ID: 1019721231

View in Genome Browser
Species Human (GRCh38)
Location 7:2572838-2572860
Sequence ACGTGGATAAAGAGAGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 283}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019721231_1019721241 18 Left 1019721231 7:2572838-2572860 CCGGCCTCTCTCTTTATCCACGT 0: 1
1: 0
2: 1
3: 27
4: 283
Right 1019721241 7:2572879-2572901 TTAAGGAAGAACAGCCTCCAGGG 0: 1
1: 0
2: 1
3: 17
4: 200
1019721231_1019721234 1 Left 1019721231 7:2572838-2572860 CCGGCCTCTCTCTTTATCCACGT 0: 1
1: 0
2: 1
3: 27
4: 283
Right 1019721234 7:2572862-2572884 TTTCCCACCTATCCTCCTTAAGG 0: 1
1: 0
2: 0
3: 16
4: 175
1019721231_1019721240 17 Left 1019721231 7:2572838-2572860 CCGGCCTCTCTCTTTATCCACGT 0: 1
1: 0
2: 1
3: 27
4: 283
Right 1019721240 7:2572878-2572900 CTTAAGGAAGAACAGCCTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019721231 Original CRISPR ACGTGGATAAAGAGAGAGGC CGG (reversed) Intronic
900580285 1:3405378-3405400 ACGTGGCAAGAGAGACAGGCAGG + Intronic
900909448 1:5584611-5584633 AAGAGGAGGAAGAGAGAGGCGGG + Intergenic
902112700 1:14096242-14096264 AAGTGGATTCAGAGAGAGGCAGG + Intergenic
902770712 1:18643928-18643950 ACGTGGAGAGAGGGAGAGGCCGG + Intronic
904078870 1:27859302-27859324 ACGTTGAGAAAGAGAAAAGCAGG + Intergenic
905923368 1:41733466-41733488 TCTTGGATATAGGGAGAGGCTGG - Intronic
905939741 1:41853671-41853693 ACGTGTAGAAAGGGAGAGGAAGG + Intronic
905949827 1:41940813-41940835 GAGAGGATAAAGAGAGAAGCTGG + Intronic
906126526 1:43430458-43430480 ACATGGTCAATGAGAGAGGCTGG - Intronic
906620098 1:47269633-47269655 ACTTGGATACAGAAAGTGGCTGG + Exonic
906684874 1:47756783-47756805 GGGTGGAAACAGAGAGAGGCAGG - Intergenic
906784501 1:48602865-48602887 AAGTGAAGAAAGAGAGAGGTGGG - Intronic
907640192 1:56181274-56181296 CTGTGCACAAAGAGAGAGGCAGG + Intergenic
907743048 1:57185484-57185506 AGGGAGAAAAAGAGAGAGGCAGG + Intronic
909283015 1:73781082-73781104 ACCTGGATAAAAAGAGATGATGG - Intergenic
909883118 1:80905187-80905209 CAGTGGATAAAGAGAGTGGAAGG + Intergenic
912649172 1:111423080-111423102 AACTGGACAAACAGAGAGGCGGG + Intronic
913229444 1:116729691-116729713 TCCAGGATAAACAGAGAGGCAGG - Intergenic
915601403 1:156924989-156925011 GCGTGGATGAACAGAGAGGCAGG - Exonic
918182564 1:182096995-182097017 ACATGGATAAAGAGAGGAGTAGG + Intergenic
918306659 1:183252557-183252579 AGATGGAGAAACAGAGAGGCAGG + Exonic
920235047 1:204497257-204497279 ACCTGAATCAAGAGAGAGGGAGG - Intergenic
921350692 1:214231361-214231383 ATGTGCAAAAAAAGAGAGGCTGG - Intergenic
922203251 1:223424779-223424801 ATGTAGCTCAAGAGAGAGGCTGG - Intergenic
922653820 1:227363705-227363727 AAGTGGAAAAAGAATGAGGCCGG + Intergenic
923854816 1:237834897-237834919 TCTGGGAGAAAGAGAGAGGCTGG + Intergenic
923916487 1:238511652-238511674 AGCTGGCTAAAGACAGAGGCTGG - Intergenic
