ID: 1019721859

View in Genome Browser
Species Human (GRCh38)
Location 7:2577167-2577189
Sequence GGCCCAGGGAAGCACTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 368}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019721859_1019721866 10 Left 1019721859 7:2577167-2577189 CCAGCTCAGTGCTTCCCTGGGCC 0: 1
1: 0
2: 4
3: 45
4: 368
Right 1019721866 7:2577200-2577222 GTGGTGTGCGTGGCTGTGTGTGG No data
1019721859_1019721865 0 Left 1019721859 7:2577167-2577189 CCAGCTCAGTGCTTCCCTGGGCC 0: 1
1: 0
2: 4
3: 45
4: 368
Right 1019721865 7:2577190-2577212 TGTGCGCGGTGTGGTGTGCGTGG No data
1019721859_1019721862 -9 Left 1019721859 7:2577167-2577189 CCAGCTCAGTGCTTCCCTGGGCC 0: 1
1: 0
2: 4
3: 45
4: 368
Right 1019721862 7:2577181-2577203 CCCTGGGCCTGTGCGCGGTGTGG 0: 1
1: 0
2: 0
3: 29
4: 313
1019721859_1019721867 24 Left 1019721859 7:2577167-2577189 CCAGCTCAGTGCTTCCCTGGGCC 0: 1
1: 0
2: 4
3: 45
4: 368
Right 1019721867 7:2577214-2577236 TGTGTGTGGTGTGTGTGCAGTGG 0: 1
1: 15
2: 94
3: 424
4: 1604

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019721859 Original CRISPR GGCCCAGGGAAGCACTGAGC TGG (reversed) Intronic
900208400 1:1441255-1441277 GGCCACGGGATGCACAGAGCTGG - Exonic
900788636 1:4665573-4665595 GTCCCTGGGGAGCACTGGGCTGG + Intronic
900867232 1:5277169-5277191 GGCCCACTGAAGCAATGACCAGG + Intergenic
900932249 1:5744540-5744562 GGTCCAGGGAGGGGCTGAGCTGG - Intergenic
901246960 1:7739345-7739367 GTCCCTGGGATGCAATGAGCAGG - Intronic
902377565 1:16036980-16037002 GGCTCAGGGCAGGAGTGAGCAGG - Intergenic
902686453 1:18080635-18080657 GGCCCAGGAAAGCAGCGAGCCGG - Intergenic
903151681 1:21414431-21414453 GGCCCAGGGTCGCCCTGAGAGGG - Intergenic
903293152 1:22327175-22327197 GGCCCATGGCGGCCCTGAGCCGG - Intergenic
904256540 1:29258423-29258445 GGGCAAGGGGAGCACTGAGGAGG - Intronic
904284734 1:29446665-29446687 GGCTCAGGGAAGCCCTCAGATGG + Intergenic
904429203 1:30451141-30451163 GGCCCTGGGCAGAACTCAGCTGG + Intergenic
904592988 1:31625572-31625594 GGCCCAGGGAAGGGCTTCGCCGG + Intronic
904605852 1:31697175-31697197 TGCCCAGGGACACACTGTGCTGG - Intronic
904966336 1:34377395-34377417 GGCACAGGGACTCACTGGGCTGG - Intergenic
905274483 1:36808069-36808091 GGCCACAGGAAGCACTGAGGTGG - Intronic
906545554 1:46617021-46617043 GGTCCAAGGAAGCACCGAGAGGG - Intergenic
913351757 1:117869072-117869094 GACCCTTGGAAGCACTGATCTGG + Exonic
913667213 1:121059280-121059302 GGCCCCGTGGAGCACTGGGCAGG + Intergenic
914018903 1:143846431-143846453 GGCCCCGTGGAGCACTGGGCAGG + Intergenic
914197999 1:145460078-145460100 GGCCCAGGGTCGCTCTGAGAGGG - Intergenic
914449811 1:147781122-147781144 GAGCCAGGGAAGGGCTGAGCTGG - Intergenic
914477101 1:148033210-148033232 GGCCCAGGGTCGCTCTGAGAGGG - Intergenic
914490381 1:148147477-148147499 GGCCCAGGCAAGCACAGGGCTGG - Intronic
914513492 1:148354115-148354137 GGCCCAGGGTCGCCCTGAGAGGG - Intergenic
914657455 1:149754635-149754657 GGCCCCGTGGAGCACTGGGCAGG + Intergenic
915544169 1:156586480-156586502 GGCCCAGGGAAAGCCTCAGCAGG + Exonic
915657941 1:157377054-157377076 GGCCAAGGGAACTACTGAGGGGG + Intergenic
918036847 1:180881977-180881999 GGGGCAGGGGAGCACTGAGTGGG + Intronic
919612207 1:199759402-199759424 AGCCCAGGGCAGCAATGAGAGGG + Intergenic
920167805 1:204048068-204048090 GCCCCAGGCAACCACTGATCTGG + Intergenic
920274991 1:204798089-204798111 GGCCCAGGGCAGCAGGCAGCAGG + Intergenic
920441920 1:205986448-205986470 TGCCAGGGGGAGCACTGAGCTGG - Intronic
920965887 1:210700228-210700250 GGCTTATGGAAGCACTGAGCAGG + Intronic
921360622 1:214328419-214328441 GGAACAGGGAATCGCTGAGCAGG - Intronic
921520955 1:216153204-216153226 GTACCAAGAAAGCACTGAGCTGG + Intronic
921946094 1:220887105-220887127 GGCTCAGGGATGAAGTGAGCCGG + Intergenic
924167423 1:241299034-241299056 TCCCCAGGGAAGCCCAGAGCTGG + Intronic
