CAGGCTGGAGGCATCTGGGTGGG + Intergenic
1017180705 6:151549180-151549202 CAGGCGTGAGCCACCACGGCCGG + Intronic
1017405226 6:154112040-154112062 CAGGCTGGAGCCACCGCGCCTGG + Intronic
1017441349 6:154467005-154467027 CAGGCAGGAGGCAGCAAAGAGGG + Intronic
1017499461 6:155010111-155010133 CAGGCGTGAGCCACCACGGCTGG + Intronic
1017905217 6:158753357-158753379 CAGGCTTGAGCCACCACGCCAGG + Intronic
1018251665 6:161877743-161877765 CAGGCGGGAGCCACCACGCCCGG + Intronic
1018446982 6:163867114-163867136 CAGGTGGGAAGCAGCATGGCTGG - Intergenic
1018659585 6:166073744-166073766 CAGGCTTGAGGCACCGCGCCCGG + Intergenic
1018679433 6:166252394-166252416 CAGGCTGGAGCCACCGCGCCCGG + Intergenic
1018729694 6:166639454-166639476 CAGGCTGGTGGCAGGACCACAGG - Intronic
1018807405 6:167271961-167271983 CAGCCTGGAGACAGCACTGGAGG - Intronic
1019044688 6:169135326-169135348 CAGGCATGAGCCAGCACGCCCGG - Intergenic
1019392926 7:799639-799661 CAGGCATGAGCCACCACGGCTGG + Intergenic
1019488411 7:1299922-1299944 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1019525214 7:1477654-1477676 CAGCCTGGAGGCCGTGCGGCTGG - Exonic
1019648516 7:2143739-2143761 CTGCCTGGAGGCAGCAAGGTGGG + Intronic
1019720231 7:2565374-2565396 CAGGCTGGAGGCAGCACGGCTGG + Intronic
1019778235 7:2925030-2925052 CAGGCGTGAGGCACCGCGGCTGG + Intronic
1019785660 7:2975621-2975643 CAGGCGTGAGCCAGCACGCCTGG + Intronic
1019825025 7:3277053-3277075 CAGGCTTGAGCCACCAAGGCCGG + Intergenic
1019839961 7:3431176-3431198 CAGGCGTGAGGCACCACGCCTGG + Intronic
1020034943 7:4959100-4959122 CAGGTTGGAGGGCGCGCGGCGGG + Exonic
1020055262 7:5113528-5113550 CAGGCATGAGCCAGCACGCCCGG + Intergenic
1020184629 7:5949551-5949573 CAGGCTTGAGCCACCACGCCCGG - Intronic
1020187615 7:5970812-5970834 GACGCTGGAGGCAGCAGGCCAGG + Intergenic
1020214149 7:6176536-6176558 CAGGCATGAGGCACCACGCCTGG + Intronic
1020295302 7:6753958-6753980 GACGCTGGAGGCAGCAGGCCAGG - Intergenic
1020298287 7:6775193-6775215 CAGGCTTGAGCCACCACGCCCGG + Intronic
1020377815 7:7507953-7507975 CAGGCGTGAGCCAGCACGCCTGG - Intronic
1020652089 7:10888121-10888143 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1020756239 7:12207273-12207295 AAGGCTGGAGGCAGGGTGGCAGG - Intergenic
1021099227 7:16569751-16569773 CAGGCTTGAGCCACCACGCCTGG - Intronic
1021147365 7:17105943-17105965 CAGGATGGAGGCTGCACTGTTGG - Intergenic
1021454179 7:20811937-20811959 CAGGCAGGAGCCACCACGCCCGG - Intergenic
1021690155 7:23223280-23223302 CAGGAAGAAGGCAGCAGGGCCGG + Intergenic
1021699266 7:23301691-23301713 CAGGCTTGAGCCACCACGCCCGG - Intronic
1021712969 7:23435016-23435038 CAGGCAGGAGCCACCACGCCTGG - Intronic
1021878764 7:25073569-25073591 TTGGCTGGAGGCAGCCAGGCTGG + Intergenic
1021923213 7:25508152-25508174 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1021932038 7:25590889-25590911 CAGGCTTGAGCCATCACGCCTGG - Intergenic
1022293641 7:29028685-29028707 CAGGCTTGAGCCACCACGCCTGG - Intronic
1022714269 7:32884233-32884255 CAGGCATGAGCCAGCACAGCTGG - Intronic
1022723443 7:32960390-32960412 CAGGCGGGAGCCACCACGCCTGG + Intronic