923924077 1:238603402-238603424 AGGTGGATAGACAGACAGGCAGG - Intergenic
924589031 1:245385907-245385929 ATGTGGGAAAAGAGAGAGGATGG + Intronic
924613270 1:245591028-245591050 ACGTGGTTAAAGGGAGATCCAGG + Intronic
1063021031 10:2127716-2127738 AAGTGGACAATGACAGAGGCTGG + Intergenic
1066546014 10:36501531-36501553 ATGAGGACAAAGAGTGAGGCTGG - Intergenic
1067167589 10:43878024-43878046 AAGGGGAGAAAGGGAGAGGCAGG - Intergenic
1067183354 10:44006819-44006841 GCTGGGAGAAAGAGAGAGGCTGG - Intergenic
1068247095 10:54387427-54387449 ACATGGATCAACAGTGAGGCTGG + Intronic
1069940950 10:71954901-71954923 ACTGGGTTAAAGAGAGAGGCGGG + Intergenic
1074745813 10:116531196-116531218 ACATGGATACAGAGAGAGGTAGG + Intergenic
1075345166 10:121676545-121676567 AAGTGGCTAAAGGCAGAGGCAGG + Intergenic
1075470709 10:122687378-122687400 AGCTGGAGCAAGAGAGAGGCAGG + Intergenic
1075908031 10:126099393-126099415 AGGTGGATAGAGAGGGAGGGAGG - Intronic
1076194597 10:128508112-128508134 AGGAGGAAAGAGAGAGAGGCTGG + Intergenic
1076425087 10:130361982-130362004 AGGAGGAGAAAGAGAGAGGGAGG + Intergenic
1076856503 10:133117899-133117921 ACGTGGGCAAAGGGAGGGGCAGG - Intronic
1077662567 11:4082729-4082751 AAGAGGAAAAAGAGAAAGGCAGG - Intronic
1079539028 11:21549917-21549939 GAGTGGAAAAAGAGTGAGGCAGG + Intronic
1081574406 11:44310209-44310231 AGGGGGAGAGAGAGAGAGGCCGG - Intergenic
1081841515 11:46204984-46205006 ACTTGGAGAAAGAGAGAAGAGGG + Intergenic
1083475500 11:62912602-62912624 GCCTGGGTAAAGAGAAAGGCCGG + Intronic
1089088465 11:115844925-115844947 AAGTGGAAAAAGAGAGATGCTGG + Intergenic
1089113122 11:116072572-116072594 AGGAGGAGGAAGAGAGAGGCCGG + Intergenic
1090733135 11:129589006-129589028 AAGTGTATAAAGAGAGGTGCAGG - Intergenic
1090859595 11:130640964-130640986 AGTTGGAGAAAGAGAGAGGGAGG - Intergenic
1092464084 12:8712604-8712626 AGGTGGGTCAAGAGAGAGGTAGG + Intronic
1093096088 12:14973747-14973769 TGGTGGACAAAGAAAGAGGCAGG - Intronic
1095099023 12:38162484-38162506 ACAGCGATAAAGAGAGAGACAGG + Intergenic
1097614504 12:61867646-61867668 AAGTGGATGAAGACTGAGGCAGG - Intronic
1099296019 12:80828884-80828906 ACGTGGAGAGAGAGAGGGGCTGG + Intronic
1101786321 12:107886704-107886726 ATGTGGATAAAGTGGGAGGGAGG + Intergenic
1102497767 12:113331156-113331178 ACTGGGAGAAAGAGAGAGGGTGG + Intronic
1104291578 12:127473945-127473967 ACGGGGCTAAACAGAGAGGCAGG + Intergenic
1104400670 12:128473431-128473453 GTGAGGATAAAGATAGAGGCTGG - Intronic
1107527291 13:41245880-41245902 ACAGGGATAAAGAGGGAGGAAGG - Intronic
1108108728 13:47043953-47043975 ACAGGAATAAAGAGATAGGCAGG - Intergenic
1108139031 13:47398792-47398814 TCGTGGACAAAGAGAAAGGTGGG - Intergenic
1108889682 13:55239656-55239678 AAGTGGAGAAAAAGAGAGGGAGG + Intergenic
1110639263 13:77803063-77803085 ATATGGATAAAGAAACAGGCAGG + Intergenic
1111579661 13:90206922-90206944 AAATGGTTAAAGAGGGAGGCTGG + Intergenic
