ID: 1019721236

View in Genome Browser
Species Human (GRCh38)
Location 7:2572866-2572888
Sequence TCTTCCTTAAGGAGGATAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019721236_1019721241 -10 Left 1019721236 7:2572866-2572888 CCACCTATCCTCCTTAAGGAAGA 0: 1
1: 0
2: 0
3: 5
4: 129
Right 1019721241 7:2572879-2572901 TTAAGGAAGAACAGCCTCCAGGG 0: 1
1: 0
2: 1
3: 17
4: 200
1019721236_1019721244 21 Left 1019721236 7:2572866-2572888 CCACCTATCCTCCTTAAGGAAGA 0: 1
1: 0
2: 0
3: 5
4: 129
Right 1019721244 7:2572910-2572932 AAACCTCCTCACTGTACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019721236 Original CRISPR TCTTCCTTAAGGAGGATAGG TGG (reversed) Intronic
900972525 1:5999434-5999456 GCTTCCTTAAGAAGTAGAGGTGG - Intronic
901909964 1:12448769-12448791 TTTTCCTTAAAAAGGATTGGTGG - Intronic
902659716 1:17892633-17892655 TCTTCCCCAAGGAGGCTGGGTGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903221938 1:21874062-21874084 TGGTCCTGAAGGAGGATCGGGGG - Intronic
903278801 1:22238478-22238500 TCTGCCTTGATGAGGACAGGTGG - Intergenic
903730898 1:25494516-25494538 TCTTCCTGAAGGAAGAAAGAGGG + Intronic
903805246 1:26000586-26000608 TGTTCCTTCTGGAGGATGGGTGG - Intergenic
906091198 1:43181008-43181030 CCTTCCTGAAGGAGGGCAGGGGG - Intronic
909900461 1:81128491-81128513 GCTTCCTTAAGCAGCATTGGAGG - Intergenic
912551475 1:110488156-110488178 TCTGCCTTTAGTAGGAAAGGGGG - Intergenic
913508744 1:119543409-119543431 TCTTCTTTGAGGTGGACAGGAGG - Intergenic
916419896 1:164627196-164627218 TTTTCCTTAAGGAAAAAAGGGGG - Intronic
921580670 1:216892542-216892564 GCTTCCATAAAGAGGATAGAAGG - Intronic
1065021473 10:21505475-21505497 TCTTCCTTATTTAGGAAAGGGGG + Intergenic
1065189324 10:23195577-23195599 TCTTCTTTTAGGAGGAGTGGAGG - Intergenic
1068737229 10:60427956-60427978 TCTTCCTCAAGGAAGATCTGAGG - Intronic
1070790578 10:79186965-79186987 GCTTCCTGGAGGAGGAGAGGTGG - Intronic
1072426448 10:95334593-95334615 GCTTCCTAAGGCAGGATAGGAGG - Intronic
1079486563 11:20941310-20941332 TCTTCCCTCTGGAGGATAAGAGG + Intronic
1083090501 11:60194381-60194403 TCTTCCTTAAGGGAAATTGGGGG + Intergenic
1087940775 11:104094243-104094265 TGTTGCTGAAGGAGGGTAGGAGG - Intronic
1088070972 11:105784732-105784754 GCTTAATTAAGGAGGATAGTAGG - Intronic
1089059029 11:115610967-115610989 TCCTCCCTAAGAAGGGTAGGGGG + Intergenic
1090064575 11:123491915-123491937 TCTTCCTCAGGGAGGAGACGTGG - Intergenic
1090190385 11:124762715-124762737 TCTTCCTGAAGGAGGAAGAGGGG + Intergenic
1091246501 11:134100154-134100176 TTTTTTTTAAGGAGGAAAGGGGG - Intronic
