ID: 1019725684

View in Genome Browser
Species Human (GRCh38)
Location 7:2601239-2601261
Sequence AGTGAGAGGCAGAATTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 417}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019725684_1019725690 10 Left 1019725684 7:2601239-2601261 CCATCCTAATTCTGCCTCTCACT 0: 1
1: 0
2: 2
3: 40
4: 417
Right 1019725690 7:2601272-2601294 TTACAAAGGCGTTTGTTTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 87
1019725684_1019725687 -4 Left 1019725684 7:2601239-2601261 CCATCCTAATTCTGCCTCTCACT 0: 1
1: 0
2: 2
3: 40
4: 417
Right 1019725687 7:2601258-2601280 CACTTTCGTCCTCCTTACAAAGG 0: 1
1: 0
2: 0
3: 14
4: 203
1019725684_1019725691 11 Left 1019725684 7:2601239-2601261 CCATCCTAATTCTGCCTCTCACT 0: 1
1: 0
2: 2
3: 40
4: 417
Right 1019725691 7:2601273-2601295 TACAAAGGCGTTTGTTTGCTGGG 0: 1
1: 0
2: 1
3: 8
4: 147
1019725684_1019725696 30 Left 1019725684 7:2601239-2601261 CCATCCTAATTCTGCCTCTCACT 0: 1
1: 0
2: 2
3: 40
4: 417
Right 1019725696 7:2601292-2601314 TGGGTCCCGGCAGCTCGGGAGGG 0: 1
1: 0
2: 1
3: 8
4: 150
1019725684_1019725695 29 Left 1019725684 7:2601239-2601261 CCATCCTAATTCTGCCTCTCACT 0: 1
1: 0
2: 2
3: 40
4: 417
Right 1019725695 7:2601291-2601313 CTGGGTCCCGGCAGCTCGGGAGG 0: 1
1: 0
2: 2
3: 24
4: 315
1019725684_1019725692 17 Left 1019725684 7:2601239-2601261 CCATCCTAATTCTGCCTCTCACT 0: 1
1: 0
2: 2
3: 40
4: 417
Right 1019725692 7:2601279-2601301 GGCGTTTGTTTGCTGGGTCCCGG 0: 1
1: 0
2: 0
3: 18
4: 96
1019725684_1019725694 26 Left 1019725684 7:2601239-2601261 CCATCCTAATTCTGCCTCTCACT 0: 1
1: 0
2: 2
3: 40
4: 417
Right 1019725694 7:2601288-2601310 TTGCTGGGTCCCGGCAGCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 179
1019725684_1019725693 25 Left 1019725684 7:2601239-2601261 CCATCCTAATTCTGCCTCTCACT 0: 1
1: 0
2: 2
3: 40
4: 417
Right 1019725693 7:2601287-2601309 TTTGCTGGGTCCCGGCAGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019725684 Original CRISPR AGTGAGAGGCAGAATTAGGA TGG (reversed) Intronic
900695596 1:4007844-4007866 AGGGAGAGACAGAAATAGGGAGG + Intergenic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
901715674 1:11151842-11151864 AGAGGGAGGCTGAGTTAGGAGGG - Intronic
902196358 1:14801477-14801499 ACTGAGAGGGTGATTTAGGATGG + Intronic
902427903 1:16339152-16339174 AGTAGGAGGCAGAAGCAGGAAGG - Intronic
903106999 1:21089864-21089886 AATGGCAGGCAGAATTAGGAAGG - Intronic
903335228 1:22620069-22620091 AGTGAGAGAGACAATTAGGAGGG + Intergenic
903548645 1:24142658-24142680 AGTGAGAGGCAGAGGAAGGATGG + Intronic
905364989 1:37446059-37446081 AGTGAGAGAGAGAATGAGCAGGG - Intergenic
906013955 1:42556223-42556245 AGAGAGGGGCAGAAGGAGGAGGG + Exonic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906236721 1:44215840-44215862 AGTGAGAGGCAGAGCTAGATTGG + Intronic
906564708 1:46790722-46790744 AGTCAGAGGGAGAATGAGCAGGG - Intronic
906956233 1:50377158-50377180 AGGCAGAGGCAGAATTATGAAGG + Intergenic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
908605089 1:65790068-65790090 AGTGAGATGGAAAATTGGGATGG - Intergenic
909468325 1:75999688-75999710 AGAGAATGGCAGAAATAGGAAGG - Intergenic