1022944460 7:35268221-35268243 CAGGCTTGCGCCAGCACGCCCGG + Intergenic
1023210897 7:37804003-37804025 CAGTCTGGTGGCAGCAAGGGTGG - Intronic
1023489237 7:40720061-40720083 CAGGCGTGAGGCAGCACACCAGG + Intronic
1023553420 7:41393338-41393360 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1023820884 7:43979921-43979943 CAGGCATGAGGCAGCTCGCCCGG - Intergenic
1023858737 7:44203369-44203391 CAGGCTTGAGCCACCACGTCCGG + Intronic
1023950536 7:44840491-44840513 CAGGCTTGAGCCACCACGTCCGG - Intronic
1024025748 7:45408514-45408536 CAGGCTGCATGGAGCATGGCGGG - Intergenic
1024331568 7:48160460-48160482 CAGGCTGGAGGAACAAGGGCAGG + Intergenic
1024348185 7:48334610-48334632 CAGGCGTGAGCCAGCACGCCCGG + Intronic
1024875529 7:54018638-54018660 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1025228499 7:57183043-57183065 CAGGCAGGAGCCATCACGCCTGG + Intergenic
1025276849 7:57589526-57589548 CAGGCATGAGCCAGCACGCCTGG + Intergenic
1025745122 7:64235987-64236009 CAGGCGTGAGGCACCACGCCCGG - Intronic
1025855487 7:65273328-65273350 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1026270351 7:68831079-68831101 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1026277039 7:68889091-68889113 CAGGCTGGGCTCAGCAGGGCAGG - Intergenic
1026485581 7:70817472-70817494 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1026531902 7:71206826-71206848 CAGGCTTGAGCCACCACGCCCGG - Intronic
1026602161 7:71785830-71785852 CAGTGTGCAGGCAGCAGGGCAGG + Exonic
1026779339 7:73254150-73254172 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1027114015 7:75463968-75463990 CAGGCGTGAGGCACCACGCCTGG + Intronic
1027286265 7:76648572-76648594 CAGGCGTGAGGCACCACGCCTGG + Intergenic
1027312727 7:76964982-76965004 CAGGCGTGAGGCACCACGCCTGG + Intergenic
1027383323 7:77634852-77634874 CAGGCGGGAGCCACCACGCCCGG + Intronic
1027663015 7:81009787-81009809 CAGGCAGGAGCCACCACGCCCGG - Intergenic
1027686151 7:81280680-81280702 CAGACTGGAGGCTGCACTGTTGG + Intergenic
1027833819 7:83216070-83216092 CAGGCGTGAGGCATCACGCCTGG - Intergenic
1027950053 7:84803964-84803986 CAGGCTTGAGCCACCACGTCCGG + Intergenic
1028553987 7:92103111-92103133 CAGGCATGAGGCACCACGCCTGG - Intronic
1028604706 7:92643162-92643184 CAGGCTTGAGCCACCACGCCCGG + Intronic
1028888446 7:95960382-95960404 CAGGCTTGAGCCACCACGCCCGG + Intronic
1028953317 7:96661708-96661730 CAGGCATGAGGCACCACGCCCGG - Intronic
1029201932 7:98844910-98844932 CAGGGTGGTGGCAGCAGGGGAGG + Intergenic
1029228681 7:99048108-99048130 CAGGCTTGAGCCACCACGCCCGG - Intronic
1029258440 7:99285167-99285189 CAGCCAGGAGCCAGCATGGCTGG - Intergenic
1029366139 7:100117763-100117785 CAGGCGTGAGCCACCACGGCCGG - Intronic
1029433706 7:100549249-100549271 GAGGCTGAAGGCAGCAGAGCTGG - Intronic
1029453780 7:100656824-100656846 CAGGCAGGTGCCAGCACGCCTGG + Intergenic
1029553472 7:101251505-101251527 CAGGCGTGAGCCACCACGGCCGG - Intronic
1029612139 7:101632155-101632177 CAGACTGAAGGCAGCACTGTTGG - Intergenic
1029725544 7:102401454-102401476 CAGGCATGAGCCACCACGGCTGG - Intronic