1091774852 12:3177865-3177887 TCTTACTCAAGAAGGACAGGCGG + Intronic
1094059411 12:26297629-26297651 TCTTGCTTAAGGTGGTTTGGTGG - Intronic
1094395651 12:30002679-30002701 TCCTCCTTCAGGAGGAGAGATGG + Intergenic
1095766956 12:45907017-45907039 TCTTCCTGAAGGAGGATCCCTGG + Exonic
1095987874 12:48011570-48011592 TCTTTCTCATGGGGGATAGGAGG + Intergenic
1101554481 12:105795437-105795459 CTTTCCTTAAGTAGGATTGGTGG - Intergenic
1102347108 12:112167403-112167425 TCTTCCAGAAGGAGGGCAGGAGG + Exonic
1102696734 12:114805775-114805797 GCTTCCTTAACTAGGATATGAGG - Intergenic
1104521582 12:129480642-129480664 TCTTCCTTAGGGACGGTTGGAGG + Intronic
1109810203 13:67503446-67503468 TCTGCCTTCAGGAAGGTAGGAGG + Intergenic
1110713280 13:78673368-78673390 TCTTGCTTAGGGTGGATGGGTGG - Intergenic
1113636783 13:111924949-111924971 TCTTCCTGAAGGAGGGGATGGGG + Intergenic
1114788147 14:25624863-25624885 TCTTCCCTCAGGAGGAAGGGAGG + Intergenic
1116496010 14:45561429-45561451 TGTTACTTAAGTAGGATTGGAGG + Intergenic
1117992260 14:61445621-61445643 TTTTCCTTAAGGACTATAAGAGG + Intronic
1119897286 14:78230924-78230946 TATTCCATAAGGAGCAAAGGTGG + Intergenic
1120006017 14:79358762-79358784 AGTTCCTCAAGGAGAATAGGGGG - Intronic
1123755483 15:23394667-23394689 TCTTCCTGCAGGAGGAAGGGTGG + Intergenic
1124928741 15:34098266-34098288 TCTTCCTTCAGGATTAGAGGTGG + Intronic
1129607490 15:77031921-77031943 TCTACCTCAAGGAGGCGAGGAGG - Intronic
1139557095 16:67719229-67719251 CCTTCCTTAAGGCGGATGGGTGG - Exonic
1139612834 16:68071050-68071072 TCTTCCTCAAGGAGGGTCTGCGG + Exonic
1142134248 16:88444346-88444368 TGTTCCCTGAGGAGGGTAGGAGG - Intergenic
1143599462 17:7934701-7934723 TGTTCCTGAAGGAGTAAAGGGGG - Intronic
1147042071 17:37726962-37726984 ACTACCTTGAGGAGGAGAGGAGG - Intronic
1147985379 17:44304159-44304181 TCTTCCTTTAGGAGAGTAAGAGG + Intergenic
1148158079 17:45434811-45434833 TCTCTCTGAAGGAGGACAGGTGG - Intergenic
1150389670 17:64783089-64783111 TCTGCCTGAAGGAGGACGGGTGG - Intergenic
1157372310 18:47126399-47126421 TTTTCCTTAAGAAGGAGATGGGG + Intronic
1161801888 19:6420961-6420983 TCTTCCTGGAAGAGGCTAGGAGG - Intronic
1163901456 19:20104357-20104379 TCTTCCTTGGTGAGGATAAGTGG + Exonic
1164584087 19:29454914-29454936 TCTTCATCAAGGAGCATAAGAGG + Intergenic
1168217904 19:54939829-54939851 GCTTCCTGGAGGAGGACAGGAGG - Exonic
1168224214 19:54982771-54982793 GCTTCCTGGAGGAGGACAGGAGG + Exonic
925333086 2:3074023-3074045 GCTTCCTTCAGGAGGATACCTGG - Intergenic
926737529 2:16084725-16084747 TCTTGGCTGAGGAGGATAGGTGG - Intergenic
