ID: 1019723225

View in Genome Browser
Species Human (GRCh38)
Location 7:2586360-2586382
Sequence CAGGAAGGTACCCTGTGTCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 185}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019723225_1019723237 13 Left 1019723225 7:2586360-2586382 CCAAGACACAGGGTACCTTCCTG 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1019723237 7:2586396-2586418 GAGGGAGGCCAGGGAATGGCAGG 0: 1
1: 0
2: 9
3: 101
4: 920
1019723225_1019723231 -2 Left 1019723225 7:2586360-2586382 CCAAGACACAGGGTACCTTCCTG 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1019723231 7:2586381-2586403 TGAAAGCCACTCCAGGAGGGAGG 0: 1
1: 0
2: 2
3: 20
4: 210
1019723225_1019723228 -6 Left 1019723225 7:2586360-2586382 CCAAGACACAGGGTACCTTCCTG 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1019723228 7:2586377-2586399 TTCCTGAAAGCCACTCCAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 199
1019723225_1019723242 24 Left 1019723225 7:2586360-2586382 CCAAGACACAGGGTACCTTCCTG 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1019723242 7:2586407-2586429 GGGAATGGCAGGGAATGGCAGGG 0: 1
1: 0
2: 41
3: 949
4: 20687
1019723225_1019723241 23 Left 1019723225 7:2586360-2586382 CCAAGACACAGGGTACCTTCCTG 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1019723241 7:2586406-2586428 AGGGAATGGCAGGGAATGGCAGG 0: 1
1: 0
2: 18
3: 200
4: 3602
1019723225_1019723238 14 Left 1019723225 7:2586360-2586382 CCAAGACACAGGGTACCTTCCTG 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1019723238 7:2586397-2586419 AGGGAGGCCAGGGAATGGCAGGG 0: 1
1: 0
2: 9
3: 102
4: 993
1019723225_1019723234 4 Left 1019723225 7:2586360-2586382 CCAAGACACAGGGTACCTTCCTG 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1019723234 7:2586387-2586409 CCACTCCAGGAGGGAGGCCAGGG 0: 1
1: 0
2: 4
3: 46
4: 454
1019723225_1019723236 9 Left 1019723225 7:2586360-2586382 CCAAGACACAGGGTACCTTCCTG 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1019723236 7:2586392-2586414 CCAGGAGGGAGGCCAGGGAATGG 0: 1
1: 0
2: 14
3: 117
4: 955
1019723225_1019723232 3 Left 1019723225 7:2586360-2586382 CCAAGACACAGGGTACCTTCCTG 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1019723232 7:2586386-2586408 GCCACTCCAGGAGGGAGGCCAGG 0: 1
1: 0
2: 5
3: 45
4: 417
1019723225_1019723229 -5 Left 1019723225 7:2586360-2586382 CCAAGACACAGGGTACCTTCCTG 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1019723229 7:2586378-2586400 TCCTGAAAGCCACTCCAGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 218
1019723225_1019723239 19 Left 1019723225 7:2586360-2586382 CCAAGACACAGGGTACCTTCCTG 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1019723239 7:2586402-2586424 GGCCAGGGAATGGCAGGGAATGG 0: 1
1: 0
2: 39
3: 218
4: 3837
1019723225_1019723226 -9 Left 1019723225 7:2586360-2586382 CCAAGACACAGGGTACCTTCCTG 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1019723226 7:2586374-2586396 ACCTTCCTGAAAGCCACTCCAGG 0: 1