1112851691 13:103713930-103713952 ACGTTGAAAAAGAGAGAAGCTGG + Intergenic
1114437981 14:22723880-22723902 AAGTGGATAGAGGGAGAAGCTGG - Intergenic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1114536609 14:23427002-23427024 ACAGGGATAAGGAGAGAGGGTGG + Intronic
1117063221 14:51983612-51983634 ACCTGGGTAAAGAGCGAGGGTGG - Intergenic
1122447902 14:101782223-101782245 AGGGGGAGAAAGAGAGAGGGAGG - Intronic
1122448021 14:101782541-101782563 AAGGGGAGAAAGAGAGAGGGAGG - Intronic
1122672331 14:103382256-103382278 AAGGGGAAAAAGAGAGAGGAAGG + Intergenic
1123578443 15:21695403-21695425 AGGGGGATGAAGGGAGAGGCGGG + Intergenic
1123615068 15:22137885-22137907 AGGGGGATGAAGGGAGAGGCGGG + Intergenic
1124008784 15:25817377-25817399 ACATTGTTAGAGAGAGAGGCTGG - Intronic
1124409267 15:29422464-29422486 ACTTGAATAAAGAGAACGGCAGG + Intronic
1125180412 15:36876941-36876963 ACCTGGATAAATAAAGAAGCAGG + Intergenic
1125294512 15:38187869-38187891 ATGAGGCTAAAAAGAGAGGCTGG + Intergenic
1125379704 15:39074864-39074886 AGGTGGATAAAGATACAGGAGGG + Intergenic
1125614203 15:40995240-40995262 ACTTGAATAAAGGGAGGGGCTGG + Intronic
1126610163 15:50520831-50520853 GGGAGGATAAAGAGAGAGGCTGG + Intronic
1128932599 15:71718723-71718745 GCATGGACAAAGACAGAGGCAGG - Intronic
1129632507 15:77276634-77276656 TCGTGGATAATGAGGAAGGCAGG + Intronic
1130899274 15:88194827-88194849 AAGTGAATAAAGAGAGAGGGAGG - Intronic
1131046003 15:89316064-89316086 AAGTGGGTAAAGAGAGTGGATGG - Intronic
1131881848 15:96870576-96870598 TGGTAGATCAAGAGAGAGGCAGG - Intergenic
1132107597 15:99074516-99074538 ACGTTGATAACGAGAATGGCTGG - Intergenic
1132302766 15:100786805-100786827 ATGTGGATATGGAGAGAGGGCGG + Intergenic
1202987313 15_KI270727v1_random:429648-429670 AGGGGGATGAAGGGAGAGGCGGG + Intergenic
1133664864 16:7956719-7956741 ATGTGGATACAAAGAGAGGATGG + Intergenic
1134843455 16:17420475-17420497 AGGTGAATAAAGGGAGACGCAGG + Intronic
1134871667 16:17657508-17657530 ACGTGGATGAAGAGAGAAGCTGG + Intergenic
1135471860 16:22738180-22738202 CTGTGGATACAGAGAGGGGCTGG + Intergenic
1135546248 16:23368852-23368874 ACGTGGATATAGAGTGTGGAAGG + Intronic
1136403340 16:30030161-30030183 ACGGGGAAGAAGAGAGAGGCGGG + Intronic
1136705861 16:32187870-32187892 ACTTAGAGATAGAGAGAGGCAGG + Intergenic
1136762052 16:32741536-32741558 ACTTAGAGATAGAGAGAGGCAGG - Intergenic
1136806046 16:33128850-33128872 ACTTAGAGATAGAGAGAGGCAGG + Intergenic
1137694214 16:50450294-50450316 AAGTTGAAAAACAGAGAGGCAGG - Intergenic
1138403571 16:56769357-56769379 ACGTTGATTGAGGGAGAGGCTGG + Intronic
1138500677 16:57441663-57441685 ACATGGATAAAGTGAGAGCTGGG + Intronic
1139102945 16:63790076-63790098 AGAGGGATAAAGAGAGAGGTTGG + Intergenic
1139552931 16:67685717-67685739 GAGTTGGTAAAGAGAGAGGCTGG - Exonic
1140039075 16:71393525-71393547 ACTTGGATAAGGAGATAAGCAGG - Intergenic