926822704 2:16870802-16870824 TCTTCCTGAAGGAGGATGTTTGG + Intergenic
927327522 2:21822369-21822391 TCTCCTTAAAGGAGGGTAGGGGG + Intergenic
930319551 2:49836915-49836937 TGTTGCTTTAGTAGGATAGGTGG - Intergenic
931065716 2:58584352-58584374 TCTTCCTAAATTAGTATAGGAGG - Intergenic
933045926 2:77536992-77537014 TCCTACTTAAAAAGGATAGGAGG - Intronic
933543920 2:83685178-83685200 TCTTACTAAAGGAGTATAAGTGG - Intergenic
933687901 2:85157867-85157889 CCTCCCTTAAGGAGGGAAGGAGG - Intronic
935053352 2:99543552-99543574 TTTTCCTCTAGGAGGTTAGGTGG - Intergenic
935296134 2:101651240-101651262 TCGTCCTTAAGAAGAACAGGAGG + Intergenic
935980427 2:108620847-108620869 TTTTCCTTAAAAAGGAGAGGAGG - Intronic
939713171 2:145549057-145549079 TCTTCCTGAAAGAGTATAGGGGG - Intergenic
943688577 2:190845143-190845165 TCTTGCTTTAGGAGGATCAGGGG + Intergenic
945000525 2:205345458-205345480 TCCTGCTTAAGGAGGGTGGGAGG + Intronic
948437824 2:237966161-237966183 TCTTCCTAAAGGAGGCTGGCGGG - Intergenic
1170365781 20:15597158-15597180 TCTCCCACAAGGAGGAGAGGTGG + Intronic
1173259434 20:41420581-41420603 ACTTCCTTCAAGAGGATATGTGG + Exonic
1174776909 20:53351794-53351816 TCTTCCTCAAGGAGGAAAACAGG + Intronic
1177793546 21:25747502-25747524 TCCTTTTTAAGGAGGAAAGGGGG - Intronic
1177793550 21:25747509-25747531 TCCTCCTTAAAAAGGATATGAGG + Intronic
968732856 4:2279008-2279030 TTTTCCATAAGGAAGAGAGGAGG - Intronic
974343501 4:60646348-60646370 TCTGCTCTTAGGAGGATAGGAGG - Intergenic
982103631 4:151992648-151992670 TTTTCCTTCAGGAGCAGAGGTGG - Intergenic
982724076 4:158887013-158887035 TTTTCCTTAAGGTGTATGGGAGG + Intronic
986071051 5:4283570-4283592 TCTTCCTTGAGGAGAAAGGGAGG - Intergenic
986729271 5:10623333-10623355 TGTTCCTTAAGGAAGATGGCAGG - Intronic
989007853 5:36835028-36835050 CCTTCCTTAAGAAAGATAGCTGG + Intergenic
990408397 5:55515360-55515382 TCATCTCTGAGGAGGATAGGAGG - Intronic
990579604 5:57155553-57155575 TTTTCCTTCAGGTGTATAGGTGG + Intergenic
991097156 5:62751473-62751495 TCATCCTTAAGGTGGCTAGCTGG + Intergenic
991328771 5:65467621-65467643 TCTTCCTTAAGAATGATGGATGG - Intronic
992382643 5:76253690-76253712 TTTTCCTTAGGGAGGAGAGGTGG - Intronic
993160922 5:84290036-84290058 TGTTCCTGAAGGAGGATCTGAGG - Intronic
994791135 5:104226996-104227018 TCTTGCTGAAGCAGGATAGTAGG - Intergenic
1000115983 5:158153772-158153794 TCTTCATAAAGGAGGAGTGGGGG - Intergenic
1003135133 6:3429179-3429201 TCTACCTGAAGGAAGAGAGGGGG + Intronic
1005662721 6:28015733-28015755 TTTTCCTTTAGGAGAATAAGAGG + Intergenic