1: 0
2: 1
3: 14
4: 158
1019723225_1019723243 29 Left 1019723225 7:2586360-2586382 CCAAGACACAGGGTACCTTCCTG 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1019723243 7:2586412-2586434 TGGCAGGGAATGGCAGGGCATGG 0: 1
1: 1
2: 38
3: 507
4: 2347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019723225 Original CRISPR CAGGAAGGTACCCTGTGTCT TGG (reversed) Exonic
900278461 1:1849143-1849165 CAGGAAGCTCCCCTGAGCCTTGG - Intronic
901761768 1:11476683-11476705 CAGGGAAGTACCCTGTGGCTGGG + Intergenic
903000374 1:20261231-20261253 CAGGAAGGGAGCCTGTGTGCTGG + Intergenic
905301751 1:36990422-36990444 CAGCAATGTTCCCTGGGTCTGGG + Intronic
905768351 1:40621815-40621837 CAGGAAGGGTCCCTGAGCCTGGG - Exonic
907535223 1:55146999-55147021 CAAGAAGCTACTCTGTATCTGGG - Exonic
912729560 1:112090239-112090261 CAGATAGCTACCCTGTGTCTTGG - Intergenic
915140978 1:153768401-153768423 GAGGAAAGTACCCTGTGTCCAGG - Intronic
915638667 1:157204341-157204363 CAGGGAGGGAATCTGTGTCTGGG + Intergenic
916201186 1:162273060-162273082 CTGGAGGGGACTCTGTGTCTGGG + Intronic
917284576 1:173410879-173410901 CAGGACGGAACCCAGTGTCCTGG + Intergenic
917353470 1:174102398-174102420 CAGGAGGGTAGCTTGAGTCTAGG + Intergenic
919647063 1:200105722-200105744 CAGGAGGATACCTTGAGTCTAGG + Intronic
920127249 1:203703117-203703139 CTGGAAAATACCCTGGGTCTGGG + Intronic
920252994 1:204634576-204634598 CAGGAAGGTGCCATGTGCCACGG + Intronic
923526445 1:234776514-234776536 GAGGACGGTGCCCTGTGCCTGGG - Intergenic
923730243 1:236543276-236543298 CAGGAAGGCCCCCTGTGCCTGGG - Intronic
923995219 1:239486120-239486142 CAGGATGGGAACCTGTGTGTGGG - Intronic
1062932506 10:1362641-1362663 CAGGGAGGCGCCCTGTGCCTGGG - Intronic
1067791527 10:49292046-49292068 CAGGGAGGTACCCAGCTTCTTGG + Intergenic
1067794304 10:49309655-49309677 CAGCAAGGCACCCTGTGGCGTGG + Intronic
1080615630 11:33942539-33942561 CAGGAAGGTCCCCTGAGCCCAGG + Intergenic
1081346549 11:41994481-41994503 CAGGAAGGAACAGTGTGACTGGG + Intergenic
1082950039 11:58804902-58804924 CAAAAAGATACCCTGTCTCTTGG - Intergenic
1086379607 11:86238503-86238525 CAGTAAGGAATCCCGTGTCTGGG + Intergenic
1087854807 11:103078958-103078980 CAGCAAGGTGCCCAATGTCTGGG + Intronic
1088022299 11:105134436-105134458 GAGGTAGGTACCCTGTGTTTGGG - Intergenic
1088106654 11:106213990-106214012 CAGGAAGATCCCCTGAGCCTAGG - Intergenic
1089650336 11:119908707-119908729 CAAGGAGGCACCCTATGTCTAGG + Intergenic
1089880191 11:121766160-121766182 CAGGCAGGAAGCCTGTGTCGAGG - Intergenic
1090275051 11:125413236-125413258 CTGGAGGGAACCCTGTGCCTAGG + Intronic
1090891984 11:130931928-130931950 CAGGAAGGTACCCAAAGGCTTGG - Intergenic
1092147559 12:6224907-6224929 CAGGGAGGTGCCATGTGGCTGGG - Intronic
1092450942 12:8601339-8601361 CAGGCAGGTGCCCTGAGCCTTGG - Intergenic
1094498570 12:31004488-31004510 CAGCAAGGCAACCTGTGGCTGGG + Intergenic
1100356061 12:93831127-93831149 CAGGAGGGTCACCTGAGTCTAGG + Intronic