1029749158 7:102533358-102533380 CAGGCGTGAGGCAGCTCGCCCGG - Intergenic
1029767101 7:102632462-102632484 CAGGCGTGAGGCAGCTCGCCCGG - Intronic
1030081522 7:105782651-105782673 CAGGCTGGATGGACCTCGGCAGG + Intronic
1030293283 7:107892823-107892845 CAGGCGTGAGCCACCACGGCCGG + Intronic
1031510413 7:122642000-122642022 CAGGTTTGAGCCACCACGGCCGG - Intronic
1031985542 7:128162493-128162515 CAGGCTGGAGAAAGCAGGCCGGG - Intergenic
1032066714 7:128776709-128776731 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1032081856 7:128863120-128863142 GAGGCTGGAGGCTGCCCGGACGG + Intronic
1032140051 7:129320587-129320609 CAGGCGGGAGCCACCACGTCTGG + Intronic
1032144451 7:129366502-129366524 CAGGCATGAGCCAGCACGCCTGG - Intronic
1032170073 7:129577381-129577403 CAGGCATGAGCCAGCACGCCTGG + Intergenic
1032387012 7:131532156-131532178 CAGGCTTGAGCCACCACGCCCGG - Intronic
1032496966 7:132369789-132369811 CAGGCAGGAGGCACCGCGCCCGG - Intronic
1032527490 7:132590494-132590516 CAGACTGGAGGCTGCACTGTCGG - Intronic
1032816946 7:135485345-135485367 CAGGCTTGAGCCACCACAGCTGG + Intronic
1032831664 7:135633239-135633261 CAGGCAGGAGCCACCACGCCTGG + Intronic
1033248139 7:139736004-139736026 AAGGCTGGAGTCAGCGTGGCAGG + Intronic
1033336707 7:140459967-140459989 CAGGCTTGAGCCACCACGACTGG - Intronic
1034153976 7:148939077-148939099 CAGGCTTGAGGCACCGCGCCCGG + Intergenic
1034344781 7:150379484-150379506 CCGGGCGGAGGCAGCACGGGAGG - Intronic
1034355520 7:150448198-150448220 CAGGCTGGAGACAGAAGGACCGG - Intergenic
1034445836 7:151113897-151113919 CAGGCTGGAGCCAGTACCGCAGG + Intronic
1034446045 7:151114877-151114899 CAGGGCGGCGGCAGCGCGGCCGG - Intronic
1034608124 7:152337011-152337033 CAGGCTTGAGCCACCACGCCAGG - Intronic
1034619807 7:152448149-152448171 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1034628378 7:152511763-152511785 CAGGCATGAGCCAGCACGCCTGG + Intergenic
1034936884 7:155205591-155205613 CTGGCTGGAGGCCGCGCAGCAGG + Intergenic
1034964418 7:155382628-155382650 CAGGCTGTGGGCAGGACCGCAGG + Intronic
1035153749 7:156895491-156895513 CAGGGTGGAGGCAGCAGAGGAGG + Intergenic
1035471896 7:159115724-159115746 GAGGCTGCAGGCAGCACGTCAGG - Intronic
1035657612 8:1322601-1322623 GAGGCAGGAGACAGCACGCCAGG - Intergenic
1035673244 8:1436218-1436240 CAGACTGAAGGCTGCACTGCCGG - Intergenic
1035678089 8:1468896-1468918 GAGGCTGGAGTGAGCACAGCAGG - Intergenic
1035690679 8:1557555-1557577 CAGGCTGGCGGCATGAAGGCAGG - Intronic
1035767468 8:2118817-2118839 AAGGCTGGAGGTGGCAGGGCTGG + Intronic
1036148412 8:6275699-6275721 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1036173581 8:6514464-6514486 CAGGCGTGAGCCAGCACGTCTGG + Intronic
1036470051 8:9044958-9044980 CAGGCTTGAGCCACCACGCCTGG - Intronic
1036871838 8:12439411-12439433 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1037154814 8:15686789-15686811 CAGGCTTGAGCCACCACGCCCGG - Intronic
1037804869 8:22053597-22053619 GAGGGAGGAGGCAGCAGGGCCGG + Intronic
1037828993 8:22177251-22177273 CAGGCTGTGGGCAGCGCTGCGGG - Intronic
