ID: 1019724637

View in Genome Browser
Species Human (GRCh38)
Location 7:2594679-2594701
Sequence CAGGAAGTCCCGGCCTGCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 115}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019724634_1019724637 -6 Left 1019724634 7:2594662-2594684 CCCAGAGCAGGAGACAACAGGAA 0: 1
1: 0
2: 2
3: 26
4: 360
Right 1019724637 7:2594679-2594701 CAGGAAGTCCCGGCCTGCGATGG 0: 1
1: 0
2: 1
3: 6
4: 115
1019724635_1019724637 -7 Left 1019724635 7:2594663-2594685 CCAGAGCAGGAGACAACAGGAAG 0: 1
1: 0
2: 1
3: 36
4: 331
Right 1019724637 7:2594679-2594701 CAGGAAGTCCCGGCCTGCGATGG 0: 1
1: 0
2: 1
3: 6
4: 115
1019724629_1019724637 17 Left 1019724629 7:2594639-2594661 CCACGGCCTCGTGGGGCTTCCAG 0: 1
1: 0
2: 1
3: 25
4: 228
Right 1019724637 7:2594679-2594701 CAGGAAGTCCCGGCCTGCGATGG 0: 1
1: 0
2: 1
3: 6
4: 115
1019724632_1019724637 -2 Left 1019724632 7:2594658-2594680 CCAGCCCAGAGCAGGAGACAACA 0: 1
1: 0
2: 2
3: 20
4: 261
Right 1019724637 7:2594679-2594701 CAGGAAGTCCCGGCCTGCGATGG 0: 1
1: 0
2: 1
3: 6
4: 115
1019724628_1019724637 23 Left 1019724628 7:2594633-2594655 CCTCAGCCACGGCCTCGTGGGGC 0: 1
1: 0
2: 3
3: 27
4: 275
Right 1019724637 7:2594679-2594701 CAGGAAGTCCCGGCCTGCGATGG 0: 1
1: 0
2: 1
3: 6
4: 115
1019724630_1019724637 11 Left 1019724630 7:2594645-2594667 CCTCGTGGGGCTTCCAGCCCAGA 0: 1
1: 0
2: 3
3: 21
4: 207
Right 1019724637 7:2594679-2594701 CAGGAAGTCCCGGCCTGCGATGG 0: 1
1: 0
2: 1
3: 6
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019724637 Original CRISPR CAGGAAGTCCCGGCCTGCGA TGG Intronic
900099119 1:953584-953606 CAGGCAGTCCCTGCCTGCCCGGG - Intronic
900619724 1:3581203-3581225 CAGGAGGACCCGGCCTGGGCTGG + Intronic
903439790 1:23379098-23379120 CAGGAAGTCACAGCCTGGCAGGG - Intergenic
903976634 1:27154582-27154604 CTGGAACTCCGGGCCTGGGAAGG + Exonic
904254311 1:29244921-29244943 GATGAAGTCCAGGCCTGGGAGGG + Intronic
904417500 1:30372316-30372338 CAAGAAGTCCCTGCCTTCAAGGG + Intergenic
905249467 1:36638708-36638730 CAGAAAGTCCAGGCCTGCAGGGG - Intergenic
915559430 1:156677685-156677707 CAGGACGTTCCAGCCTGGGAGGG + Intergenic
917852661 1:179078710-179078732 AAGCAAGTCTCGGCCTGGGACGG - Intergenic
920920722 1:210295239-210295261 CAGGAAGTCCCCGGCTGGGCTGG + Intergenic
923479783 1:234373437-234373459 CAGGAAGTCCCGCCCCTCTATGG + Intronic
1068657074 10:59586885-59586907 CATGAGGTCCCTGCCTGTGAGGG + Intergenic
1069604026 10:69728801-69728823 CATGAAGCCCCAGCCTGCCAAGG - Intergenic
1070923939 10:80205672-80205694 CAGGAAGTCTCGGGCTCCGGAGG + Intergenic