1103118101 12:118354964-118354986 CAGGAGGGTCCCTTGAGTCTAGG + Intronic
1104716795 12:131020831-131020853 CCCGAAGGCACCCTGTGTCCAGG - Intronic
1104879160 12:132057949-132057971 CATGAAAGCACACTGTGTCTTGG - Intronic
1107566805 13:41613453-41613475 CAGGAGGGTATCCTGAGTATGGG + Intronic
1113128360 13:107006305-107006327 CAGGAAGGTGCCCAGTGGCAGGG + Intergenic
1113440133 13:110322369-110322391 CAGGAGGGAACCGGGTGTCTGGG + Intronic
1115239120 14:31237231-31237253 CAGGAAGTTACCCTGTATGGAGG - Intergenic
1116029142 14:39549812-39549834 CAGGAATGTACCCTGTGAAAGGG + Intergenic
1118732873 14:68681546-68681568 CAGGCAGGTGCCTTTTGTCTGGG + Intronic
1118988809 14:70779678-70779700 AATGAAGGAACCCTGTTTCTAGG - Intronic
1120954933 14:90073480-90073502 CACCAAGGTTCTCTGTGTCTTGG + Intronic
1122237210 14:100338356-100338378 CAGGAAGGTAACCTGAGACCAGG - Intronic
1122410022 14:101521201-101521223 CAGGAAGGTGCCCTGAGCTTCGG - Intergenic
1124997459 15:34737522-34737544 CAGGAAGTAATCCTGTGCCTGGG + Intergenic
1125529576 15:40404008-40404030 CAGGTTGGTACCCTGAGTCCAGG - Intergenic
1126401079 15:48271332-48271354 ATGGAAGGTTTCCTGTGTCTGGG + Intronic
1128103451 15:65025310-65025332 CAGGAAGATCCCTTGAGTCTGGG + Intronic
1129425645 15:75460592-75460614 CAGGAAGGTCACCTGAGCCTGGG + Intergenic
1130877968 15:88030651-88030673 CAGGAAAGTGCCTTGAGTCTTGG - Intronic
1130881549 15:88060092-88060114 AAGGAGGGCACCCTGTGGCTGGG + Intronic
1131729742 15:95267334-95267356 CTTGAAGGCACTCTGTGTCTTGG + Intergenic
1135510769 16:23081244-23081266 CAGGAAATTACTCTGTGTCTGGG + Intronic
1135961735 16:27000449-27000471 CGGGATGGAACCCTGTGCCTGGG + Intergenic
1137483307 16:48870360-48870382 CAGGAAGCAACACTGTGTGTAGG + Intergenic
1138273114 16:55710219-55710241 CAGGCAGGTGCCCTGTTGCTGGG - Intergenic
1141087718 16:81108805-81108827 CTGGAAGGTCCCCTCTGCCTGGG + Intergenic
1142626850 17:1197705-1197727 CAGGCTGGTCCCCTGAGTCTTGG + Intronic
1143483751 17:7241565-7241587 CAGGAAGCAAGCCTGAGTCTTGG + Intronic
1144779097 17:17799012-17799034 GAGGGAGGAACCCTGTGACTGGG - Intronic
1145391454 17:22459121-22459143 CAGCAAGTTCCCCTGTCTCTGGG - Intergenic
1145943356 17:28755749-28755771 CAGCCGGGTACCCTGTGTCCAGG + Intergenic
1146268666 17:31470230-31470252 CAGGAGGGCTTCCTGTGTCTGGG - Intronic
1148098389 17:45070845-45070867 CATCAAGGTACCCTGGGGCTGGG - Intronic
1149379922 17:56083272-56083294 GAGGAAGTTACCCAGTGTGTAGG - Intergenic
1151699746 17:75736932-75736954 CAGGAAGGGACCAAGAGTCTTGG + Intronic
1152409993 17:80118326-80118348 CAGGAAGATGACCTGTGTGTAGG - Intergenic
1152604929 17:81284785-81284807 CGGGAGGGTCCCCAGTGTCTGGG + Intronic
1155634752 18:27939664-27939686 CAGGAAGGAAGTCTTTGTCTAGG - Intergenic
1155777680 18:29788738-29788760 CAGGAAGCTACCATATTTCTGGG + Intergenic
1158309993 18:56147917-56147939 CAGGAAGGTGGCCTGTCCCTAGG + Intergenic
1158832349 18:61294123-61294145 CAGGCAGGTGCACTGTATCTGGG - Intergenic