1062854395 10:772463-772485 GGGCCAGGGAAGCCCTGCTCTGG - Intergenic
1062937566 10:1399738-1399760 GTGCCAGGGAACCACTGACCAGG + Intronic
1063593664 10:7413263-7413285 GCCCCCGGGAAGCCCTGCGCTGG - Intergenic
1064202856 10:13299556-13299578 GGCCCAGGCAGGCAGTGACCGGG - Intronic
1064293518 10:14056623-14056645 GGCCCAAAGAAGCAGTTAGCTGG - Intronic
1065643917 10:27814809-27814831 GGCACAGGGAAGAACAGAGTTGG - Intronic
1066313070 10:34217185-34217207 GGGACAGGGAAGCAGTGAGGTGG - Intronic
1066471793 10:35705471-35705493 GGCCCAGGGCAGCACACAGGTGG - Intergenic
1067161431 10:43828091-43828113 CTTCCAGGGAAGCACTGACCAGG - Intergenic
1067948517 10:50707996-50708018 GGAGGAGGGAAGCACAGAGCTGG + Intergenic
1068630653 10:59294198-59294220 GGCCCCGGGAGCCACTGAACTGG + Intronic
1069793803 10:71039944-71039966 GACCCAGGGAAGCAGGGACCTGG - Intergenic
1069815829 10:71193740-71193762 CGCCCAGGGGAGCACAAAGCTGG + Intergenic
1070722748 10:78768143-78768165 GGCCCTGGGGAGCAGTGAGGGGG - Intergenic
1070961264 10:80501817-80501839 GACCCAGGCAAGCACTGTCCTGG + Intronic
1071036076 10:81247323-81247345 GGTTCAGGAAAGTACTGAGCCGG - Intergenic
1071510255 10:86257025-86257047 GGGACAGGGAAGCACTCAGAGGG - Intronic
1071601374 10:86960148-86960170 GGCCCAGGAGAGGACTGGGCAGG - Intronic
1072524811 10:96262322-96262344 GCACCAGGGAAGCACAGACCAGG + Intronic
1073749438 10:106507319-106507341 GGCTTAGGGAAACACTGTGCTGG + Intergenic
1075446720 10:122518445-122518467 GGTCCAGGGCAGCAGTGAGCAGG - Intergenic
1075914901 10:126158559-126158581 GGGGCAGGGATGCACAGAGCCGG + Intronic
1076042640 10:127264200-127264222 GGACTAGGGAAGCTGTGAGCTGG - Intronic
1076302618 10:129439497-129439519 GGCCCAGTGAAGAACAGAGTGGG + Intergenic
1076618213 10:131770830-131770852 GGCCCAGGGGAGCACAGAGGTGG + Intergenic
1076629378 10:131843074-131843096 GGCCGAGAGATGCCCTGAGCGGG - Intergenic
1076817357 10:132921467-132921489 GTCCCAGGGAGACCCTGAGCTGG - Intronic
1077011931 11:382692-382714 GGCCCAGGCCAGGACTGAGCTGG - Intergenic
1077034787 11:489381-489403 GCCCCTGGGAACCACAGAGCCGG - Exonic
1077123402 11:921518-921540 GGCCCAAGGGTGCCCTGAGCCGG + Intergenic
1077341743 11:2029283-2029305 AGCCCCGGGAAGCACTGACCAGG - Intergenic
1077442077 11:2573590-2573612 GGCCTAGGGAAGCAGGGACCCGG + Intronic
1078140221 11:8687051-8687073 GGCACAGAGAAGCACTGAATTGG + Exonic
1078541691 11:12218246-12218268 GGCCCAGGGAGGCTCTGGGATGG - Intronic
1079373180 11:19869656-19869678 GGCCTATGGCAGCTCTGAGCTGG - Intronic
1079375861 11:19891366-19891388 GGTCCAGGGAATTACTAAGCAGG - Intronic
1079725067 11:23870351-23870373 AGCCCAGGGAAGCTGGGAGCGGG + Intergenic
1080599843 11:33810476-33810498 CCCCTAAGGAAGCACTGAGCGGG + Intergenic
1083408021 11:62472093-62472115 GGCACAGGGAAGGACTGATACGG - Intronic
1083424443 11:62575846-62575868 GCACCAGGGCAGCAGTGAGCTGG + Exonic
1083599626 11:63938895-63938917 GGCGCAGGGCAGCGGTGAGCCGG - Intergenic
1083706182 11:64518006-64518028 GGCCCTGGGACCCACTGAGGCGG - Intergenic
1083827503 11:65211779-65211801 GGGCCAGGGAAGGACAGAGGGGG - Exonic
1083842088 11:65310360-65310382 GGCCCAGGGGATCCCTGAGGAGG - Intergenic
1084147261 11:67271744-67271766 GTCCAAGGTAAGCCCTGAGCAGG - Intronic
1084350644 11:68596686-68596708 GGCACAAGCAAGCACTCAGCTGG - Intronic
1085463653 11:76710075-76710097 GGCCTAGGAAAGCACACAGCAGG + Intergenic
1087887162 11:103494578-103494600 GGCCCAGAGAAGGCATGAGCAGG - Intergenic
1088575228 11:111265052-111265074 GACCCAGGTGAGCAGTGAGCAGG + Intronic
1088746313 11:112807784-112807806 GGTCCAGGGAAGCACAGGGATGG - Intergenic
1088776633 11:113091281-113091303 GGAGCAGGGAGCCACTGAGCTGG - Intronic
1089148161 11:116345462-116345484 GGGCCAGGGCAGCATTCAGCTGG - Intergenic
1089620940 11:119721803-119721825 GGGCCAGGGAAGCAGTGTCCTGG - Intronic
1090666275 11:128916890-128916912 GGCTCAGGGAGGCCCTGTGCTGG - Exonic