910262674 1:85307208-85307230 ACTGAGAGGCTGAGTAAGGATGG + Intergenic
911410323 1:97496534-97496556 AGTGAGAATAAGAATTAGAATGG - Intronic
911541862 1:99165992-99166014 GGGCACAGGCAGAATTAGGAGGG - Intergenic
912424306 1:109573024-109573046 GTTGAGAGTCAGAATTGGGAGGG + Intronic
912544781 1:110442893-110442915 AGTGAGTGGCTGGACTAGGATGG + Intergenic
912730002 1:112093778-112093800 AGAGAGAGACAGAATGAGGGAGG + Intergenic
913515501 1:119602190-119602212 AGTAAGAGGCAGTATAAGGCCGG + Intergenic
914344632 1:146788053-146788075 AGTTAGAGTCAGAATGAGGTAGG - Intergenic
914834213 1:151193970-151193992 AGGGAGAGGCTAAATTATGAAGG - Intronic
915611476 1:156996806-156996828 AGTAAGTGGCAGAATCAGGATGG - Intronic
915927517 1:160034548-160034570 AGTGAAAGGGGGAATTAAGAAGG - Intergenic
917844797 1:179011565-179011587 ACTCAGAGGCTGAAGTAGGAGGG + Intergenic
918214823 1:182384356-182384378 AGTGGGATGAAGAACTAGGAGGG + Exonic
918248961 1:182684777-182684799 AGGGAGAGGCAGAGTTCAGAGGG + Intergenic
918656734 1:187036081-187036103 AAGGAGAGGCAGAATTAGTTTGG - Intergenic
918703575 1:187635477-187635499 AGTGACAGGGAGAAAGAGGATGG - Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919531300 1:198724667-198724689 AGAGAGAGAGAGAATCAGGATGG - Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920429541 1:205908308-205908330 AGAGAGAGAGAGAATTAGAAAGG - Intergenic
922503252 1:226111680-226111702 AGTGAAAGGTAGAATGGGGAAGG - Intergenic
922555555 1:226529710-226529732 GATGAGTGGCAGAAGTAGGATGG + Intergenic
923932466 1:238717784-238717806 AGTGAGAGGGAGAGGAAGGAAGG - Intergenic
924260480 1:242225076-242225098 AGTGAGAGGCAGGATTCAGAGGG - Intronic
1063539444 10:6917610-6917632 AGTGAGAGGCAGAGTTCGCTGGG + Intergenic
1064546880 10:16459617-16459639 AGTTTGAGTCATAATTAGGAGGG - Intronic
1064814106 10:19236545-19236567 AGTGAGAGGCAGAGGAATGAGGG - Intronic
1065674749 10:28162838-28162860 AGTGAGAGAAAGAATATGGAGGG - Intronic
1065936715 10:30526831-30526853 TGTGAGAGGCAATATTAGCAAGG - Intergenic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067474580 10:46557112-46557134 TGTGAGAGGCGGAGCTAGGATGG - Intergenic
1067894148 10:50161604-50161626 AGTGAAAAACAGAAGTAGGATGG - Intergenic
1067954697 10:50778657-50778679 AGTGAAAAACAGAAGTAGGATGG + Intronic
1069241057 10:66139677-66139699 AATGAGAGGGACAATTATGATGG - Intronic
1070394928 10:76003637-76003659 CAGGAGAGGCAGCATTAGGAAGG + Intronic
1070522270 10:77264383-77264405 AGTGTGAGGCTGAAGGAGGAAGG - Intronic
1071123607 10:82309224-82309246 ATTCATAGGCAAAATTAGGAGGG - Intronic
1071802236 10:89076649-89076671 AATCAGAGGAAGAATAAGGAAGG + Intergenic
1072252753 10:93594581-93594603 ATTAATAAGCAGAATTAGGATGG - Intronic
1072873060 10:99141176-99141198 AATGAGAGGGAGAATTGGGTAGG - Intronic
1073084761 10:100881027-100881049 AGTGAGTGGCAGAGCCAGGATGG + Intergenic
1074232697 10:111553707-111553729 AGTGAGAGGCAGGATTGAGCAGG - Intergenic
1074672253 10:115805105-115805127 ATTAGGAGGTAGAATTAGGAGGG - Intronic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075843888 10:125529286-125529308 AGTGAGAGGGTGGACTAGGAAGG - Intergenic