1162113097 19:8411851-8411873 CAGGAAGGTCTCTTGGGTCTAGG - Intronic
1162422776 19:10575257-10575279 CAGGAAGATCCCTTGAGTCTGGG + Intronic
1165576875 19:36827408-36827430 CAGGAAGGGCCCTTGTGACTGGG - Intronic
1165950174 19:39469916-39469938 CAGGTTGGTGTCCTGTGTCTGGG + Intronic
1166688970 19:44811497-44811519 CTGCAAGGTGCCCCGTGTCTAGG + Intronic
925222780 2:2155669-2155691 CAGAAAGTAACCTTGTGTCTGGG - Intronic
926613408 2:14970688-14970710 AAGGAAGGTACCCTGGGACCAGG + Intergenic
926756481 2:16240467-16240489 CAGGCAGCTTCCCTGAGTCTTGG - Intergenic
927838906 2:26424477-26424499 CAGGCAGATCCCCTGTGGCTGGG - Intronic
930734386 2:54760877-54760899 ATGGAAGTTACTCTGTGTCTGGG + Intronic
933875405 2:86615679-86615701 CAGGAAGGAACACTGTATGTGGG + Intronic
934607417 2:95707350-95707372 CATGATGGTTCCCTGTGTCGGGG - Intergenic
934844718 2:97655431-97655453 CAGGATGGTGCCGTGTGTTTGGG - Intergenic
937457468 2:122054937-122054959 CAGGAAGAGGCCCTGTGTCAAGG - Intergenic
938384637 2:130855556-130855578 CAGGAAGCTCCCCTGAGCCTTGG + Intronic
939304866 2:140398617-140398639 CAGGAAGATTGCCTGAGTCTAGG - Intronic
941897823 2:170647342-170647364 CAGCAAAGTACACTGTGTATAGG + Intronic
942062294 2:172239040-172239062 CAGCCAGGTTCCCTATGTCTAGG + Intergenic
942345588 2:174999444-174999466 CAGCAAGGTACTCTTTGTCATGG + Intronic
942857007 2:180561355-180561377 CATGAAGGTATGCTGGGTCTGGG + Intergenic
947467621 2:230367383-230367405 CAGGAGGGTAGCCTGAGCCTAGG - Intronic
948100641 2:235370102-235370124 CAGGAAGGTCCCTGGTCTCTGGG - Intergenic
948664656 2:239527264-239527286 CATGAAGGTGCCATGTGTCCTGG + Intergenic
948866028 2:240775288-240775310 CAGGGAGGTAAACTGAGTCTTGG - Intronic
948991016 2:241554053-241554075 GAGGAAGGTGCCCTGCTTCTGGG + Intergenic
1168865282 20:1080932-1080954 CAGGCAGGCACCCTCTGTCTTGG - Intergenic
1169489233 20:6057148-6057170 CAGGAAATTTCCCAGTGTCTTGG - Intergenic
1170004056 20:11646699-11646721 CAGAGAGGGACCCTGTGCCTGGG - Intergenic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1171180977 20:23090210-23090232 TAGGAAACTACCCTGTGTCTTGG - Intergenic
1171292950 20:23993112-23993134 CAGGAAGGTCCCTTGAGTCCGGG + Intergenic
1171490375 20:25512614-25512636 CAGGAGAGAACCCTGTGTCCAGG + Intronic
1173544374 20:43882641-43882663 CAGGAAGGTTGCTTGTGTCCAGG + Intergenic
1174453955 20:50636705-50636727 CAGGACAGTCCCCAGTGTCTGGG - Intronic
1175874334 20:62222248-62222270 CAGGAAAGCTCCCTCTGTCTGGG - Intergenic
1176098747 20:63355660-63355682 CAGGCAGGGACACTGTGTCCAGG + Intronic
1180824009 22:18850826-18850848 CAGGAAGGTCCCTTGAGTCCGGG + Intronic
1181188729 22:21123722-21123744 CAGGAAGGTCCCTTGTGTCCAGG - Intergenic
1181210470 22:21286771-21286793 CAGGAAGGTCCCTTGTGTCCGGG + Intergenic
1181399039 22:22640120-22640142 CAGGAAGGTCCCTTGAGTCCGGG - Intergenic
1181501769 22:23319466-23319488 CAGGAAGGTCCCTTGTGTCCGGG - Intergenic
1181706998 22:24654799-24654821 CAGGAAGGTCCCTTGAGTCCGGG - Intergenic