1091306941 11:134542302-134542324 GGCCAAGGGAAGAACTGAGTTGG - Intergenic
1202824729 11_KI270721v1_random:84472-84494 AGCCCCGGGAAGCACTGACCAGG - Intergenic
1092595885 12:10004237-10004259 AGGCCGGGGAGGCACTGAGCTGG - Intronic
1092917468 12:13201838-13201860 GGCTCAGGGAGAAACTGAGCTGG + Intronic
1094525706 12:31229364-31229386 GGACCAAGGAAGCTCTGAGAGGG + Intergenic
1096583872 12:52606809-52606831 GGCCCAGGGAGGAACTCAGGGGG - Intergenic
1101365300 12:104064818-104064840 CGCCCAAGGAAGCAGTGACCGGG - Intronic
1102396936 12:112594250-112594272 GGCCCAGAGAAGGAATGAGAGGG - Intronic
1102574948 12:113850302-113850324 TACCCAGGAAAGCTCTGAGCAGG + Intronic
1103398930 12:120629160-120629182 GGCCAAGGGCAGCACGGAGAAGG + Intergenic
1103568098 12:121827142-121827164 GGCCCAGGGAGGCCAAGAGCAGG + Intronic
1103749986 12:123151591-123151613 GGCCCAGGGAACGGCAGAGCCGG + Intergenic
1103948332 12:124539142-124539164 GGCCCCGGGAAGCCCTGACGGGG - Intronic
1104072937 12:125362214-125362236 GGCACAGGGAAGCGCTGAGCAGG - Intronic
1104639340 12:130457488-130457510 GTCCCAGGGGAGCAGGGAGCGGG - Intronic
1104874750 12:132026223-132026245 GGCCAAGGCAGGCACAGAGCGGG - Intronic
1105214196 13:18274762-18274784 GGCCCAGAGAGGGCCTGAGCTGG + Intergenic
1106195999 13:27494356-27494378 GGCCCAGGGAAAGCCAGAGCTGG - Intergenic
1106241714 13:27918373-27918395 GGCCAAGGGAAGCACGGCGGCGG - Intergenic
1106974432 13:35190341-35190363 GGCCCAGGGAAGACCTGAGAAGG + Intronic
1108147221 13:47491285-47491307 GGCACAGGGAAGAACTTATCTGG + Intergenic
1112398039 13:99051223-99051245 TGTCAAAGGAAGCACTGAGCTGG - Intronic
1112492167 13:99876975-99876997 AGGGCAGGGCAGCACTGAGCAGG - Intronic
1112608467 13:100931323-100931345 GGCCCAGAGAAGCACTGGAATGG - Intergenic
1113797211 13:113065609-113065631 GGCCAGGGGCAGCACAGAGCAGG - Intronic
1113808351 13:113122879-113122901 CAGCCAGGGAGGCACTGAGCAGG - Exonic
1115405091 14:33006130-33006152 GAAGCAGGGAAGCACTGAGTTGG - Intronic
1116799111 14:49424505-49424527 GATGTAGGGAAGCACTGAGCTGG - Intergenic
1116948762 14:50859628-50859650 GGCCAAGGGAAGCACAGCACCGG + Intronic
1117297936 14:54396237-54396259 GGCTCAGGGAAGCACTGTATTGG - Intergenic
1118586903 14:67361904-67361926 GGCACAGTGAAGCAATGAACAGG - Intronic
1119329967 14:73786721-73786743 TTCCCAGGGAAGCACCGGGCAGG + Intronic
1120208103 14:81607943-81607965 GGCCCATGGAGCCAGTGAGCTGG - Intergenic
1121782592 14:96631475-96631497 GGCCCAGGGAAGCAGAGGGAAGG + Intergenic
1122075641 14:99232999-99233021 GGCCCAGGGTATTTCTGAGCTGG + Intronic
1122264792 14:100541532-100541554 GGCCCAGGGAGGCACTGAGAGGG - Intronic
1122732126 14:103808361-103808383 GGCCCAGGGAAGCCCAAAGTTGG - Intronic
1122942340 14:104987025-104987047 AGGCCAGGGAAGCAATGAGTTGG + Intronic
1122954842 14:105065808-105065830 GGGCCAGGCAAGCACGGAGCAGG + Intergenic
1123039216 14:105483554-105483576 GGCCCTGGGGAGGCCTGAGCTGG + Intergenic
1123701582 15:22918179-22918201 AGCCCAGGGCAGCAGTGAGGTGG + Intronic
1124291585 15:28457030-28457052 GGCCCAGGAAAGCGCAGGGCTGG + Intergenic
1124403108 15:29367626-29367648 TGCCCAGGAAAGCCCTGAGAAGG + Intronic
1125454196 15:39841036-39841058 GACCCAGGGCAGCAGAGAGCTGG - Intronic
1125975620 15:43949053-43949075 GGCCAAAAGAAGCACTAAGCAGG + Intronic
1126778762 15:52120538-52120560 GGCCCAGGGAAGCACATTCCAGG - Exonic
1127384957 15:58459869-58459891 GGCCCTGGGAGGCCCTGAGTGGG + Intronic
1127664850 15:61135682-61135704 GTACCAGGGAAGCAGAGAGCAGG + Intronic
1128658764 15:69482777-69482799 TGCCCATGGTAGAACTGAGCTGG + Intergenic
1128699358 15:69793075-69793097 GGCCCAGGGCACCTCTCAGCAGG + Intergenic
1129276325 15:74448093-74448115 GCACCAGGCAGGCACTGAGCTGG - Intronic
1129323914 15:74789617-74789639 GGCCCAGGGAACCTCCGAGCAGG - Intronic
1129331971 15:74832420-74832442 GGCCCTGCGAAGCACTGAGGGGG - Intergenic
1129682134 15:77663913-77663935 GGCCCAGGGAGGGGCTAAGCAGG + Intronic