1038014017 8:23498048-23498070 CAGTCTGGAGGCAGCAGGAGAGG + Intergenic
1038127195 8:24687767-24687789 CAGACTGAAGGCTGCACTGCTGG + Intergenic
1038409006 8:27343720-27343742 CAGGCATGAGCCAGCACGCCTGG - Intronic
1038790104 8:30660807-30660829 CAGGCATGAGCCACCACGGCCGG - Intergenic
1039010632 8:33089336-33089358 CAGGCGGGAGCCACCACGCCCGG + Intergenic
1039098281 8:33911386-33911408 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1039364252 8:36913876-36913898 CAGGCTTGAGCCACCACGCCTGG + Intronic
1039407949 8:37328763-37328785 CAGGAAGGAGCCAGCACGGTGGG - Intergenic
1039705882 8:40006936-40006958 CAGGCTTGAGCCACCACGTCTGG + Intronic
1039912217 8:41834522-41834544 CAGGCTGGAGACCACAGGGCAGG - Intronic
1040011706 8:42666557-42666579 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1040051557 8:43020434-43020456 CAGGCGTGAGGCACCACGTCTGG - Exonic
1040059748 8:43093805-43093827 CAGGCTGGAGCCACCTCGCCGGG - Intronic
1040506563 8:48054084-48054106 CAGGCTTGAGCCACCACGTCTGG + Intronic
1040969964 8:53125170-53125192 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1041481612 8:58327789-58327811 CAGGCATGAGCCACCACGGCCGG - Intergenic
1041543164 8:59009647-59009669 CAGGCTTGAGCCACCACGCCCGG + Intronic
1041661612 8:60406694-60406716 CAGGCTGGTGCCACCACGCCTGG + Intergenic
1041958150 8:63579883-63579905 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1042136364 8:65636497-65636519 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1042468900 8:69160851-69160873 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1043365026 8:79522396-79522418 CAGGCATGAGCCACCACGGCCGG + Intergenic
1043888589 8:85631131-85631153 CAGACTGGAGGCAGGAAGGAAGG - Intergenic
1044405122 8:91817917-91817939 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1044667714 8:94647930-94647952 CAGGCTGGTGTCAGCACTCCTGG - Intronic
1045315556 8:101040838-101040860 CAGTCTGGAGGCAGCACAGGTGG + Intergenic
1045424147 8:102046754-102046776 CAGGCTTGAGCCAGCATGCCTGG + Intronic
1045443175 8:102235561-102235583 CAGGCGTGAGGCACCACGCCGGG - Intronic
1045458210 8:102403129-102403151 CAGGCAGGAGACACCATGGCTGG - Intronic
1045673623 8:104585501-104585523 CAGGCTTGAGTCACCACGCCTGG + Intronic
1046460010 8:114520957-114520979 CAGGCAGGAGCCACCATGGCTGG + Intergenic
1047079644 8:121445512-121445534 CAGGCGTGAGGCACCACGCCAGG - Intergenic
1047272235 8:123373167-123373189 CAGGCTTGAGGCACCACGCCTGG + Intronic
1047476828 8:125240398-125240420 CAGGCTTGAGCCACCACGCCTGG + Intronic
1047486699 8:125337615-125337637 CAGGCTTGAGCCACCACGCCCGG - Intronic
1047498893 8:125427656-125427678 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1047959493 8:130000548-130000570 TAGGCTTGAGACACCACGGCTGG - Intronic
1048217294 8:132508083-132508105 CAGACTGAAGGCTGCACTGCTGG - Intergenic
1048334488 8:133492441-133492463 CAGGCTTGAGCCACCACGCCTGG - Intronic
1048791094 8:138104322-138104344 CAGGCTGGAGGCAATTGGGCGGG - Intergenic
1048873455 8:138817476-138817498 CAGGCAGTTGGCAGCACAGCTGG + Intronic