1140288454 16:73627247-73627269 ACTTGGGGACAGAGAGAGGCAGG + Intergenic
1141817918 16:86425476-86425498 ACATGGACAAAGCCAGAGGCAGG + Intergenic
1142328129 16:89431691-89431713 ACGTCGTTAAAGCCAGAGGCAGG - Intronic
1203064209 16_KI270728v1_random:1001852-1001874 ACTTAGAGATAGAGAGAGGCAGG - Intergenic
1143760048 17:9095458-9095480 ACATGGACAAAGTGAAAGGCTGG - Intronic
1144364408 17:14528474-14528496 ACCTGAATAAATAGAGAGACGGG - Intergenic
1145725458 17:27117216-27117238 ACATGGATCAAGAGTGAGGCTGG - Intergenic
1146619468 17:34386345-34386367 ACGAGGATAAAGTGAGAGAAAGG - Intergenic
1148033406 17:44638957-44638979 ATATATATAAAGAGAGAGGCTGG + Intergenic
1148789275 17:50164324-50164346 AGGTGGAGAGAGAGAGAGGAAGG + Intronic
1149045300 17:52238128-52238150 ACCAGGATAAAGAGAGTGTCTGG + Intergenic
1150366310 17:64589088-64589110 CCATTAATAAAGAGAGAGGCAGG - Intronic
1151244214 17:72781961-72781983 ATGTATATATAGAGAGAGGCAGG - Intronic
1151290715 17:73147978-73148000 ACGGGGAGAGAGAGAGAGACGGG - Intergenic
1151290718 17:73147996-73148018 ACGGGGAGAGAGAGAGAGACGGG - Intergenic
1151290721 17:73148014-73148036 ACGGGGAGAGAGAGAGAGACGGG - Intergenic
1151290724 17:73148032-73148054 ACGGGGAGAGAGAGAGAGACGGG - Intergenic
1151290727 17:73148050-73148072 ACGGGGAGAGAGAGAGAGACGGG - Intergenic
1151290741 17:73148103-73148125 ACGGGGAGAGAGAGAGAGACGGG - Intergenic
1151290747 17:73148137-73148159 ACGGGGAGAGAGAGAGAGACGGG - Intergenic
1151290760 17:73148191-73148213 ACGGGGAGAGAGAGAGAGACGGG - Intergenic
1151290766 17:73148225-73148247 ACGGGGAGAGAGAGAGAGACGGG - Intergenic
1151290781 17:73148296-73148318 ACGGGGAGAGAGAGAGAGACGGG - Intergenic
1151368546 17:73632370-73632392 ACGGGGAGAAAGATGGAGGCTGG - Intronic
1153055294 18:939769-939791 AAGGGGAGAAAAAGAGAGGCAGG + Intergenic
1153375159 18:4368846-4368868 ATGTAGATAAAAAGAGATGCTGG + Intronic
1153498419 18:5722895-5722917 AGGTGGATAAATGGAGATGCAGG - Intergenic
1154130735 18:11734952-11734974 TCCTAGATAAAGAGAAAGGCTGG + Intronic
1155216391 18:23647049-23647071 AAGTGGATGATGAGAGAGACAGG + Intronic
1157854016 18:51087371-51087393 ACCTGGAAAAAGAGCGAGGCTGG + Intergenic
1159964643 18:74583456-74583478 ACAAGGAAAAAGAGAGAGGAAGG + Intronic
1160286206 18:77546180-77546202 AAGTGGAAAAATGGAGAGGCTGG - Intergenic
1161664244 19:5565267-5565289 AGGTGGTTAAACAGAGAGTCAGG - Intergenic
1163207355 19:15813449-15813471 ATGGGGATAGAGAGAGAGGCAGG + Intergenic
1163278000 19:16297638-16297660 ACGAGGAGAAAGGGAGAGACAGG + Intergenic
1163400322 19:17088218-17088240 ACGTGAATAAAGATGGAGGTGGG - Intronic
1163761729 19:19140682-19140704 ACGAGGAAAAAAAAAGAGGCTGG + Intergenic
1167211629 19:48137270-48137292 TCCTGGATAAAGGGAGAGGGAGG - Intronic
925188727 2:1866564-1866586 AAGGGGAGAGAGAGAGAGGCAGG + Intronic
927087251 2:19684669-19684691 ACGTGGATAAAGACAGAGAGAGG - Intergenic