1183371603 22:37435637-37435659 CAGGAGGGGAGCCTGTGTCAGGG + Intergenic
1203216476 22_KI270731v1_random:8659-8681 CAGGAAGGTCCCTTGAGTCCGGG - Intergenic
1203274150 22_KI270734v1_random:76729-76751 CAGGAAGGTCCCTTGTGTCCGGG + Intergenic
950672513 3:14535776-14535798 CAGGAAGGTACCCAGAGGGTAGG - Intronic
952989181 3:38816649-38816671 AAGGAAGGTACCATGTGAATGGG - Intergenic
953970256 3:47341828-47341850 CAGGAAGGTAACTTGAGCCTAGG + Intronic
955022542 3:55135015-55135037 CAGGAAGAGACCCTGTCTATAGG - Intergenic
962084524 3:132176057-132176079 CAGGAAGACACTCTGTGTGTGGG + Intronic
962739349 3:138351468-138351490 CTGGCAGGTACCCATTGTCTAGG + Intronic
963066880 3:141271291-141271313 CAGGGAGGTAGCCTGGGGCTGGG - Intronic
968461795 4:729980-730002 CACGTAGGGACCCTGCGTCTGGG - Intronic
968469511 4:772899-772921 CATGAAGGTGCCCTGGGTCAGGG + Intergenic
969525935 4:7704118-7704140 CTGGAAAGCTCCCTGTGTCTGGG - Intronic
972436741 4:39042662-39042684 GAGGAAGGAATCCAGTGTCTGGG + Intergenic
972780459 4:42282837-42282859 CAGGCAGGCACCCTGTCACTGGG - Intergenic
973850253 4:54954874-54954896 CAGGAAGCTATCATGTGTCAGGG - Intergenic
976536668 4:86225315-86225337 CATGTAGGCACCCTGTGTCTGGG - Intronic
976979733 4:91212502-91212524 CAGGAATGCCACCTGTGTCTGGG + Intronic
978830819 4:113082364-113082386 CAGGAAGATACCTTGTGCCCAGG - Intronic
978844947 4:113262317-113262339 CAGGAGGATAGCCTGTGCCTAGG - Intronic
980188582 4:129494482-129494504 TAGGAAGATACCCTGTGTGATGG + Intergenic
984757452 4:183337587-183337609 CAGGCAGCTCGCCTGTGTCTGGG + Intergenic
984901430 4:184590114-184590136 CAGGAAGATCGCCTGAGTCTGGG + Intergenic
985778047 5:1855459-1855481 CAGGATGGTCCCCGGTGTCCTGG - Intergenic
986857793 5:11891393-11891415 CAGCAAGTTACCCAGTGTCAAGG - Intronic
987563463 5:19554688-19554710 CAGGAAGGGAACCTGTGTTCTGG - Intronic
991584389 5:68187508-68187530 CAGAGATGTACCCTGTGGCTTGG - Intergenic
993500423 5:88660619-88660641 GAGGAAGGTGCCCTGTGGCAGGG + Intergenic
995043543 5:107617950-107617972 CAGGATGGTCTCCTGTGCCTGGG - Intronic
997167026 5:131672182-131672204 CAGGAAAGTAACCTTTGTCTGGG + Exonic
1000933236 5:167278209-167278231 CAGGAAGATCGCTTGTGTCTGGG + Intergenic
1001403714 5:171461356-171461378 CAGGAAGGGCCCCTGAATCTGGG + Intergenic
1002367799 5:178726809-178726831 CATGAAATTGCCCTGTGTCTGGG - Intronic
1002452100 5:179325069-179325091 CAGGAGGGGACCATTTGTCTTGG - Intronic
1007384727 6:41512936-41512958 CCAGAGGGTAGCCTGTGTCTTGG - Intergenic
1007765188 6:44155698-44155720 CAGGAAGGGCCCCTGTGCCCAGG + Intergenic
1010884427 6:81218487-81218509 GAGGTAGGTTCCCAGTGTCTTGG - Intergenic
1011754331 6:90483570-90483592 CTGGATGGGACCCTGTGCCTCGG + Intergenic
1013327001 6:109056309-109056331 CAGGAGGATAACCTGTGCCTAGG + Intronic
1014261861 6:119227694-119227716 CAGGAAGATAGCTTGAGTCTAGG - Intronic
1015791541 6:136968855-136968877 CAGAAAGGTACCCGCTGGCTAGG - Intergenic
1016843229 6:148544716-148544738 CAGGAAGGTCTCCTGTGCCCGGG + Exonic