1048942807 8:139416827-139416849 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1049174450 8:141182968-141182990 CAGGACGGAGGCAGCACTGCAGG + Intronic
1049229783 8:141475964-141475986 CAGGCTGGACGCACCAGGGCTGG - Intergenic
1049329592 8:142043159-142043181 CAGGCTGGAGCCATCCCTGCAGG + Intergenic
1049553053 8:143269533-143269555 CAGGGTGGAGGGCGCACAGCGGG - Intronic
1049700323 8:144008221-144008243 CAGCATGGAGGCAGCACGTTGGG + Intronic
1049717314 8:144099096-144099118 CAGGCTGGAGGCAGCTGGCTGGG + Exonic
1049785183 8:144447258-144447280 CAGGCTGAGGGCAGCAGGGGAGG + Intergenic
1049859505 8:144889043-144889065 CAGGCTTGAGCCACCACGCCTGG + Intronic
1050468565 9:5960282-5960304 CAGGCGTGAGGCAGCACGCCCGG - Intronic
1051299678 9:15635235-15635257 CAGACTGAAGGCTGCACTGCTGG - Intronic
1052013077 9:23433871-23433893 CTGGCTGGAGGCAGGATCGCTGG + Intergenic
1052831396 9:33218831-33218853 CAGGCTTGAGCCACCACGCCTGG - Intronic
1052843423 9:33313309-33313331 CAGGCTTGAGCCACCACGCCCGG - Intronic
1052935675 9:34091046-34091068 CAGGCTTGAGCCACCACGCCTGG - Intronic
1052940567 9:34128814-34128836 CAGGCATGAGCCACCACGGCTGG + Intergenic
1053000631 9:34575472-34575494 CAGGAAGGAGGCTGCAAGGCAGG + Intronic
1053194169 9:36102676-36102698 CAGGCTTGAGTCACCACGCCTGG - Intronic
1053210662 9:36224589-36224611 CAGGCGTGAGCCACCACGGCCGG - Intronic
1053276975 9:36790513-36790535 CAGGCATGAGGCACCACGACCGG - Intergenic
1053327505 9:37168618-37168640 CAGGCATGAGCCAGCACGCCTGG - Intronic
1053350633 9:37411351-37411373 CAGGTTGGAGGAGGCAAGGCCGG + Intergenic
1053391697 9:37740732-37740754 CAGCCTGGGGTCAGCAGGGCTGG + Exonic
1053434020 9:38063406-38063428 ATGGCTGGGGGCAGCAGGGCAGG - Intronic
1053707025 9:40766713-40766735 CAGGCATGAGCCAGCACGCCTGG + Intergenic
1054416939 9:64887481-64887503 CAGGCATGAGCCAGCACGCCTGG + Intergenic
1054725657 9:68647475-68647497 CAGGCTTGAGCCAGCACACCTGG + Intergenic
1054827483 9:69587745-69587767 CAGGCTTGAGCCACCACGCCGGG - Intronic
1055109981 9:72550188-72550210 CAGGCAGGAGCCACCACGCCTGG - Intronic
1055147032 9:72948386-72948408 CAGGCTGGGGCCAGATCGGCTGG - Intronic
1055591406 9:77818720-77818742 CAGGCATGAGCCAGCATGGCTGG - Intronic
1055724409 9:79212088-79212110 CAGACTGGAGGCTGCACTGTTGG + Intergenic
1056134127 9:83614606-83614628 CAGGCATGAGCCAGCACGCCTGG - Intergenic
1056172896 9:84005388-84005410 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1056328715 9:85503949-85503971 CAGGCGTGAGCCAGCACGCCCGG + Intergenic
1056362882 9:85876336-85876358 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1056454484 9:86746730-86746752 CAGGCGGGAGACATCACGCCCGG - Intergenic
1056615141 9:88159365-88159387 CAGGCTTGAGGCACCACGCCCGG + Intergenic
1056691825 9:88814366-88814388 CAGGCATGAGCCAGCGCGGCTGG + Intergenic
1056940477 9:90951571-90951593 CAGGCGTGAGGCACCACGCCTGG + Intergenic
1057143714 9:92744562-92744584 CAGGCTTGAGCCACCACGCCTGG - Intronic
1057305149 9:93907936-93907958 CTGGCTGGAGGTTGCACAGCTGG - Intergenic
1057502169 9:95604492-95604514 CAGGCGGGAGCCACCACGCCCGG + Intergenic
1057587986 9:96346857-96346879 CAGGCAGGAGCCACCACGCCTGG - Intronic