1076098497 10:127753930-127753952 AGAGAGGGGCAGAATTATCAAGG + Intergenic
1076275777 10:129197210-129197232 AGTTAGAGGCAGAGTTGGGCTGG - Intergenic
1076547195 10:131253313-131253335 AGTGAGGGGCAGAGTGAGGGCGG - Intronic
1077507769 11:2940098-2940120 AGACAGAGGCAGAAATCGGAAGG + Intergenic
1078065836 11:8079020-8079042 AGTGAGGTGCAGAAGTAAGATGG - Intronic
1078106663 11:8362086-8362108 AGTCAGAGCCAGAGTTTGGAAGG - Intergenic
1078907501 11:15701542-15701564 AGTGAAAGGCAGAAATTGGGAGG - Intergenic
1079194773 11:18315855-18315877 AGTGGGAGGCAGACATGGGAAGG - Intronic
1079329491 11:19521922-19521944 TCTGAGAGGCAGAATTTGGCAGG + Intronic
1079743058 11:24087697-24087719 AGTGAGAAGCAGCATATGGATGG + Intergenic
1080187696 11:29510086-29510108 AGTGAGAGACATAAGAAGGAAGG - Intergenic
1080357712 11:31470968-31470990 AGTGTGAGGCATGATAAGGAGGG + Intronic
1080826637 11:35854124-35854146 AGTGAGTGGGATAGTTAGGATGG - Intergenic
1083058242 11:59843776-59843798 AGTCAGAGGCAGCATTGGGGTGG + Intronic
1083808452 11:65088629-65088651 AGTGAGTGGCAGGAGTGGGAGGG - Exonic
1083935291 11:65866844-65866866 TGTGAGGGGCAGAATGAGAAAGG - Exonic
1084065484 11:66701503-66701525 AGTGAGAGGCAGGTTTTGTAGGG - Intronic
1085050417 11:73377314-73377336 AGTAAGAGGCAGGAGGAGGAGGG + Intronic
1085622207 11:78045989-78046011 AGTTAGAGGCAGCCTCAGGAGGG + Intronic
1085704051 11:78770156-78770178 TGTGAGTGGGAGAATCAGGAAGG + Intronic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1086135935 11:83444028-83444050 TGTGAGAGACAGAAGTTGGAAGG + Intergenic
1087161098 11:94948863-94948885 AGTGAGAGGCAAGATGAGGCAGG - Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087239200 11:95756654-95756676 AGGGAGAAGCAGGATTATGAGGG + Intergenic
1088428732 11:109733270-109733292 AGTGAGAGACTGATTTTGGAAGG - Intergenic
1088928434 11:114325374-114325396 AGTGAGGGGCAGAAGTAGGTGGG - Intergenic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1089507672 11:118974884-118974906 AGTGGGAGACAGGTTTAGGAAGG + Intronic
1089960473 11:122613395-122613417 AGTGGGATGAAGAACTAGGAGGG + Intergenic
1090239064 11:125169329-125169351 ACTGAGAAGCAGAATTTAGAGGG + Intronic
1090347585 11:126083600-126083622 AGAGAGAGACAGAGGTAGGAAGG - Intergenic
1090547711 11:127783380-127783402 AGAGAGAGTCAGCATTTGGAAGG - Intergenic
1091151890 11:133336670-133336692 AGTGAGAGGAATAAAAAGGATGG + Intronic
1091525041 12:1291512-1291534 CTTGAGAGGCAGAAATATGAGGG + Intronic
1091907490 12:4200694-4200716 TGTGAGAGGTAGAATGGGGATGG - Intergenic
1091951448 12:4596355-4596377 AGGGAGAGGCACAGTCAGGAAGG - Intronic
1092442514 12:8519379-8519401 AGGGAGGGGTAGAATGAGGAAGG - Intronic
1093704317 12:22257720-22257742 AGAGGGAGGGAGAAGTAGGAAGG + Intronic
1094123754 12:27000858-27000880 TGTGTGAGGAAGGATTAGGAAGG - Intronic
1095991204 12:48035801-48035823 AGTGATAGGAGGAATGAGGAAGG - Intergenic
1096078296 12:48818270-48818292 AGAGAGAGGCAGAGGGAGGACGG - Intronic
1097396585 12:59082491-59082513 AGTGAGAGACAGAACTGGAAAGG - Intergenic
1099465982 12:82988563-82988585 AGTTGAAGGCAGAATGAGGAGGG + Intronic
1100245101 12:92749813-92749835 AGTGGGATGCAGCATTAGGATGG - Intronic