927737035 2:25533622-25533644 AAGTAGAAAGAGAGAGAGGCAGG - Intronic
928807460 2:35176952-35176974 AGGTGATTAAAGAGACAGGCAGG + Intergenic
930216150 2:48699406-48699428 AAGTGGAGGAAGAGAGAGGGTGG - Intronic
930834951 2:55783305-55783327 ACTAGTATAAAGAGAGGGGCAGG - Intergenic
931071835 2:58660289-58660311 CCGTGGACAAAGAGAGGGCCTGG - Intergenic
931192612 2:60020172-60020194 AGGTGCAGAAAGAGAGAGGCTGG - Intergenic
932018885 2:68062685-68062707 ACGAAGAAAAAGAGAGAGACCGG + Intronic
935788536 2:106570519-106570541 GCGTGGCTAGAGAGAGAGGCAGG + Intergenic
936093874 2:109517290-109517312 CCGGGGATAAAGAGGGGGGCTGG - Intergenic
936392373 2:112087159-112087181 AGGTTGACAAAGAGAAAGGCAGG - Intronic
937140042 2:119592132-119592154 AAGAGGAGAAAGAGGGAGGCTGG + Intronic
937851583 2:126640831-126640853 ACGTGGGTAGAGAGAGAGAGAGG - Intergenic
937876141 2:126826900-126826922 TCTGGGATAAAGAGAGAGGCTGG - Intergenic
938120113 2:128627126-128627148 TCGTGGATAAACAGGGATGCAGG + Intergenic
938782160 2:134594247-134594269 AGGGGGAGAAAGAGAGAAGCGGG + Intronic
943521527 2:188957296-188957318 ACGTGGGTGAAGAAAGAGGGAGG - Intergenic
943722943 2:191223687-191223709 CCATGGAAAAAGAGAGAGGGAGG + Intergenic
1170324502 20:15141540-15141562 ACTTGGAATCAGAGAGAGGCAGG - Intronic
1172943146 20:38668239-38668261 ACTTAGACAAGGAGAGAGGCGGG + Intergenic
1173364163 20:42370019-42370041 ACCTGGACACAGAGAGAGGAGGG - Intronic
1173398367 20:42702040-42702062 AAGTGGGTAAACAGAGAGGGAGG - Intronic
1175037113 20:56010173-56010195 ACGGGGAGAGAGAGAGAGACTGG - Intergenic
1175961590 20:62639932-62639954 ATGTCCATAAAGAGAGAGGGAGG + Intergenic
1178307590 21:31503416-31503438 AAGAGGAGAAAGAGAGAGGAAGG + Intronic
1178519436 21:33275788-33275810 CCGAGGAGAAGGAGAGAGGCAGG + Intronic
1179304977 21:40145432-40145454 ATGTGGGGCAAGAGAGAGGCTGG + Intronic
1179836001 21:44034028-44034050 ACGTGCATAAAGACAGAGAAAGG + Intronic
1180969009 22:19805292-19805314 ACGTGGAGAGAGAGAAAAGCTGG + Intronic
1181837152 22:25620186-25620208 AGGTGTATATATAGAGAGGCTGG + Intronic
1182794390 22:32980225-32980247 ACCTAGAAAATGAGAGAGGCAGG + Intronic
1184027150 22:41866252-41866274 ATCAGGAAAAAGAGAGAGGCTGG + Intronic
1185146015 22:49137097-49137119 ACTTGGTTACTGAGAGAGGCTGG + Intergenic
950454057 3:13082323-13082345 TCGGGGATAAAAAGAGAGTCAGG - Intergenic
951420517 3:22478944-22478966 AGCTGGGTAAAGAGAGAGGCAGG - Intergenic
953447818 3:42982732-42982754 GCTTGGATAGAGAAAGAGGCCGG - Intronic
955661045 3:61299458-61299480 AAGAAGAGAAAGAGAGAGGCTGG - Intergenic
959783464 3:110264906-110264928 AAGTGGAGAGAGAGAGAGGGAGG - Intergenic
960484804 3:118238923-118238945 ACGTGAATAAAGAAAAAGGATGG + Intergenic
962062554 3:131945607-131945629 ACTTGTACAAAGAGAGAGGAAGG - Intronic
962659085 3:137582687-137582709 AAGCGGATTAGGAGAGAGGCAGG - Intergenic
967367057 3:188699244-188699266 ACGTGGAGACGGAGAGAGGTGGG + Intronic