1130542968 15:84835149-84835171 GGGGCAGGGAGGCTCTGAGCTGG + Intronic
1132405018 15:101536681-101536703 GCCCCAGGACAGCGCTGAGCTGG - Intergenic
1132410824 15:101577179-101577201 GGGCCAGGGATGCAGAGAGCCGG - Intergenic
1132558768 16:584144-584166 GGTCCAGGGAAGCTCTGGGGGGG + Intergenic
1132640876 16:977722-977744 GGCACAGGGAAGGACGGAGAGGG + Intronic
1132654381 16:1035810-1035832 AGCCCAGGGTGCCACTGAGCAGG + Intergenic
1132689879 16:1177686-1177708 GTCCCAGGGAAGGGCTGGGCAGG + Intronic
1133076426 16:3283979-3284001 GTCCCCGGGAAGCCCTCAGCCGG + Exonic
1134019633 16:10912580-10912602 GGCACAGGGGAGCAGTGATCAGG - Intronic
1135724597 16:24844920-24844942 GGCCCAGTGAAGGAGTGAGATGG + Intergenic
1136008626 16:27348023-27348045 GCCCCTGGGATGCACAGAGCCGG - Intronic
1136069419 16:27778997-27779019 GGCCCAGAGAATGGCTGAGCAGG + Exonic
1136275925 16:29179577-29179599 GGCCCAGTGAAGACCAGAGCTGG + Intergenic
1136366536 16:29811726-29811748 GGCCCTGGAAAGGACGGAGCGGG - Intronic
1136533805 16:30887538-30887560 GGCCCAGGCGAGGGCTGAGCAGG + Intronic
1136707194 16:32200640-32200662 GGCCCAGGCAAGCGCAGGGCTGG - Intergenic
1136760716 16:32728777-32728799 GGCCCAGGCAAGCGCAGGGCTGG + Intergenic
1136807387 16:33141609-33141631 GGCCCAGGCAAGCGCAGGGCTGG - Intergenic
1137618165 16:49858739-49858761 GGCCCAGGGATGGACGGAGTTGG + Intergenic
1137737881 16:50738483-50738505 GGCACTGGGAAGCATGGAGCAGG + Intergenic
1138177017 16:54909625-54909647 GGCCAAGGAGAGCACTGAGGTGG + Intergenic
1138185059 16:54970594-54970616 GGCACAGGGAAGGCCTAAGCAGG + Intergenic
1138185363 16:54972622-54972644 GGCCAAGGAGAGCACTGAGGTGG - Intergenic
1138418364 16:56884297-56884319 GGCCCTGGACAGCACAGAGCCGG - Intronic
1138496392 16:57411778-57411800 GGCACAGGGCAGCCCTGACCTGG - Intronic
1140507546 16:75483292-75483314 TACCCAGGGAAGGGCTGAGCTGG - Intronic
1141184169 16:81775237-81775259 GGACCAGGAAAGCAGAGAGCGGG - Intronic
1142080297 16:88145639-88145661 GGCCCAGTGAAGACCAGAGCTGG + Intergenic
1203062868 16_KI270728v1_random:989091-989113 GGCCCAGGCAAGCGCAGGGCTGG + Intergenic
1143003762 17:3813323-3813345 GAACCAGGGTAGCACTGAGGGGG + Intronic
1143044970 17:4070842-4070864 GGCCCACAGAAGTTCTGAGCAGG + Exonic
1143151687 17:4810847-4810869 GGCCCAAGAGATCACTGAGCTGG + Exonic
1143166712 17:4900549-4900571 GGGCTAGGGAGGCACTGAGCCGG + Exonic
1143860721 17:9888807-9888829 TTCCCAGGGAAGCAGAGAGCTGG - Intronic
1144422367 17:15110020-15110042 GGCCAAGGGAAGCACTGGGAAGG - Intergenic
1144863333 17:18319334-18319356 GGCCCTGAGAAGCACTCAGAGGG + Intronic
1145190973 17:20842080-20842102 GGCCCAGGCAAGCGCAGGGCTGG - Intronic
1145906961 17:28521566-28521588 TGACCAGGGAAGCGCCGAGCTGG - Intronic
1145910701 17:28540463-28540485 GGCCCAGGGTTGGACAGAGCTGG - Intronic
1146212100 17:30950698-30950720 GGCCCAGGGATGTGCTGAGATGG + Intronic
1149597426 17:57872574-57872596 GGCTCAGGAAAACACTGAGCTGG - Intronic
1149597679 17:57873811-57873833 GGCCATGGGAATCTCTGAGCAGG - Intronic
1151213281 17:72560595-72560617 TGCCCAGGGACACACGGAGCAGG + Intergenic
1151317044 17:73329407-73329429 GGCACAGGGAAGCACTGCCGTGG + Intergenic
1151662322 17:75525530-75525552 GGCCCCGGGAAGCGCGGGGCGGG - Intronic
1151764013 17:76122770-76122792 GGCACAGGGAAGCCCTGCCCGGG + Intergenic
1152171795 17:78755602-78755624 GCCCCAGGCAACCACTGATCTGG - Intronic
1152710993 17:81870617-81870639 TGCCCGGGGCAGCACTGACCCGG + Intronic
1152938744 17:83154779-83154801 CTCCCATGGAAGTACTGAGCTGG - Intergenic
1153028476 18:691860-691882 GCCCCAGGCAAACACTCAGCAGG + Intronic
1153435382 18:5063149-5063171 GGCACAGGGAAGAAATGACCTGG + Intergenic
1154230135 18:12549045-12549067 GTGCCAGGGAAGCACTGAAATGG - Intronic
1154310201 18:13261421-13261443 GTCCCAGGCAGGCACTGTGCTGG - Intronic
1154318815 18:13327748-13327770 GGCCCAGAGACCCACAGAGCAGG + Intronic