1075742426 10:124704027-124704049 CAGGCAGTCCCACCCTGAGAAGG + Intronic
1075912765 10:126140004-126140026 CAGGGAAGCCCGGCCTGGGAAGG - Intronic
1083634852 11:64115065-64115087 CCTGAAGTCCCAGCCTGGGAGGG - Intronic
1084561816 11:69909818-69909840 CAGGAAGACCTGGCCAGCCATGG + Intergenic
1096608779 12:52787538-52787560 CAGGAAGGCCAGGCCTGCTCTGG + Intergenic
1101870691 12:108562942-108562964 CACGAAGTCGCGGCCAGCGGCGG - Intronic
1103536740 12:121638643-121638665 CAGGAATTCCCTGCCTGCTGGGG + Intronic
1105502967 13:20988637-20988659 CAGGGAGTCCCGGCGGGCCAGGG + Exonic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1109346988 13:61126091-61126113 CAGGGCCTCCAGGCCTGCGATGG + Intergenic
1113565502 13:111317392-111317414 CAGGAAAGCCAGGCCTGAGATGG + Intronic
1113612903 13:111660439-111660461 CAGGGAGTCCCAGCCTGCCCTGG - Intronic
1118607790 14:67515761-67515783 CAGGTAGCCCGGGCCTGCAATGG - Intronic
1121247707 14:92474364-92474386 CAGCAGGCCCCTGCCTGCGAGGG + Intronic
1122846501 14:104502957-104502979 CAGAAAGTCCAGGCCTCAGAGGG + Intronic
1202835831 14_GL000009v2_random:76828-76850 GAGGAAGTCCAGTCCTGAGATGG - Intergenic
1123668474 15:22629176-22629198 CAGGAAGACCTGGACTGAGAAGG + Intergenic
1124524453 15:30435637-30435659 CAGGAAGACCTGGACTGAGAAGG + Intergenic
1124534211 15:30530586-30530608 CAGGAAGACCTGGACTGAGAAGG - Intergenic
1124764437 15:32477025-32477047 CAGGAAGACCTGGACTGAGAAGG + Intergenic
1124774197 15:32572073-32572095 CAGGAAGACCTGGACTGAGAAGG - Intergenic
1128342902 15:66835084-66835106 CGGGTAGTCCAGGCCTGGGATGG + Intergenic
1130910339 15:88266345-88266367 CAGGAACCTCCAGCCTGCGAGGG + Intergenic
1132152540 15:99472962-99472984 CAGGGAGTCCAGGCCTTGGAAGG - Intergenic
1133221414 16:4320658-4320680 TAGCAAGTCCCGGCCTGCCTGGG + Intronic
1133224570 16:4334787-4334809 CTGGAAGTCCTGGGGTGCGAGGG - Exonic
1134502036 16:14776876-14776898 CAGGAAGCCCCTGCAGGCGAGGG + Intronic
1134578525 16:15352017-15352039 CAGGAAGCCCCTGCAGGCGAGGG - Intergenic
1134724063 16:16405527-16405549 CAGGAAGCCCCTGCAGGCGAGGG + Intergenic
1138578497 16:57923982-57924004 CAGGAAGTCCAAGTCTGCCATGG + Intronic
1139545649 16:67648395-67648417 CAGGAAGTCCCGCGCCGCGCCGG + Exonic
1142177352 16:88651228-88651250 CAGGAACTCCCCGCCTGGGCTGG - Intergenic
1143118689 17:4594575-4594597 CAGGAAGTTCCGGGCTCTGAGGG - Intronic
1145767899 17:27471982-27472004 CTGGCAGTCCCGGCCTGCTTGGG + Intronic
1146546918 17:33748030-33748052 GAGGAAGTCAAGGCTTGCGAAGG + Intronic
1151892554 17:76959173-76959195 CAGGAAGCCTCGGCCTGCGCTGG + Intergenic