1057724618 9:97559486-97559508 CAGGCTTGAGCCACCACGCCCGG - Intronic
1057945989 9:99329121-99329143 CAGGCATGAGCCACCACGGCTGG - Intergenic
1058073414 9:100625147-100625169 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1058440562 9:105002930-105002952 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1058502429 9:105634409-105634431 CAGGCGGGAGCCACCACGACCGG + Intronic
1058524062 9:105839628-105839650 CAGGCAGGAGCCAGCATGCCTGG + Intergenic
1058706544 9:107642223-107642245 CAGGCATGAGCCAGCACGCCTGG + Intergenic
1058765611 9:108180138-108180160 CAGACTGGACGCTGCACTGCTGG + Intergenic
1059144757 9:111889343-111889365 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1059148139 9:111920639-111920661 CAGGCTTGAGCCACCACGCCTGG + Intronic
1059239580 9:112792565-112792587 CAGGCTTGAGCCACCACGCCTGG + Intronic
1059614032 9:115929645-115929667 CAGGCTAGAGCCACCACGCCCGG + Intergenic
1060176792 9:121503200-121503222 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1060391471 9:123281150-123281172 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1060500749 9:124152322-124152344 CAGGCAGGAGGCACCACACCTGG - Intergenic
1060527932 9:124330983-124331005 CAGGCGGGAGCCACCACGCCTGG - Intronic
1060699922 9:125741764-125741786 CAGGCATGAGCCAGCACGCCTGG + Intergenic
1061026526 9:128053294-128053316 CAGGCAGGAGCCACCACGCCTGG - Intergenic
1061087948 9:128410091-128410113 CAGTCTGGAGGCAGCAGAGCTGG + Intergenic
1061292428 9:129658862-129658884 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1061320813 9:129828068-129828090 CAGGCAGGAGCCACCACGCCCGG + Exonic
1061334824 9:129925869-129925891 CAGGCTTGAGTCACCACAGCTGG + Intronic
1061359575 9:130132421-130132443 CAGGGTGGACACAGGACGGCAGG - Intronic
1061775791 9:132962937-132962959 CAGGCTGGTGCCACCACGCCTGG - Intronic
1061821169 9:133227883-133227905 CAGGTTGCAGGCTGCCCGGCCGG + Intergenic
1061836860 9:133335233-133335255 CAGGCATGAGGCCGCACGGCCGG + Intronic
1061873328 9:133532038-133532060 CAGGCTTGAGGCAGAGGGGCTGG - Intergenic
1061893621 9:133635629-133635651 CAGGCTGCAGGGTGCACTGCTGG - Intergenic
1061958691 9:133977101-133977123 CAGGCTTGGGGCAGGGCGGCTGG - Intronic
1062119838 9:134828244-134828266 CAGGCTGGGCCCAGCAGGGCAGG - Intronic
1062138757 9:134944036-134944058 CAGGGTGGAGGCAGAACGGCGGG - Intergenic
1062152584 9:135029516-135029538 GAGGCTGCTGGCAGCAGGGCAGG - Intergenic
1062179264 9:135182060-135182082 CAGACTGAAGGCTGCACTGCCGG + Intergenic
1062218662 9:135402853-135402875 GAGGCTGGAGGAGGCACGGAGGG - Intergenic
1062238087 9:135522193-135522215 CAGGTTGCAGGCTGCCCGGCCGG - Intronic
1062254184 9:135613411-135613433 CAGGCAGGAGGAAGGAGGGCAGG + Intergenic
1062267800 9:135695369-135695391 CAGGGTGCAGGCAGCAGAGCAGG - Intronic
1062304709 9:135898365-135898387 CAGGCGGGAGCCACCACGCCTGG - Intronic
1062325214 9:136009575-136009597 CTGGCTGGAGGCAGCCCAGGAGG + Exonic
1062354736 9:136156631-136156653 CGGGCGGGAGGCCGCACAGCCGG - Intergenic
1062409407 9:136415126-136415148 CAGGCGTGAGCCAGCACGCCTGG - Intronic