1154491433 18:14925239-14925261 AGACATGGGAAGCACTGAGCTGG + Intergenic
1155090977 18:22510904-22510926 TGACCAGGAAAGCACTGAGAAGG - Intergenic
1158224023 18:55182027-55182049 GGCCCTGGGTGGCACTGTGCTGG - Intergenic
1158395089 18:57073029-57073051 AGCACAGGGAAGCACTATGCTGG + Intergenic
1159058444 18:63490311-63490333 GCCTGGGGGAAGCACTGAGCCGG - Intronic
1159493932 18:69176056-69176078 GGCCCAGGGCAGCACTGTGAAGG - Intergenic
1159831945 18:73287889-73287911 GGCCCAGAGCAACACTGTGCAGG - Intergenic
1159886054 18:73908455-73908477 AGTCCAGGGAAGCACAGAACAGG + Intergenic
1160070096 18:75621065-75621087 AGCTTAGGGAAGGACTGAGCCGG - Intergenic
1160657754 19:282026-282048 GGCCCAAGGAAGGACTCAGTGGG + Intronic
1160995229 19:1879343-1879365 GGCCCAGGCAAGCGCAGGGCTGG + Intronic
1161038089 19:2096500-2096522 AGCCCTGGGATGCCCTGAGCCGG + Intronic
1162184178 19:8891864-8891886 GACCCACGGCATCACTGAGCTGG - Exonic
1162417502 19:10546942-10546964 GGCCCAGGGTGCCCCTGAGCTGG + Exonic
1162573542 19:11485904-11485926 GCCCCTGGGAATCTCTGAGCTGG - Intronic
1163031309 19:14545942-14545964 GGCCCAGAGGAGCTCTGATCAGG - Intronic
1163120459 19:15214134-15214156 GTCCCAGGGAAGCAGTGTCCAGG - Intergenic
1164191864 19:22925313-22925335 GGCCCAGGGCAGTGCGGAGCCGG + Intergenic
1164524072 19:29000664-29000686 GGCCCGGGGAAGCATTTTGCAGG - Intergenic
1166348063 19:42179179-42179201 GGTCCAGGGAAGCACCAAGGGGG + Intronic
1166351157 19:42199036-42199058 GGCCCAGGGAAGATCTCAGCAGG + Exonic
1166894895 19:46016927-46016949 GGGCCTGGGAAGCACTGGGCGGG + Intronic
1168210036 19:54883641-54883663 TCCCCTGGGAAGCACTGAGATGG - Intronic
1168726119 19:58583093-58583115 GGGCCCGGGAAGAACAGAGCTGG - Intergenic
925176598 2:1788820-1788842 TGCCCAGGGGAGCCCTGTGCTGG + Intergenic
925414120 2:3657467-3657489 TGCGCAGGGAGGGACTGAGCTGG - Intergenic
925971477 2:9109657-9109679 AGCCCAGGGAAGCACTAGGGAGG + Intergenic
927493962 2:23540093-23540115 GGCCCAGGCAAGGACTGAGGAGG - Intronic
927959657 2:27233230-27233252 GGCTGAGGGAAGCAGTGAGCAGG + Intronic
929119627 2:38473758-38473780 GGCCCAGGGAATTTCTCAGCTGG - Intergenic
931600993 2:64002259-64002281 TGCCCAAAGAAGCACTGAACAGG - Intronic
931664753 2:64602190-64602212 GGCCTAGGCAAGCCATGAGCTGG - Intergenic
934300123 2:91771988-91772010 GGCCCAGAGAGGGCCTGAGCTGG - Intergenic
936154077 2:110037024-110037046 CACCCAGGTAAGCAATGAGCAGG - Intergenic
936190607 2:110334391-110334413 CACCCAGGTAAGCAATGAGCAGG + Intergenic
936336843 2:111597695-111597717 GCCCTAAGGAAGCAGTGAGCTGG + Intergenic
936463618 2:112728474-112728496 GTTCCAGGGAAGCCCTGAGCTGG - Intronic
937314393 2:120921738-120921760 GCCCCTGGGAAGTCCTGAGCAGG - Intronic
937338682 2:121077221-121077243 GGCCCCAGCAAGGACTGAGCAGG - Intergenic
937693412 2:124781242-124781264 GGCTCAGGGAAGAGGTGAGCTGG + Intronic
937914182 2:127090768-127090790 GGCCAAGTGAAGGTCTGAGCTGG + Intronic
942072986 2:172332106-172332128 GGCCCAGGGGAGAAGTGAGGAGG + Intergenic
942349784 2:175040041-175040063 CGCCCTGGGAAGGTCTGAGCTGG - Intergenic
942767007 2:179469200-179469222 GGCCCAGGGAAGCCCAAAGATGG - Intronic
943190995 2:184679916-184679938 AGGCCAGGGAAGGCCTGAGCTGG + Intronic
943324957 2:186486512-186486534 CTCCCAGGGAAGCCCGGAGCGGG - Intronic
943936056 2:193918679-193918701 GTCCCAAGGAGGCACAGAGCAGG - Intergenic
946520291 2:220457135-220457157 GGCTCAGGGAAGTCCTGACCTGG + Intergenic
947512295 2:230767417-230767439 AGACCAGTGAAGCAGTGAGCAGG - Intronic
948090807 2:235293244-235293266 GGAACCGGGAAGCCCTGAGCTGG - Intergenic
948804758 2:240448672-240448694 AGCCCAGGGAGACTCTGAGCAGG - Intronic
948948101 2:241231695-241231717 GGCCCAAGGAAGGCCTGAGCAGG - Intronic
1171248647 20:23632773-23632795 GGCAAAGGGAAGGACTGTGCAGG + Intronic
1171461689 20:25301642-25301664 GGCCCAGGGCAGTACAGAGGAGG + Intronic
1172272750 20:33663737-33663759 GGGCCAGGGCAGCTCTGAGCTGG + Exonic