1100665325 12:96746014-96746036 AGAGAGAGGCAGAAGGAGGCTGG - Intronic
1100889168 12:99104783-99104805 AGTGATAAACAGAACTAGGAAGG - Intronic
1101045713 12:100803656-100803678 AGTAAGTGGCAGAGTAAGGATGG - Intronic
1101316982 12:103638294-103638316 ATTGAAAGGGAGAATTGGGATGG - Intronic
1101406785 12:104435798-104435820 AGTAAGTGGTAGAACTAGGAAGG + Intergenic
1101421304 12:104553594-104553616 AGAGAGAGTGAGAACTAGGAGGG + Intronic
1102016571 12:109651760-109651782 AGTAAGTGGCAGAACCAGGACGG - Intergenic
1102095913 12:110241252-110241274 AGGGAGAAGCAGACTTAGGTAGG + Intergenic
1102765471 12:115429229-115429251 AGTGAGAGGGAAAGGTAGGAGGG - Intergenic
1104463649 12:128973648-128973670 GGTGAGAGGCAGAAAAGGGAGGG - Intronic
1104483657 12:129130409-129130431 AGGGAGGGGCAGAGTCAGGATGG - Intronic
1106027198 13:25966813-25966835 AGTGGGAGGCTGGAATAGGAAGG - Intronic
1106130402 13:26934706-26934728 AGAGAGAGGCAGCAAGAGGAAGG - Intergenic
1107125561 13:36841907-36841929 GGAGAGAGGCAGAAATAGGCAGG - Intergenic
1107451638 13:40515446-40515468 TGTGAAAGGCAGGATTAGAATGG - Intergenic
1107723005 13:43268792-43268814 AGTGAAGGCCAGAAATAGGAAGG + Intronic
1107817340 13:44255949-44255971 AGTGAGAGGAAGTAACAGGATGG - Intergenic
1107918235 13:45175088-45175110 AGTGTGAGGCATGATAAGGAGGG - Intronic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1109267348 13:60216766-60216788 GGAGAGAGACAGAGTTAGGAAGG + Intergenic
1111798216 13:92950528-92950550 AGTGCTATGCAGAATTAAGATGG + Intergenic
1112378849 13:98869502-98869524 ACTGAGAGCCTGAAGTAGGAAGG + Intronic
1112404571 13:99107762-99107784 AGTGAGAGTCTGAAGAAGGAAGG + Intergenic
1112463516 13:99623450-99623472 AGTGAGAGAAAGAGGTAGGAGGG - Intronic
1112643423 13:101303392-101303414 AGAGAGAGGCTGAATTGTGATGG + Intronic
1112782315 13:102914574-102914596 AGCGAGAGGGAGAGATAGGAAGG + Intergenic
1113245138 13:108386798-108386820 AGAGAGAATCAGAATAAGGATGG - Intergenic
1113268730 13:108648893-108648915 AGAGAGAGAGAGAATTAGAATGG - Intronic
1114179514 14:20353836-20353858 TGTGGGAGGCAGAACTTGGATGG + Intronic
1114815034 14:25947425-25947447 ATTGACAGGCTGAATTAGGTGGG - Intergenic
1115008510 14:28515859-28515881 TTTGATATGCAGAATTAGGAAGG + Intergenic
1117380576 14:55158627-55158649 AATGAGAGAGAGAATTAGGCAGG - Exonic
1117461837 14:55952970-55952992 AGTGAGAGGCTCATTTAGGGTGG + Intergenic
1117661564 14:58011201-58011223 ACTGAGAAGCAGAAATAGTAAGG + Intronic
1117996538 14:61483321-61483343 GGGGAGAGGCAGAATTGGGTGGG - Intronic
1118042683 14:61934678-61934700 AGTGAGAGGCAGAACTAGAATGG - Intergenic
1118669547 14:68108602-68108624 AGAGAGAGGCAGGAATGGGAAGG + Intronic
1119819481 14:77602321-77602343 ACTGAGAGGGAGGGTTAGGATGG - Intronic
1119981456 14:79086290-79086312 GGTTAGAGGCAGAGGTAGGAAGG + Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121620193 14:95341348-95341370 AGTGAGCGGCTGATGTAGGATGG + Intergenic
1121704204 14:95979050-95979072 AGTGAGAGGCTGAGCTAGGAGGG + Intergenic
1121726546 14:96156223-96156245 AGAGAGAGGGAGAAGAAGGAAGG + Intergenic
1121939822 14:98059436-98059458 GGGGAGAGGGAGAAGTAGGAGGG + Intergenic