969936992 4:10692019-10692041 ACATTTAAAAAGAGAGAGGCAGG - Intergenic
970831273 4:20343193-20343215 TGGGGGATGAAGAGAGAGGCTGG - Intronic
971725314 4:30304191-30304213 AGCAGGAGAAAGAGAGAGGCGGG + Intergenic
972831326 4:42817012-42817034 AAGTGAATAAAGAGGGAGGCAGG + Intergenic
974020311 4:56687177-56687199 ACTTGGATACAGAGAGGGGAAGG + Intergenic
974020434 4:56687951-56687973 AGGTGGATAGAGAGGGAGGGAGG + Intergenic
974296282 4:60003237-60003259 ACGTGTATTATTAGAGAGGCTGG + Intergenic
975738005 4:77400498-77400520 GAGGGGATAAAGAGTGAGGCAGG + Intronic
976327039 4:83783483-83783505 ACAAGGAGAAAGAGAGAGACAGG + Intergenic
977160594 4:93629408-93629430 ATGTGTATAAAGAGAGGAGCTGG - Intronic
977912003 4:102548132-102548154 ATGTGGAGAAAGAGAGAGAAAGG + Intronic
978102136 4:104854517-104854539 ACCTGTGGAAAGAGAGAGGCAGG - Intergenic
978214059 4:106176303-106176325 ATGGGGATGAAGAGAGAGGTTGG - Intronic
978388845 4:108203536-108203558 AGGTGCATAGTGAGAGAGGCTGG + Intergenic
979272157 4:118775548-118775570 AGGGAGATAAAGAGAAAGGCTGG + Intronic
981041940 4:140231315-140231337 ACGTGGACAAAGAGTGAGTATGG - Intergenic
982461205 4:155670952-155670974 AAGGGGATAAATAGATAGGCTGG - Intronic
982612111 4:157588438-157588460 ACAGGGAGCAAGAGAGAGGCAGG + Intergenic
983105237 4:163678796-163678818 ATGTGGATAAACAGTGAGGCAGG - Intronic
983398869 4:167237378-167237400 AGGTGGGTAAAGTGAGACGCTGG + Intergenic
986142167 5:5041081-5041103 ACATGAATCAAGAGAGAGGAAGG + Intergenic
986243732 5:5985515-5985537 ACCTGGAACCAGAGAGAGGCAGG - Intergenic
986438796 5:7760138-7760160 ACCTGGACAGAGAGAGAGGCAGG + Intronic
987017413 5:13834944-13834966 ACGAGGACAACGACAGAGGCAGG + Intronic
987478738 5:18426649-18426671 ACGTTGATAGTGAGAAAGGCTGG + Intergenic
987593599 5:19965758-19965780 GCGGGTAGAAAGAGAGAGGCAGG + Intronic
988526005 5:31987966-31987988 ATGGGAGTAAAGAGAGAGGCAGG - Intronic
989559995 5:42839367-42839389 ATGTGAATAAAGAGAGAAGATGG + Intronic
990050483 5:51494136-51494158 ACGTGGATGGAGAGATAGACAGG - Intergenic
990389861 5:55307789-55307811 CAGTGGATAAAGAGCGAGGGCGG - Exonic
991216880 5:64165942-64165964 ACGTGGATACAGGTAAAGGCCGG + Exonic
992245778 5:74820861-74820883 ATATGGATTAGGAGAGAGGCAGG - Intronic
994925218 5:106108570-106108592 CAGTGGATACAGAGAGATGCAGG - Intergenic
997999766 5:138615694-138615716 AGGAGGATAGAGAGGGAGGCTGG + Intronic
998080574 5:139272000-139272022 TGGAGGATAAAGAGAAAGGCAGG + Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998908183 5:146929140-146929162 ATGTGGAAGAAGAGAGAGGTAGG - Intronic
999626695 5:153528785-153528807 ACGTGGAGGAAGAGAGAAGAAGG - Intronic
999656759 5:153818144-153818166 ACGTGGCTCAAGAGAGAGCAGGG + Intergenic
1000128649 5:158273291-158273313 TAGGGGATAAAGACAGAGGCTGG - Intergenic
1000972937 5:167734859-167734881 GCGTGGAGAAAGAGAGATGAAGG - Intronic