1008623133 6:53291689-53291711 TATTCCTAAATGAGGAAAGGTGG - Intronic
1010524658 6:76885881-76885903 TCTTACTTAAGCAGGAGAGGAGG - Intergenic
1015359570 6:132323125-132323147 CCTTCTTTTAGGAGGATAAGAGG + Intronic
1015455007 6:133416505-133416527 TTTTCCATGAGGAGGTTAGGAGG + Intronic
1015679502 6:135789467-135789489 TCTTTCTTAAGGAGCTTGGGTGG + Intergenic
1017266536 6:152452679-152452701 TCTTCCTTGAGGTAGACAGGAGG - Intronic
1018762711 6:166905522-166905544 TCTCCCTGAAGAGGGATAGGGGG + Intronic
1019721236 7:2572866-2572888 TCTTCCTTAAGGAGGATAGGTGG - Intronic
1019910521 7:4097713-4097735 CCTTCCATAAGGAGGGAAGGAGG - Intronic
1021384585 7:20012525-20012547 TATTCCTTAAAGGGGATATGAGG + Intergenic
1023026974 7:36059491-36059513 TCTTCCTGAAGCAGGAAATGAGG - Intergenic
1026172819 7:67969419-67969441 TCTTCCTTCTGGTGGATACGTGG - Intergenic
1026819603 7:73537956-73537978 TCTTCCTTGGTGAGGGTAGGAGG + Exonic
1028957364 7:96709220-96709242 GCCTCATTAAGTAGGATAGGAGG - Intronic
1029600683 7:101561786-101561808 GCTTCCCCAAGGAGGAGAGGAGG - Intergenic
1031052347 7:116956520-116956542 GCTTCCTTGAGGAGGAAGGGAGG - Exonic
1036915236 8:12798239-12798261 TCTTCCTTTAGGAGGAAAGAGGG + Intergenic
1038420095 8:27428592-27428614 TCTTTGTTAGGGAGGATTGGGGG + Intronic
1044291254 8:90472934-90472956 TCTTCCTGAAGGCAGATAGATGG - Intergenic
1046624762 8:116564564-116564586 TTTTCCTCAAGGGGGGTAGGTGG - Intergenic
1046715371 8:117561208-117561230 TCTTCCTTGGGGAGGATGAGTGG - Intergenic
1048045069 8:130765341-130765363 GCTTCCTTACGGAGGAAAGCTGG - Intergenic
1050355609 9:4780303-4780325 TGTTTCTTAAGGTGGGTAGGAGG + Intergenic
1053282609 9:36830811-36830833 GGTTCCTCAAGGAGGAGAGGAGG - Intergenic
1055855000 9:80675070-80675092 TCTTCCCTATGGAGGAAATGAGG + Intergenic
1056735411 9:89205532-89205554 TCTTCCTTAAAGGGCACAGGTGG + Intergenic
1056856170 9:90131517-90131539 TCTGCCTAGAGGAGGAGAGGAGG + Intergenic
1057185316 9:93054172-93054194 CCTTGCTTTAGGAGGATAAGTGG + Intergenic
1057860765 9:98639131-98639153 TCTTCTGGAAGGAGGAAAGGAGG - Intronic
1062588635 9:137263245-137263267 ACTACCTTCAGGAGGGTAGGGGG - Intronic
1186151472 X:6678983-6679005 GCTCCCTGAAGGAGGATAGAGGG + Intergenic
1186313872 X:8348175-8348197 CCTTACTTAAGGGGGATTGGGGG + Intergenic
1187255149 X:17635535-17635557 CCTTCCTTAAGGAGCAGAGCGGG + Intronic
1188233178 X:27691812-27691834 ACAGCCTGAAGGAGGATAGGTGG + Intronic
1196190872 X:112793007-112793029 TCTTCTTTAAAGAAGATATGGGG + Intronic
1198608365 X:138369593-138369615 GCTTCCAGAAGGAGGATAAGTGG + Intergenic