1152361569 17:79835439-79835461 CAGAAACTCCCGGCATGCGGTGG - Intronic
1153610244 18:6877442-6877464 CAGGAAGCCCCAGCCCACGACGG - Intronic
1153926471 18:9839330-9839352 CATGAAGCCCCGTCCTGCTAAGG + Intronic
1155649598 18:28125230-28125252 CAGGCAGTCCCGGCTTACAATGG - Intronic
1159773951 18:72582952-72582974 CAAGAAGACCCTGCCTGGGAAGG - Intronic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1160990557 19:1858729-1858751 CAGGAGGTCCTGGCCTGGGTTGG - Intronic
1165579653 19:36850999-36851021 CAGGAACTCCCGACCTGTGTGGG + Intronic
1168561675 19:57389842-57389864 GCGGAAGTCCCGCCCTCCGACGG - Intronic
1202636806 1_KI270706v1_random:50535-50557 GAGGAAGTCCAGTCCTGAGATGG + Intergenic
925994242 2:9278928-9278950 CAGGATGCCCCTGCCTGCCAGGG - Intronic
932781700 2:74562549-74562571 CAGGAAGTCCCTCCCTACCAGGG - Intronic
934491179 2:94762829-94762851 GAGGAAGTCCAGTCCTGAGATGG + Intergenic
935191968 2:100785237-100785259 AGGGCAGACCCGGCCTGCGATGG - Intergenic
936081265 2:109434188-109434210 CAGGAAGGCGCAGCCTGAGATGG + Intronic
938330076 2:130442855-130442877 GAGGAAGTCCAGTCCTGAGATGG + Intergenic
938359869 2:130678648-130678670 GAGGAAGTCCAGTCCTGAGATGG - Intergenic
943369779 2:187002397-187002419 CAGGAAGTGATGGCCTGCGGTGG - Intergenic
948119446 2:235518048-235518070 CAGGCAGGCCCAGCCTCCGAAGG + Intronic
948368750 2:237474625-237474647 CAGGAACTCCAGGCCTGCAGAGG - Intergenic
1170573088 20:17643354-17643376 TAGGAAGTCCCAGCCTGGGGTGG + Intronic
1171880819 20:30616499-30616521 CAGAAAGTCCAGTCCTGGGATGG - Intergenic
1172042013 20:32052509-32052531 CGGGAATACCCGGCCCGCGAGGG + Intronic
1173023492 20:39287204-39287226 CTGGACCTCCAGGCCTGCGATGG - Intergenic
1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG + Exonic
1180681316 22:17628832-17628854 CAGGAAGTCCCGCCCTGTCCCGG + Intergenic
1182050826 22:27311352-27311374 CAGGAGTTCCCGGCCTGTGAAGG + Intergenic
1182222915 22:28772926-28772948 CGGGAAGGCCCGGCCGGGGAAGG - Exonic
1184129932 22:42511725-42511747 CAGGAAGGCCCTGCCTGCCTTGG - Exonic
1184347764 22:43923943-43923965 CAGGAAGCCGCAGCCCGCGAAGG - Exonic
1184370893 22:44081294-44081316 CAGGAGGACCCGGCCTGCTTCGG - Intronic
961618692 3:128205832-128205854 CAGGAGGCCCTGGCCTGCTAAGG + Intronic
962249764 3:133828804-133828826 CAGGAGCCCCCGGCCAGCGAGGG - Exonic
967878026 3:194280025-194280047 GTGGAAGTCCCAGCCTTCGAGGG + Intergenic
969112968 4:4855084-4855106 AAGGAAGCCCGGGCCTGGGACGG + Intergenic
973366609 4:49213869-49213891 GAGGAAGTCCAGTCCTGAGATGG + Intergenic
973393994 4:49578530-49578552 GAGGAAGTCCAGTCCTGAGATGG - Intergenic