1001438558 5:171720103-171720125 AGGTGGAGAAAGTGAGAGTCTGG - Intergenic
1001554437 5:172626351-172626373 AAGAGGAGAAGGAGAGAGGCCGG - Intergenic
1004503515 6:16229340-16229362 ATCTGGAAAAAGAGGGAGGCAGG - Intergenic
1007560599 6:42805247-42805269 ACCTGGACAAAGACAGATGCTGG + Intronic
1007982432 6:46172416-46172438 ATGGGGATTAAGAGGGAGGCTGG + Intergenic
1010396726 6:75401313-75401335 ACATGGTTAAAGAGAAAGGAAGG - Intronic
1010806670 6:80245410-80245432 AAGTAGACAAAGTGAGAGGCTGG + Intronic
1011217905 6:85024752-85024774 ACTTGGATAAAGTGGGAGGTGGG + Intergenic
1011492695 6:87908705-87908727 ACGTGGATAATTCTAGAGGCGGG - Intergenic
1012505496 6:99941628-99941650 ATGTGGCAAAAGAGAGAGACAGG - Intronic
1015896886 6:138026228-138026250 TGGTGGCCAAAGAGAGAGGCTGG - Intergenic
1016055130 6:139570817-139570839 ACCTGAATAAAGCCAGAGGCTGG - Intergenic
1019721231 7:2572838-2572860 ACGTGGATAAAGAGAGAGGCCGG - Intronic
1019799010 7:3074006-3074028 AGGAGGAGAAGGAGAGAGGCTGG - Intergenic
1019951708 7:4378426-4378448 ACGTGGAGTGAGAGAGATGCTGG - Intergenic
1021199863 7:17716682-17716704 ATGTGGAGAAAGAGAGACACAGG - Intergenic
1023202384 7:37712520-37712542 ACCTGGAGAAACAGAGGGGCAGG - Intronic
1023753050 7:43390112-43390134 ACGAGGAAAAAGAGAGGGGTTGG - Intronic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1024215298 7:47243392-47243414 ACAAGGAGAAAGAGAGAGGAGGG - Intergenic
1024269919 7:47634665-47634687 AGGGGGAGAAAGAGAGAGGGCGG + Intergenic
1024568594 7:50705377-50705399 AAGGGGAAAAAGAGAGAAGCTGG - Intronic
1024751443 7:52470272-52470294 ACGGGGAGAGAGAGAGAGGCAGG + Intergenic
1025073700 7:55924393-55924415 AGGGAGATACAGAGAGAGGCTGG - Intronic
1026176488 7:68002183-68002205 ACTTGAATGAAGAGAAAGGCTGG - Intergenic
1026760932 7:73125181-73125203 GCGTGGATGGAGAGAGAGGAGGG - Intergenic
1026893329 7:73995973-73995995 AAGTGCATAATGAGAGTGGCAGG + Intergenic
1027037274 7:74933977-74933999 GCGTGGATGGAGAGAGAGGAGGG - Intergenic
1027086288 7:75267475-75267497 GCGTGGATGGAGAGAGAGGAGGG + Intergenic
1029218416 7:98969272-98969294 ATGGGGATGCAGAGAGAGGCAGG - Intronic
1029392591 7:100285502-100285524 GCGTGGATGGAGAGAGAGGAGGG + Intergenic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1029902094 7:104052276-104052298 AGGTGAATGAATAGAGAGGCCGG + Intergenic
1029906458 7:104098390-104098412 AGGTGGATAATGAGAAAGACTGG + Intergenic
1031662319 7:124440984-124441006 GCAGGGATAAAGAGAGAGTCAGG + Intergenic
1033099734 7:138460216-138460238 AGGGGGATGAAGAGAAAGGCGGG + Intergenic
1037315885 8:17599084-17599106 ATGTGGATAAAGAGGGAGAAGGG - Intronic
1037386122 8:18343967-18343989 ACGTGGCAAAAGAGAGAAGGGGG - Intergenic
1037969417 8:23161343-23161365 ACTTTGATAAAGAGAAGGGCGGG + Intronic
1039099002 8:33920849-33920871 AAGTGGAAACAGAGAGAGGGAGG + Intergenic
1041526480 8:58812343-58812365 AGGGGAATAAAGAGAGAGGTAGG - Intronic