1173152940 20:40583402-40583424 GGGCCAGGGCAGCACAGAGAAGG + Intergenic
1173407120 20:42776057-42776079 GAGCCTGGGAAGAACTGAGCAGG - Intronic
1173618014 20:44415494-44415516 GGCCCAGGGGTGCTCTGGGCAGG - Intronic
1175729463 20:61344116-61344138 GGCCGAGGGAAGCACTAATGAGG + Intronic
1175825237 20:61933366-61933388 GGCACAGGGCAGCACTGGGCTGG - Intronic
1175894890 20:62331608-62331630 GACCCAGGCAGGCACTCAGCAGG + Intronic
1175902206 20:62364437-62364459 GGCCCAGGCAGGGACTGAGCAGG - Intronic
1175919539 20:62444211-62444233 GGCCCAGGGATGAACAGAGGTGG + Intergenic
1176101246 20:63365504-63365526 GGCCCAGGAGAGGACTGAGGAGG + Intronic
1179799725 21:43805356-43805378 GGCCCAGGGGAACACTGACCAGG - Intergenic
1180025835 21:45161556-45161578 GGCTGAGGGAAGCACAGCGCAGG + Intronic
1180799251 22:18624174-18624196 GGCCCAGGGAAGCAGGGAGGAGG + Intergenic
1180958721 22:19752690-19752712 AGCCCTGGGAAGCTCTGAGAAGG - Intergenic
1181121302 22:20669883-20669905 GGCCCAGGCAAGCGCAGGGCTGG + Intergenic
1181222467 22:21371092-21371114 GGCCCAGGGAAGCAGGGAGGAGG - Intergenic
1181334258 22:22116908-22116930 GGCCCAGGCAAGCGCAGGGCTGG + Intergenic
1181555900 22:23671535-23671557 GGCCCAGAGAGGGCCTGAGCTGG + Intergenic
1181638223 22:24184078-24184100 GGCCCAGGGAAGCAGGGAGGAGG - Intronic
1181698477 22:24607118-24607140 GGCCCAGAGAGGGCCTGAGCTGG - Intronic
1182121550 22:27790485-27790507 GGCCCTGGGTGGCTCTGAGCTGG + Intronic
1182554613 22:31122552-31122574 GGCCGGGGCAAGCTCTGAGCTGG + Intergenic
1183229725 22:36574225-36574247 GCTCCAGGGAAGCAGTGAGAAGG + Intronic
1183512355 22:38243626-38243648 GCCCCAGTTAAGCCCTGAGCAGG + Intronic
1183623161 22:38986570-38986592 GGCCCAGGAAAGCAGGGAGGAGG - Intronic
1184171312 22:42761387-42761409 GGCCTTGGGTGGCACTGAGCAGG - Intergenic
1184607581 22:45582928-45582950 GGCCCAGGGCAGCCTTGGGCTGG - Intronic
1185168399 22:49276550-49276572 GGCTCAGAGCGGCACTGAGCCGG + Intergenic
1185408699 22:50671976-50671998 GGCTCAGGGCGGCACTGGGCAGG + Intergenic
952992587 3:38844603-38844625 GGACCAGGGAAGCTTTGAGATGG - Intergenic
953624194 3:44557247-44557269 GGCCGCAGGAAGCATTGAGCCGG + Exonic
953632293 3:44629318-44629340 GACCCCAGGAAGCCCTGAGCCGG + Exonic
954136677 3:48585103-48585125 GCTCCAGGGAAGCCCTGAGGAGG + Exonic
954192489 3:48973850-48973872 GGCCCTGGGCAGCACTAAGGAGG - Intronic
954390845 3:50267325-50267347 GGCAAAGGGAATCACTGAGTGGG - Intergenic
954681833 3:52350132-52350154 GGGCCAGGGAGGCACAGGGCTGG + Intronic
954797275 3:53168051-53168073 GGCCAAGGGGAGCCCTGAGGGGG - Intronic
955520663 3:59772549-59772571 GGCCCAGGTAGGCACAGGGCTGG + Intronic
956112876 3:65888352-65888374 AGCCAAGGGAAGTACTGAGCAGG + Intronic
958967006 3:100570321-100570343 GGCACAAAGAAGCACAGAGCAGG - Intronic
959638700 3:108606210-108606232 GGCCCACTGAACCACTCAGCAGG - Intronic
960448220 3:117774306-117774328 TGCCCAGGGAAGCAGTCATCAGG + Intergenic
961349731 3:126292186-126292208 GCTCCAGGGAAGCACAGGGCTGG + Intergenic
961406007 3:126680003-126680025 GGCCCAGGGAAGCTGTGACCTGG + Intergenic
962352182 3:134664145-134664167 GACACAGGGAAGCAAAGAGCAGG - Intronic
968912256 4:3482356-3482378 GGCCCAGGAAAGCACTGTGCCGG + Intronic
969443754 4:7232718-7232740 GGCCCAGGGCAGCTCCCAGCAGG - Intronic
970959608 4:21856952-21856974 GGCCAAGGGCAGCTCAGAGCTGG + Intronic
972106406 4:35494220-35494242 GGGCCAGGGAAGCAGAGAGCTGG - Intergenic
974760276 4:66265994-66266016 GGCCAAGGGAGGCAGTGAGTGGG + Intergenic
975873671 4:78810288-78810310 CGCCCAGGAAAGAACTGAGAAGG - Intronic
976940129 4:90690028-90690050 GGGCCAGGTATGCACAGAGCTGG + Intronic
977666173 4:99649651-99649673 GGCCAAGGGAGGCACAGAGATGG + Exonic
980093911 4:128470235-128470257 GGCCCAGGTAAGCACAGAATGGG - Intergenic
982485086 4:155956820-155956842 GGACCAGGGAATGACTGAGGTGG + Intergenic