1062480202 9:136747593-136747615 GAGGCTGGAGGCTGGAGGGCTGG - Intronic
1062480229 9:136747686-136747708 GAGGCTGGAGGCTGGAGGGCTGG - Intronic
1062480243 9:136747731-136747753 GAGGCTGGAGGCTGCAGGGCTGG - Intronic
1062480271 9:136747821-136747843 AAGGCTAGAGGCTGCAAGGCTGG - Intronic
1062480303 9:136747942-136747964 CAGGCTGGAGGTTGGAAGGCTGG - Intronic
1062480333 9:136748070-136748092 GAGGCTGGAGGCTGCTGGGCTGG - Intronic
1062480590 9:136749106-136749128 GAGGCAGGAGGCAGCAGGGCCGG - Intergenic
1062659461 9:137621417-137621439 CAGGCATGAGCCACCACGGCTGG - Intronic
1203530804 Un_GL000213v1:140273-140295 CAGGCAGGGGGCACCACAGCAGG - Intergenic
1185509919 X:656297-656319 CAGGCATGAGCCAGCACAGCTGG - Intronic
1185608250 X:1379568-1379590 CAGGGTGGAGGAAGCAGGGCCGG + Intronic
1185654453 X:1672848-1672870 CAGGCGTGAGGCACCACGCCTGG + Intergenic
1186063585 X:5737964-5737986 TGGGTTGGAGGCAGCACGGCTGG - Intergenic
1186852388 X:13593190-13593212 CAGGCTGGAGCCACCATGCCTGG + Intronic
1187181140 X:16945379-16945401 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1187319514 X:18227212-18227234 CAGACTGAAGGCTGCACTGCTGG - Intergenic
1187412031 X:19059987-19060009 CAGGCTCGCGGCACCACGCCTGG - Intronic
1187462077 X:19496342-19496364 CAGGCTTGAGCCACCACGCCTGG + Intronic
1188354504 X:29174794-29174816 CAGGCGTGAGCCAGCACGCCAGG - Intronic
1188387160 X:29575376-29575398 CAGACTGAAGGCTGCACTGCTGG - Intronic
1188394326 X:29661929-29661951 CAGAATGGAGGCAGGAAGGCAGG - Intronic
1188512052 X:30946948-30946970 CAGGCTTGAGCCACCACGCCCGG - Intronic
1188560303 X:31460857-31460879 CAGGCGTGAGCCACCACGGCCGG + Intronic
1188736974 X:33728687-33728709 CAGGCTGGCGCCAACACGCCTGG - Intergenic
1189448394 X:41103069-41103091 CAGGCTTGAGCCACCACGCCCGG + Intronic
1189482347 X:41402241-41402263 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1189643829 X:43104616-43104638 CAGGCATGAGGCACCACGCCTGG + Intergenic
1189792311 X:44615778-44615800 CAGGCATGAGCCAGCACGCCTGG + Intergenic
1189797274 X:44657299-44657321 CAGGCTTGAGCCACCACGCCCGG - Intergenic
1189950289 X:46222982-46223004 CAGGCAGGAGCCACCACGTCTGG - Intergenic
1189965113 X:46364769-46364791 CAGGTGGGAGCCACCACGGCGGG - Intergenic
1190105182 X:47555539-47555561 CAGGCGTGAGCCAGCACGCCCGG - Intergenic
1190118217 X:47639382-47639404 CAGGCTGGAGGCAGGGTGTCAGG + Intronic
1190120042 X:47651653-47651675 CAGGCTGGAGGCAGGACTGCTGG + Intergenic
1190160273 X:48027108-48027130 CAGGCGTGAGCCAGCACGCCCGG - Intronic
1190444013 X:50504845-50504867 CAGGCAGAAAGCAGCACTGCTGG + Intergenic
1190689862 X:52904575-52904597 CAGGCAGGAGCCACCACGCCCGG + Intronic
1190696121 X:52951217-52951239 CAGGCAGGAGCCACCACGCCCGG - Intronic
1190841974 X:54153841-54153863 CAGGCTTGAGCCACCACGCCCGG + Intronic
1190867990 X:54400767-54400789 CAGGCAGGAGGCATCACACCTGG + Intergenic
1190870749 X:54422896-54422918 CAGGCGGGAGCCACCACGCCCGG - Intergenic
1191591105 X:62886345-62886367 CAGGCTTGAGCCACCACGCCTGG - Intergenic
1191686520 X:63898190-63898212 TAGGCTTGAGCCACCACGGCTGG - Intergenic