1121951576 14:98175394-98175416 GGTGAGAGGCAGACTCTGGAAGG + Intergenic
1122504032 14:102220227-102220249 AGTGAGAGGAAGTCTAAGGAAGG + Intronic
1122874494 14:104657414-104657436 AGGGAGAGGCAGGGTTAGGAGGG - Intergenic
1123091985 14:105746006-105746028 GGTGGGAGGCAGAATAAGCAGGG - Intergenic
1124219542 15:27837604-27837626 AGTAACAGCCAGAAGTAGGAAGG + Intronic
1124353357 15:28976780-28976802 AATGAAAGGCAGAATAAGAAAGG - Intronic
1125911677 15:43445389-43445411 AGAGAGAAGGAGAACTAGGAGGG - Intronic
1126718019 15:51542882-51542904 AGTGAGAGGCAGTATTGGGGAGG - Intronic
1126950973 15:53880908-53880930 AGTGAGAGTCTGAATTTGGAAGG + Intergenic
1127633770 15:60850173-60850195 TGTGAGAGGCAGAATGAGTGAGG - Intronic
1128716809 15:69914521-69914543 AGAGAGAGACAGAAGGAGGAGGG - Intergenic
1131428625 15:92368196-92368218 AGTTAGAGGCAGATCTGGGAGGG - Intergenic
1132060489 15:98688323-98688345 AGTGAAAGGCAGAGAGAGGAGGG - Intronic
1134790559 16:16985727-16985749 AGTTTGAGGCAGAAATAGGCAGG + Intergenic
1136136348 16:28258995-28259017 TGTCAGAGGCAGGACTAGGAGGG - Intergenic
1136296499 16:29307041-29307063 AGTGAGAGGCAGACTGGGAATGG - Intergenic
1137376836 16:47958990-47959012 CTTGAGAGGCTGAAGTAGGAGGG - Intergenic
1137378996 16:47980586-47980608 AGAGAGGAGCAGAGTTAGGAAGG - Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1139070298 16:63372195-63372217 AGAGAGAGAGAGTATTAGGATGG - Intergenic
1139989360 16:70927253-70927275 AGTTAGAGTCAGAATGAGGTAGG + Intronic
1141686693 16:85574360-85574382 AGTTAGAGGCCAAACTAGGAGGG + Intergenic
1142058080 16:88013160-88013182 AGTGAGAGGCAGACTGGGAATGG - Intronic
1142245438 16:88968169-88968191 GGTGAGAGGCCGAATAAGGGTGG + Intronic
1142489156 17:266711-266733 AGTGAGAAACAGAATTCTGAGGG + Intronic
1143403561 17:6661075-6661097 AGGGAGAGGCAGGAGTGGGATGG + Intergenic
1143487799 17:7264091-7264113 AGAGAGAGCCAGAATAAGCAGGG - Intergenic
1143563880 17:7709930-7709952 AGTGAGAGGCAGAAAGAAGGCGG - Exonic
1143613837 17:8037957-8037979 AGTGAGAAGCAGAGGTGGGAAGG - Intergenic
1143887530 17:10076192-10076214 AGGGAGAGGGAGAAGTGGGAGGG + Intronic
1143892520 17:10113619-10113641 AGTGAGAGGCACAAGTTGTAGGG - Intronic
1143982262 17:10880153-10880175 AGGGAGTGGCTGAGTTAGGATGG + Intergenic
1144299248 17:13907828-13907850 AGTGAGAGGCATAGTTATGGAGG - Intergenic
1145830595 17:27913210-27913232 AATGTGAGGCAGCAGTAGGAGGG - Intergenic
1145966002 17:28917720-28917742 TGTCAGAGGCCGAATTTGGAAGG - Intronic
1146287099 17:31581408-31581430 GGTGAGAGCCAGACTGAGGAGGG - Intergenic
1146589948 17:34120312-34120334 AGAGAGAGGCAGAGGTGGGATGG - Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147336877 17:39731532-39731554 AGTGAGAGGCTGGATGAGAAGGG - Intergenic
1148116094 17:45175984-45176006 AGTGAGAAGAAGAACTGGGATGG - Intergenic
1148208199 17:45792659-45792681 AGTGAGAGACAGATTTAGACTGG - Intronic
1148432898 17:47656889-47656911 ACTGTGAGGCAGAACTAGGCCGG - Exonic
1150414963 17:64979797-64979819 ACTGAAGGGCAGAATTGGGAGGG - Intergenic
1150707088 17:67496872-67496894 AGAGAAGGGCAGAATTGGGAGGG - Intronic
1150796671 17:68243882-68243904 AGTGAAGGGCAGAATTGGGAGGG + Intergenic