1042408740 8:68436972-68436994 ACATGGATTAAGTGAGAAGCAGG + Intronic
1042673497 8:71289936-71289958 ATGTGGAAAAAAAGAGAGGCGGG + Intronic
1042826514 8:72985324-72985346 AGGTGGATCATGAGCGAGGCGGG + Intergenic
1045441304 8:102215087-102215109 ACATGAAAAAAGAGAGAGGTCGG + Intronic
1046325021 8:112630667-112630689 ATATGGATAAAAAGAGAGGGAGG + Intronic
1046770337 8:118111593-118111615 AAGGGAATAAAGAGAGATGCAGG - Exonic
1046785535 8:118262057-118262079 AAGTGAATACAGACAGAGGCAGG + Intronic
1047709753 8:127539847-127539869 ACATGGATTTAGAGAGAGGATGG - Intergenic
1048003503 8:130399592-130399614 GGGTGGATGAAGTGAGAGGCTGG - Intronic
1048583553 8:135751006-135751028 AGGGTGATGAAGAGAGAGGCAGG - Intergenic
1048700734 8:137086037-137086059 AGGAGGAGAAAGAGAGAGGGAGG + Intergenic
1048730408 8:137434096-137434118 AGGTCCATACAGAGAGAGGCAGG - Intergenic
1049685698 8:143938447-143938469 AAGAGGAGGAAGAGAGAGGCAGG + Intronic
1050536233 9:6633262-6633284 ACATGCAGAAGGAGAGAGGCAGG - Intronic
1051189865 9:14500052-14500074 ATGTGGCTAAAGAGGTAGGCAGG - Intergenic
1051964719 9:22813361-22813383 ACTTGAATAACAAGAGAGGCAGG + Intergenic
1052593504 9:30529111-30529133 ACTGGGATAAAGGGACAGGCTGG + Intergenic
1055462978 9:76536867-76536889 AAGAAGAGAAAGAGAGAGGCAGG + Intergenic
1055710487 9:79055680-79055702 AGGTAGAGAAAGAGAGAGGTAGG - Intergenic
1057320262 9:94006156-94006178 ACGTGGAGAAAAAGGGAGACTGG - Intergenic
1057320413 9:94007504-94007526 ACGTGGAGAAAAAGGGAGACTGG + Intergenic
1057879192 9:98780276-98780298 AGGTGAATAAAGACAAAGGCCGG - Exonic
1057932108 9:99203330-99203352 ACGTGAACAAAGAGAAAGTCAGG + Intergenic
1057952067 9:99377125-99377147 ACGTGGCAGAGGAGAGAGGCAGG - Intergenic
1059330042 9:113529092-113529114 TCCTGGGAAAAGAGAGAGGCAGG - Intronic
1059588333 9:115630174-115630196 AGGTGGAGAAAGAAAGAGGAAGG + Intergenic
1059888775 9:118777448-118777470 ACATTGATAAAAAGAGAGACAGG + Intergenic
1060108862 9:120892238-120892260 ACGTGGATGAAGCTAGAGGGTGG + Intronic
1061193129 9:129093832-129093854 AAGCGGGTAAAGAGGGAGGCTGG - Intergenic
1061313020 9:129776485-129776507 ACATAGATAGAGAGATAGGCAGG - Intergenic
1061603125 9:131685864-131685886 ATTTGGACAAACAGAGAGGCAGG + Intronic
1185865388 X:3619576-3619598 ACGTGAAGAAAGACAGAGACTGG + Intronic
1186328962 X:8511901-8511923 AGGTGCATAAAAAGAGATGCTGG - Intergenic
1186543472 X:10424851-10424873 AGTTGGGTAAAGAGACAGGCAGG + Intergenic
1186785840 X:12955325-12955347 ATTTGGATAAAGAGACAGGCTGG + Intergenic
1187106839 X:16252019-16252041 ACCTGGAAAAAGAGAAAGGAGGG + Intergenic
1188256202 X:27964566-27964588 ACCTGGATAAAGAGAGAAGAAGG + Intergenic
1189542973 X:42011844-42011866 ACGTGGATGAAGGTGGAGGCAGG + Intergenic
1197284474 X:124580084-124580106 ATGTGGATCAAAAAAGAGGCAGG + Intronic
1200052687 X:153443317-153443339 AGGGGGAGCAAGAGAGAGGCGGG - Intergenic