1191861655 X:65670445-65670467 CTGGCTGGAGCCACCACGCCCGG - Intronic
1192201459 X:69069080-69069102 CTGGAAGGAGGCAGCACGTCAGG - Intergenic
1192405562 X:70882501-70882523 CAGGCATGAGCCACCACGGCTGG - Intronic
1192872946 X:75202321-75202343 CAGGCATGAGCCAGCACGCCGGG - Intergenic
1193123953 X:77851649-77851671 CAGGTGTGAGGCAGCACGCCTGG + Intronic
1193440537 X:81535466-81535488 CAGCCTGGAGGCAGAAAGGGTGG + Intergenic
1193975258 X:88110569-88110591 CAGGCTTGAGCCACCACGCCAGG + Intergenic
1193978914 X:88157633-88157655 AAGGCTGAAGGCAGCATGGGTGG - Intergenic
1193999656 X:88412375-88412397 CAGGCATGAGTCAGCACGCCTGG - Intergenic
1194298057 X:92151467-92151489 CAGGCTTGAGCCACCACGCCCGG + Intronic
1194366490 X:93019717-93019739 CAGCTTGGAGGCAGCAGGGGTGG - Intergenic
1194694209 X:97025372-97025394 CAGGCTTGAGCCACCACGCCCGG - Intronic
1194875395 X:99180797-99180819 CAGGCAGGAGCCACCACGCCCGG + Intergenic
1195550229 X:106160624-106160646 CAGGCGTGAGCCACCACGGCTGG + Intergenic
1196214000 X:113028671-113028693 CAGGCATGAGGCACCACGCCTGG + Intergenic
1196735339 X:118976813-118976835 CGGGGAGGAGGCAGCAGGGCTGG + Intronic
1196803356 X:119563269-119563291 CAGGCATGAGCCACCACGGCCGG - Intronic
1196887326 X:120260669-120260691 CAGGCTGAACGCAGCACAGAAGG - Exonic
1197220573 X:123909306-123909328 CAGGCTTGAGCCACCACGCCCGG + Exonic
1197220912 X:123912921-123912943 CAGGCGTGAGCCACCACGGCCGG + Exonic
1197240327 X:124116385-124116407 CAGGCAGGAGCCACCACGCCTGG + Intronic
1197315872 X:124965354-124965376 CAGGCGTGAGGCACCACGCCCGG + Intergenic
1197903971 X:131403503-131403525 CAGGCGTGAGCCACCACGGCTGG + Intergenic
1197908413 X:131451805-131451827 CAGGGGTGAGGCACCACGGCTGG + Intergenic
1197981284 X:132219594-132219616 CAGTCTGGAGACAGCTAGGCAGG - Intergenic
1198100847 X:133420380-133420402 CAGGCTTGAGCCACCACGCCTGG + Intergenic
1198183224 X:134230367-134230389 CAGGCATGAGCCACCACGGCTGG - Intergenic
1198312629 X:135436646-135436668 CAGCCTGGAGGCGACGCGGCAGG + Intergenic
1198371828 X:135997041-135997063 CAGGCTTGAGCCACCACGCCTGG + Intronic
1198383727 X:136107691-136107713 CAGGCTGGAGCCACCACACCCGG - Intergenic
1198766287 X:140082626-140082648 CAGGCGTGAGCCACCACGGCCGG - Intergenic
1198769538 X:140114731-140114753 CAGGCGTGAGCCACCACGGCTGG + Intergenic
1198973341 X:142305695-142305717 CAGGCTTGAGCCACCACGCCCGG + Intergenic
1199110019 X:143921044-143921066 CAGGCGTGAGCCACCACGGCCGG - Intergenic
1199131114 X:144187361-144187383 CAGGCGGGAGCCACCACGCCCGG + Intergenic
1199342251 X:146694502-146694524 CAGGCGTGAGGCACCACGCCTGG + Intergenic
1199902784 X:152193719-152193741 CAGGCGGGAGCCACCACGCCCGG - Intronic
1200134589 X:153868724-153868746 CAGCCTGGAGGGAGCAGGGCGGG + Exonic
1200615666 Y:5376438-5376460 CAGGCTTGAGCCACCACGCCCGG + Intronic
1200674718 Y:6135978-6136000 CAGCTTGGAGGCAGCAGGGGTGG - Intergenic
1201603961 Y:15764529-15764551 CAGGCTTGAGCCAGCATGCCCGG + Intergenic
1201786126 Y:17781275-17781297 CAGGCTGGAGCCACCGCGCCCGG + Intergenic
1201815427 Y:18124713-18124735 CAGGCTGGAGCCACCGCGCCCGG - Intergenic