1150811734 17:68362229-68362251 GGTGAGAGGCAAGATGAGGAGGG - Intronic
1151823330 17:76509100-76509122 TGGGAGAGGGAGGATTAGGAAGG + Intergenic
1151825058 17:76519402-76519424 CGGGAGAGGGAGGATTAGGAAGG - Intergenic
1152262326 17:79273828-79273850 AGTGACAGGCAGTATTTGCAGGG + Intronic
1154059990 18:11050746-11050768 TTGGAGAGGCAGAATTAGAAAGG - Intronic
1156241383 18:35257894-35257916 AGAGAGAAGCAGGATTAGGAAGG - Intronic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156768278 18:40686534-40686556 AGTGAGAACCAGAATTATCATGG - Intergenic
1156782829 18:40871497-40871519 AGTGGGAGGCAGAACAAAGAGGG - Intergenic
1157175019 18:45443702-45443724 AATGAGAGGCAGAGAGAGGAGGG + Intronic
1157467345 18:47958604-47958626 AGTGAGAGGTAGGAGTAGAATGG - Intergenic
1157976534 18:52334119-52334141 AGAGAGAGGCAGAGTAAGAAAGG - Intergenic
1158261731 18:55613245-55613267 AGTGGAAGGCAGGATTGGGAAGG - Intronic
1160378411 18:78430849-78430871 AGTGAGAGGCGGAGGGAGGAAGG - Intergenic
1161738377 19:6005599-6005621 AGTGACAGGCACAGTGAGGAAGG - Intronic
1162315829 19:9937304-9937326 AGTGAGAGGCAGAGAAAGGCTGG - Intergenic
1162377080 19:10310968-10310990 GGTGAGTGGCAGAGTCAGGAAGG + Intronic
1162877820 19:13633959-13633981 AGAGAGAGACAGAAGAAGGAAGG - Intergenic
1163692333 19:18744586-18744608 AGTCAGAGGCAGAATGAAGCGGG - Intronic
1164770965 19:30808620-30808642 AGAGAAAGGCAGAGTTGGGATGG + Intergenic
1165323248 19:35099183-35099205 GGTGAGAGGTAGGATTAGGAAGG - Intergenic
1165943358 19:39426456-39426478 AGTGAGAGGCACAATTTAAACGG + Exonic
1165944554 19:39434006-39434028 AGTGAGGGACACAAGTAGGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166750077 19:45160358-45160380 AGTGAGGGGCAGGATAAGGAGGG + Intronic
1167514484 19:49915118-49915140 AAGGAAAGGAAGAATTAGGAAGG + Intronic
1167880001 19:52449345-52449367 AGAGAGAGAGAGAATGAGGATGG - Intronic
1168705153 19:58466635-58466657 AGTGAGAGGCAGAGCTGGGAAGG + Intergenic
925234902 2:2269537-2269559 AATGCAAGGCAGAAGTAGGATGG - Intronic
925282712 2:2695931-2695953 GGTGAGAGGGAGGACTAGGAAGG + Intergenic
925704826 2:6674381-6674403 AGGGAGATGCAGCATTGGGAGGG + Intergenic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
926627690 2:15106769-15106791 AGGTAGAGGGAGCATTAGGAGGG + Intergenic
927648820 2:24898622-24898644 AGTCAGAGGCGGAAATGGGAGGG - Intronic
927786964 2:25981148-25981170 AGCGAGAGGCAGAACAAGGCAGG - Exonic
929379966 2:41337928-41337950 AAAGAGAGTCAGAATAAGGAAGG + Intergenic
929887420 2:45891447-45891469 AGTGATAGCCAGCATCAGGATGG - Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932827002 2:74950317-74950339 AGTGAGACAGAAAATTAGGAAGG + Intergenic
933141126 2:78793856-78793878 AGTGAGAGGCTGAAGCTGGATGG + Intergenic
934019804 2:87936145-87936167 AGTGAGTGGCTGAAGTGGGATGG + Intergenic
934498974 2:94838529-94838551 AGCAAGAGACAGAATTTGGAAGG + Intergenic
934667663 2:96184242-96184264 AGTGTGAGGCAGAGCCAGGATGG + Intergenic
935653644 2:105403484-105403506 AGGGAGAGGCACAGCTAGGAAGG + Intronic
936399058 2:112152087-112152109 AGTGAGAGGATGAATGAGGCAGG + Intronic
937525711 2:122767058-122767080 AGTGACACGCACAATCAGGATGG + Intergenic