1017602417 6:156098153-156098175 GAGGAATCAACCCTGTGTCTTGG + Intergenic
1018054838 6:160042803-160042825 CAAGAAGCCAGCCTGTGTCTTGG - Intronic
1018722989 6:166588080-166588102 AACGAAGGTCCCCTGTTTCTTGG - Intronic
1019723225 7:2586360-2586382 CAGGAAGGTACCCTGTGTCTTGG - Exonic
1020530247 7:9324032-9324054 AAGTAAGGTCACCTGTGTCTTGG - Intergenic
1022517510 7:30985395-30985417 CAGGTAGCTCCCCTGTCTCTAGG + Intronic
1023009056 7:35908959-35908981 CAGAAAAGTTCCCTGTGTCTTGG + Intergenic
1023784407 7:43692005-43692027 CTGGAAGTTACCCTGTAACTTGG + Intronic
1024160707 7:46672421-46672443 CAGAAAGACACCCTGTGTCAAGG - Intergenic
1025085823 7:56022549-56022571 CTGGAAGCTACCCTATGGCTTGG + Intronic
1031226434 7:119043458-119043480 CCAGAAGGTACGCTGTGACTAGG - Intergenic
1031252355 7:119402314-119402336 AAGCCAGCTACCCTGTGTCTTGG - Intergenic
1033529722 7:142249503-142249525 CAGGAAGGTCGCCTGAGCCTGGG - Intergenic
1034331500 7:150287115-150287137 CAACAAGGTACACTGTCTCTAGG - Intronic
1034666543 7:152822746-152822768 CAACAAGGTACACTGTCTCTAGG + Intronic
1034900218 7:154903587-154903609 GAGGATGGTCCCATGTGTCTGGG + Intergenic
1035040944 7:155926723-155926745 CTGGCAGGTCCTCTGTGTCTGGG + Intergenic
1035056872 7:156041631-156041653 GAGGAGCGTGCCCTGTGTCTGGG - Intergenic
1035430376 7:158815581-158815603 CTGGATGCTGCCCTGTGTCTAGG + Intronic
1036034399 8:5003531-5003553 CAGGGAGGGACCCTGTGTGCTGG + Intergenic
1037745661 8:21642199-21642221 CGAGAAGGGACCCTGGGTCTTGG - Intergenic
1038794469 8:30697533-30697555 CAGGAGGATAACTTGTGTCTGGG + Intronic
1039919683 8:41884501-41884523 CAGGAAGCTTTCCTGAGTCTGGG - Intronic
1040874497 8:52136932-52136954 CAGGAATGGACTCTGTGTGTGGG - Intronic
1043326195 8:79054882-79054904 GAGCAAGGTAACCTGAGTCTGGG - Intergenic
1046644296 8:116767992-116768014 CAGGAGGGTTGCCTGAGTCTAGG + Intronic
1047438612 8:124856934-124856956 CTGGGAGGTAGGCTGTGTCTGGG + Intergenic
1048713289 8:137238214-137238236 GAGGCAGGTACCCTGCATCTAGG - Intergenic
1049750808 8:144282729-144282751 AAGAAGGGTACTCTGTGTCTGGG - Intronic
1050857273 9:10375388-10375410 CATGAAGGTACCTTGTAACTTGG - Intronic
1053456198 9:38234746-38234768 CAGGAGGGTCCCCTGGGACTGGG - Intergenic
1057046092 9:91887113-91887135 CACGAATGTACCCTTTGCCTAGG - Intronic
1059034626 9:110740619-110740641 CAGGAAGTTACCCTGTCACTAGG + Intronic
1059115800 9:111599328-111599350 CAGGAAGCTACCGGGTGTCCCGG + Intronic
1059412952 9:114144859-114144881 CAGGAAGCCACCCAGAGTCTTGG - Intergenic
1062010343 9:134263646-134263668 GAGGAAGGGACCCTGGGCCTAGG + Intergenic
1185835165 X:3339165-3339187 CAGGAAGGCACCCAAAGTCTGGG + Intronic
1187935772 X:24334507-24334529 CAGGAAGTTCCCCTGAGCCTTGG + Intergenic
1190365995 X:49695530-49695552 CAGGAATGTGCCCTGTGTCATGG + Intronic
1193498036 X:82238059-82238081 CAGGAAAGTCCTCTGTGCCTGGG - Intergenic
1194900014 X:99498177-99498199 CAGGTAGGGCCCCTGTGGCTTGG + Intergenic
1196234225 X:113260973-113260995 CAGGCAGGGCCCCTCTGTCTTGG - Intergenic