982590006 4:157296661-157296683 TGCCCAGGGAAACATAGAGCTGG + Intronic
985705999 5:1401745-1401767 GGCCCAGGTCAGCGCAGAGCTGG - Intronic
986384574 5:7219010-7219032 GCCCCAGGCAAACACTCAGCTGG - Intergenic
990393714 5:55354993-55355015 GGGCGAGGGAAGCTCTGAGAAGG + Intronic
990451194 5:55933186-55933208 GGGCCAGGAGAGGACTGAGCTGG + Intergenic
991472755 5:66986235-66986257 GTCCCTGGGGAGCACAGAGCTGG + Intronic
993164224 5:84331306-84331328 GGCCCAGGGATGGACTGATATGG + Intronic
993905807 5:93621519-93621541 GGCCAATGGAAGCGCTGGGCGGG + Intronic
994089909 5:95800711-95800733 AGCCCAGAGAAACCCTGAGCAGG - Intronic
997196900 5:131986269-131986291 GGGAGAGGGAAGGACTGAGCTGG + Intronic
999564124 5:152838492-152838514 GTCCCACGGCAGCACTCAGCAGG + Intergenic
1000350428 5:160348414-160348436 GGCCAAGGTAAGAACTGAGAAGG - Exonic
1000350689 5:160350072-160350094 AGCCCATGGAAGGATTGAGCTGG - Intronic
1000945418 5:167417293-167417315 GGGCCAGGGATGGACTGTGCTGG - Intronic
1001647150 5:173290435-173290457 GACCTAGGGAGCCACTGAGCAGG + Intergenic
1002021890 5:176368766-176368788 GGGCCCGGGAGGCTCTGAGCTGG + Intronic
1002043831 5:176531373-176531395 GGCCCAGGGCAGCCCTGAACTGG - Intronic
1002092575 5:176813743-176813765 GGCCCAGAGCAGCACTAGGCAGG - Intronic
1002442656 5:179272465-179272487 GGACCATGGCAGCACAGAGCAGG + Intronic
1002483184 5:179516882-179516904 GACCGAGGGAAACACTGAGGGGG + Intergenic
1002483198 5:179516933-179516955 GACCGAGGGAAACACTGAGGGGG + Intergenic
1002483251 5:179517137-179517159 GACCGAGGGAAACACTGAGGGGG + Intergenic
1002483265 5:179517188-179517210 GACCGAGGGAAACACTGAGGGGG + Intergenic
1002483292 5:179517290-179517312 GACCGAGGGAAACACTGAGGGGG + Intergenic
1002516138 5:179760433-179760455 GGCCCCAGGCAGCACTGAGCAGG + Intronic
1002710814 5:181193966-181193988 TTCCCAGGGGAGCGCTGAGCAGG + Exonic
1004664906 6:17740838-17740860 GCCCCAGGGAAGCAGAGTGCTGG + Intergenic
1005195687 6:23281127-23281149 GGACCAGGGAAGCACAGAAAGGG - Intergenic
1005693476 6:28329507-28329529 GTCCCCGAGAAGCTCTGAGCCGG - Exonic
1006491567 6:34392457-34392479 GGCCAAGGGAAGCAGGGAGGGGG + Exonic
1007351340 6:41275754-41275776 GGTCCAGGGCAAAACTGAGCAGG + Exonic
1010186400 6:73148890-73148912 CTCCTAGGGAAGCACTGAGAAGG + Intronic
1012226645 6:96711359-96711381 GGTGCAGGGAAGCATTGAGTGGG + Intergenic
1014582667 6:123158186-123158208 GGCCCTGGTAAGCACTTAGGAGG + Intergenic
1018028231 6:159822128-159822150 TGCCTAGGGCAGCCCTGAGCTGG + Intergenic
1018641307 6:165907035-165907057 GGGCCAGGCAATCACAGAGCAGG + Intronic
1018650683 6:165989007-165989029 CACCCAGGGATGCACTGCGCAGG + Intergenic
1019168035 6:170112012-170112034 GCCCCAGGGAAGCGCTAAGCAGG + Intergenic
1019405910 7:883960-883982 TGCCCAGGGAAGAAGGGAGCCGG + Intronic
1019721859 7:2577167-2577189 GGCCCAGGGAAGCACTGAGCTGG - Intronic
1020347584 7:7182494-7182516 GCCCCAGGGAAGGGCGGAGCGGG - Intronic
1024231515 7:47367301-47367323 CGGCCAGGGAAACACTCAGCAGG - Intronic
1024275072 7:47670829-47670851 AGCCCAGGCGGGCACTGAGCAGG + Intergenic
1024667241 7:51559232-51559254 GTCCCAAGGATGCACAGAGCAGG - Intergenic
1025021893 7:55486822-55486844 TGCCCAGGGCAGCACAGGGCAGG + Intronic
1026937821 7:74269113-74269135 GGTTCAGGGATGCACTGCGCAGG + Intergenic
1027569580 7:79847363-79847385 GGACCAAGAAGGCACTGAGCTGG + Intergenic
1028303265 7:89228844-89228866 GGCACAGGGGCGCACGGAGCAGG + Intronic
1028635242 7:92981355-92981377 TGCCCAGGAAAGAACTGAGAAGG - Intergenic
1030468282 7:109930374-109930396 GGCCCAGGAAAGCTGAGAGCTGG - Intergenic
1031215332 7:118883144-118883166 AGCCCTGGGAAGAACTCAGCTGG + Intergenic
1033038744 7:137899301-137899323 GGCCCAGGGAAGGCCTGACACGG + Intronic
1034553742 7:151837018-151837040 CGCCCAGGGCAGGGCTGAGCTGG - Intronic
1034959844 7:155358369-155358391 GTCCCAGGGAGGCACAGAGGGGG - Exonic
1035279985 7:157772481-157772503 GTCTCTGGGCAGCACTGAGCAGG - Intronic