937818716 2:126283655-126283677 AGTGAGTGGTAGAAATAGGAGGG + Intergenic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
938188354 2:129253258-129253280 TGTGAGGGGCAGAATGAGGTCGG - Intergenic
938781529 2:134589109-134589131 AGTGAGAGGCAGCAGAAAGAAGG + Intronic
939456948 2:142449579-142449601 AGTAAGGGGTAGAATTAGGGAGG - Intergenic
940743460 2:157540332-157540354 AATGAGAGGAAGAATTAGGGAGG - Intronic
941186447 2:162326001-162326023 AGTGAGAGGCTGAAACTGGATGG + Intronic
941404528 2:165071891-165071913 TGTGAGAGGCTGAAGCAGGAGGG - Intergenic
941950661 2:171152456-171152478 ATTGAGAGGCAGGATTTGAATGG - Intronic
942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG + Intronic
943755760 2:191555304-191555326 TGGGAGAGGCTGAACTAGGATGG + Intergenic
944972127 2:205005097-205005119 AGTGAGGTGGTGAATTAGGAAGG - Intronic
945703757 2:213203566-213203588 AGGGAGAGGCCTACTTAGGAGGG - Intergenic
945738342 2:213629856-213629878 AGTGAGAGCCAGACCCAGGAAGG - Intronic
946326427 2:218986787-218986809 AGTGGGAGGCAGAGTGTGGAGGG + Intergenic
948426078 2:237887200-237887222 AGTGAAGGTCAGCATTAGGAGGG - Intronic
948447136 2:238041418-238041440 ACTGAGAGGGAGCATGAGGACGG - Exonic
1169152161 20:3297911-3297933 GATGAGAGGGAGAGTTAGGAGGG - Intronic
1169663461 20:8006684-8006706 ATAGAGAGGGAGAAGTAGGAGGG - Intronic
1169780463 20:9303997-9304019 AGAGAGAGGGAGATTTAGGTGGG - Intronic
1170059646 20:12245705-12245727 AGTGTGACTCAGAAGTAGGATGG + Intergenic
1170956237 20:20982392-20982414 ACTCAGATGCATAATTAGGATGG - Intergenic
1171516807 20:25745043-25745065 GATGAGTGGCAGAATTAGCAGGG + Intergenic
1174543795 20:51309757-51309779 CATGGGAGGCAGAATTCGGAGGG + Intergenic
1175499083 20:59436781-59436803 AGGGAGAGGCAGGGTCAGGAAGG + Intergenic
1177953537 21:27568654-27568676 AGTGAGAGGCAGATATGGGATGG - Intergenic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178606126 21:34037526-34037548 AGTGGGAGGCAGGAAAAGGATGG - Intergenic
1179915379 21:44474280-44474302 GGCGAGGGGCAGAATCAGGAGGG + Intergenic
1181909624 22:26228358-26228380 GGTGAGGGGCGGAGTTAGGATGG + Intronic
1182794188 22:32978379-32978401 ATTGAGAGAGAGAATTAGGGAGG + Intronic
1184870193 22:47232922-47232944 AGTCAGAGGCTGAATCAAGAAGG + Intergenic
949184053 3:1169060-1169082 AGTGAGTGGCAGAGGAAGGATGG + Intronic
950198926 3:11029080-11029102 AGTCACAGGCAGAATCAGGCTGG + Intronic
950858180 3:16125016-16125038 AGGGGGAGGCAGAAATATGATGG + Intergenic
951106521 3:18750222-18750244 GTTGGGAGGCAGAATTGGGAGGG + Intergenic
951802822 3:26615380-26615402 AGTTAGAGGGAGAAGGAGGAGGG + Intergenic
952125630 3:30297278-30297300 AGTGAGAGGCAGTAGGAGGTAGG - Intergenic
952953014 3:38539303-38539325 AGTCAGAGGCAGAGCTGGGAAGG - Intronic
953137305 3:40192259-40192281 AATCAGAGGGAGAATTAGAAAGG - Intronic
953203508 3:40799344-40799366 AGTGAGTGGCAAAACTGGGATGG + Intergenic
953458646 3:43063744-43063766 ACTGATAGGAAGACTTAGGAAGG + Intergenic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
954050807 3:47975484-47975506 AGAGGGAGGAAGAAGTAGGAAGG + Intronic
955584457 3:60461769-60461791 AGTCAGAGGCAGGATAAGGATGG + Intronic