977586289 4:98779040-98779062 TAGGAAGTCCAGCCCTGGGAAGG + Intergenic
1202764123 4_GL000008v2_random:136406-136428 GAGGAAGTCCAGTCCTGAGATGG + Intergenic
986306951 5:6523128-6523150 CAGGAAGTGCTGCCCTGAGAGGG - Intergenic
990419822 5:55620478-55620500 CATAAAGTACAGGCCTGCGATGG - Intergenic
993754261 5:91708054-91708076 AAGGAAGTCCTGGCCGGGGATGG - Intergenic
995828665 5:116329713-116329735 CTGGACGTCCAGGCCTGTGATGG + Intronic
1002440413 5:179261697-179261719 CAGGAAGGCTCTGCCTGCAAAGG + Intronic
1006115907 6:31776126-31776148 CAGGAAGTCCTGGGCTGCATTGG + Exonic
1015965510 6:138692842-138692864 AAGGAAGTCCCGGGCAGCGGCGG + Intergenic
1017910112 6:158785279-158785301 CAGGATGACCCGGCCTGGGCAGG - Intronic
1019427702 7:985157-985179 CGGGAAGGGCCGGCCTGCGAGGG - Exonic
1019527638 7:1487844-1487866 CAGGAGATCCTGGCCTTCGAGGG - Exonic
1019724637 7:2594679-2594701 CAGGAAGTCCCGGCCTGCGATGG + Intronic
1025738343 7:64174583-64174605 GAGAAAGTCCAGTCCTGCGATGG + Intronic
1028173784 7:87629123-87629145 CACAAAGTCCAGGGCTGCGACGG - Intronic
1029111426 7:98214734-98214756 CAGGAAGCCCTGGGCTGCGCTGG - Exonic
1032057811 7:128697639-128697661 CAGGAGGTCCCGGGCTGCGACGG - Intergenic
1033284234 7:140026810-140026832 CAGCAAGACCCAGCCTGCCATGG + Intronic
1034885966 7:154799101-154799123 CAGGGAGACCCGGCCTGCTTAGG + Intronic
1040105218 8:43537821-43537843 CAGAAAGTCCAGCCCTGAGACGG + Intergenic
1049305251 8:141899470-141899492 CAGGGGGTCCCGGCCCGGGAGGG - Intergenic
1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG + Intergenic
1049726772 8:144150193-144150215 CAGGAACTCTGGGCCTGGGATGG + Intronic
1051552228 9:18342891-18342913 CAGGAAGTACCGACATGCTAGGG - Intergenic
1052880677 9:33599491-33599513 CAGAAAGTCCAGTCCTGAGATGG + Intergenic
1053916490 9:42948410-42948432 CAGGAAGTCTGGTCCTGGGATGG + Intergenic
1055985935 9:82056592-82056614 CAGAATGTCCAGCCCTGCGATGG + Intergenic
1056585407 9:87924541-87924563 CAGAAAGTCCAGTCCTGCGATGG - Intergenic
1056611473 9:88128399-88128421 CAGAAAGTCCAGTCCTGCGATGG + Intergenic
1056922364 9:90801911-90801933 CAGAAAGTCCCGGCCGGGTAGGG - Intronic
1058403239 9:104641337-104641359 CTGGAAGTCCTGGCCGGCCAGGG + Intergenic
1060517037 9:124272344-124272366 CATGAAGTCCCTGCCTGCACAGG + Intronic
1203544870 Un_KI270743v1:121279-121301 GAGGAAGTCCAGTCCTGAGATGG + Intergenic
1185446645 X:261355-261377 CAGGAGGTGCCGGCCTTGGAAGG - Intergenic
1200115296 X:153767363-153767385 CAGGAGGTCCCGGCCGGGCAAGG - Exonic
1200951444 Y:8903035-8903057 CAGGAGGCCCCGGCCCGCAACGG - Intergenic