1036215732 8:6878242-6878264 GCCACAGGGAAGCTCTGAGCAGG + Intergenic
1037910918 8:22743138-22743160 AGCCCAAGGAAGCACTGATAAGG - Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1038585349 8:28783419-28783441 GGCCAAAGGAAGCACTGCTCTGG + Intronic
1040029554 8:42812297-42812319 AGCTCAGGGGAGCACTGAGGAGG + Intergenic
1040478608 8:47803339-47803361 GTCCCAGGGCTGCTCTGAGCAGG - Exonic
1040634872 8:49261199-49261221 GCCCCAGGGAAGCATTGAGCGGG - Intergenic
1040741318 8:50579567-50579589 GCCCCAGGGATGCACATAGCAGG - Intronic
1041462704 8:58129527-58129549 GGCCAAGGGAACCACTGGACAGG - Intronic
1042866345 8:73359709-73359731 GGCCCATCCAGGCACTGAGCTGG + Intergenic
1044949135 8:97418457-97418479 GGCCCAGGGCTGCACTCAGTTGG + Intergenic
1045306099 8:100957608-100957630 AGGCCAGGGAGGCACTGAGAGGG + Intergenic
1047320085 8:123770908-123770930 GGCCTAGGGAAGCAGTGATTAGG - Intronic
1048027760 8:130602227-130602249 GGACCAAGGAAGGAATGAGCAGG - Intergenic
1048819621 8:138369001-138369023 GGACCAGAGAAGCTCTGACCTGG + Intronic
1049005117 8:139850091-139850113 TCCCCAGGGGAGCACTGAGAAGG - Intronic
1049349006 8:142154129-142154151 GGCCCCGGAAAGCAAGGAGCTGG - Intergenic
1049480042 8:142818282-142818304 GGCCCAGGGAGCCGCGGAGCCGG + Intergenic
1049585666 8:143431333-143431355 GGCACCGGGAAGCACGGGGCGGG + Intergenic
1049658750 8:143810373-143810395 GGGCCAGGGCAGCACAGAGAAGG - Intronic
1050917685 9:11158228-11158250 GCCCCAGGGGACCACTGAGTAGG - Intergenic
1053514334 9:38717111-38717133 CGCCCAGGGAAGCAAAGAGCAGG + Intergenic
1057283132 9:93726976-93726998 GTCCCAGGGAAGGGCCGAGCTGG + Intergenic
1057905334 9:98978246-98978268 GGCCATGGGAAGCACTAGGCTGG + Intronic
1058648575 9:107153901-107153923 GCTCCAGGTAAGCACAGAGCTGG + Intergenic
1058824491 9:108762504-108762526 GGCCCGGGGAAGCAGGGGGCTGG + Intergenic
1059061272 9:111037822-111037844 GGCCCCGGGGCGCACTGACCTGG + Exonic
1059650674 9:116313236-116313258 GGCACAGGGAACCTCTCAGCAGG - Intronic
1059651833 9:116322455-116322477 CTCCCAGGAAAGCACTGAGGAGG + Intronic
1060417848 9:123445306-123445328 GGCCCAGGGAGGCAGACAGCAGG + Intronic
1060542075 9:124437964-124437986 GGAGCAGGAAAGCACTGGGCAGG + Intergenic
1060656259 9:125374560-125374582 AACCCAGGCAGGCACTGAGCTGG - Intergenic
1060835978 9:126755483-126755505 GGCCCAGGGCCCCACAGAGCAGG - Intergenic
1061622590 9:131821287-131821309 GTCCCAGTGAATCACTGAACAGG + Intergenic
1061880237 9:133565326-133565348 ACCCCAGGGAGGCACTGAGCTGG + Intronic
1062022413 9:134325909-134325931 GGGCCAGGCAAGCGCAGAGCCGG - Intronic
1062075563 9:134586731-134586753 AGCCCTGGGAGGCACTGAGCAGG - Intergenic
1062200075 9:135297939-135297961 GACCCAGGCCAGCACTGCGCTGG - Intergenic
1062387578 9:136319103-136319125 GGGCCAGGGAAGGGCAGAGCGGG - Intergenic
1062390030 9:136330187-136330209 AGCCCCGGGGAGCACTCAGCTGG - Intronic
1062444796 9:136589090-136589112 GTCCCAGGGCAGCTCTGAGCAGG + Intergenic
1062461748 9:136665334-136665356 GGCGCAGGTTAGCACTGAGCTGG - Intronic
1062562852 9:137149469-137149491 GGCCCAGGGAAGTGATGTGCAGG + Intronic
1185608054 X:1378562-1378584 GGCCCTGGGAAGCAGAGAGGTGG - Intronic
1185726416 X:2425646-2425668 CTCTCAGGGCAGCACTGAGCAGG + Intronic
1187341596 X:18425880-18425902 GGCGCAGGGGAGCGCTGAGGAGG - Intronic
1188246464 X:27841047-27841069 AGCCCTGGGAGGCACTAAGCAGG + Intergenic
1190244894 X:48684519-48684541 GGCTCAGGGATTCACTGATCAGG - Intronic
1195365012 X:104116806-104116828 GGCCCAGGGAAGAGCAGAGTTGG - Intronic
1195765510 X:108292728-108292750 GGCTCAGAGAAGCCCTGAGTTGG - Intronic
1195928565 X:110050581-110050603 CAACCAGGGAAGCACTGAGATGG - Intronic
1199990124 X:152982862-152982884 GGCCCAGGGAAGCAGCCAGCAGG + Intergenic
1200033290 X:153312998-153313020 GGCCCAGGGAAGCAGCCAGCAGG + Intergenic
1200148479 X:153939781-153939803 GCAGCAGGGAAGCACTGAGCAGG - Intronic