957982708 3:87531080-87531102 AGTGAGAGGCTGAATGGGGCTGG + Intergenic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959246409 3:103875304-103875326 AGAGAGATGCAGAATTACGTGGG + Intergenic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
960992497 3:123321113-123321135 AGTAAGAGGCAGGATTGAGAGGG - Intronic
962221438 3:133567580-133567602 AATGAGTGGCAGAGTTAGGGAGG + Intergenic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963563410 3:146896795-146896817 CCTGAGTGGCAGAATCAGGAGGG + Intergenic
963632454 3:147750261-147750283 AGTATGAGACAGAATAAGGAAGG + Intergenic
965002896 3:162980578-162980600 AGACAGAGGCAGAAATTGGAGGG - Intergenic
965686971 3:171314460-171314482 ACAGAGAGGCAGAAATGGGATGG - Intronic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
966611169 3:181869245-181869267 AGTGAGGGGCAAACTTAGGATGG + Intergenic
966728366 3:183129542-183129564 AGTCAGAGGCAGAATAAATAGGG - Intronic
967595564 3:191323758-191323780 AGTGAGAGGCAGTACCAGGGTGG + Intronic
967954288 3:194865801-194865823 ACTGAGACTCAGAAGTAGGAAGG + Intergenic
968798091 4:2722532-2722554 AGTGATTGTCAGAGTTAGGAGGG + Intronic
969501008 4:7552946-7552968 AGAGGAAGGCAGAACTAGGAAGG + Intronic
969928022 4:10603606-10603628 AGAAAGAGGCAGAATTGGGCAGG + Intronic
969956328 4:10895000-10895022 AGGGAGATGGAGAATAAGGAAGG + Intergenic
971109645 4:23570783-23570805 AGTGAGAGGCAAAAAGAGAATGG - Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
973265725 4:48208422-48208444 AGTAACAGGCAGATTTTGGAGGG - Intronic
973288156 4:48442688-48442710 AGTGAGAGTGAGAAGTGGGAGGG + Intergenic
973796678 4:54434332-54434354 AGTGAGAGGCACAAACATGAAGG - Intergenic
974714165 4:65645088-65645110 AGTGAGTGGCAGGATTTGCAAGG - Intronic
976575743 4:86668943-86668965 AGTGAGAAACAGAATTACCAAGG - Intronic
977086579 4:92606459-92606481 AGTGAGAGGAAGAAGAAAGAAGG + Intronic
977686350 4:99851332-99851354 AATGAGAGACAGAAAGAGGAAGG + Intronic
978240854 4:106514634-106514656 AGTGAGGGGTAGAATTTTGAGGG - Intergenic
978555368 4:109973675-109973697 AGAGAGAGGCAGAGGTGGGAGGG - Intronic
978954425 4:114597562-114597584 AGTGAGATTCAGAAATAGGTTGG - Intergenic
978986418 4:115019064-115019086 AGTGAGAACAAGAATTAGGCTGG - Intronic
979874624 4:125872401-125872423 TGTGAGAGGGAGACTTGGGAAGG - Intergenic
980029564 4:127811550-127811572 ATTGAGAAGCAAAATTTGGAAGG + Exonic
980173164 4:129313486-129313508 AGAGAGAAGCCCAATTAGGAGGG - Intergenic
983260411 4:165450429-165450451 AGTGGGAGGTAAAATTAGAATGG + Intronic
983378099 4:166956086-166956108 AGTGAGTGGCTGAATTTGGGTGG - Intronic
985693412 5:1326111-1326133 AGTGGCAGGCAGAAGTAGGTGGG - Intronic
985996623 5:3600575-3600597 CGGAAGAGGCAGAGTTAGGACGG - Intronic
986329457 5:6706861-6706883 GGTGAGGGGAAGAAATAGGATGG - Intergenic
986418488 5:7552343-7552365 AGTGAGAAGCAGTATTTTGATGG + Intronic
986460080 5:7961149-7961171 AGTGAGATGGAGAAGTAAGAAGG - Intergenic
988726421 5:33930867-33930889 AGTCAGTGACAGAATTAGAAAGG - Intergenic
990317835 5:54600841-54600863 AGGGAGAGAGAGTATTAGGAAGG + Intergenic
991038945 5:62156661-62156683 GGTGAGAGGCAGTAGTAGGCAGG + Intergenic
993010862 5:82480705-82480727 AGAGAGGGGCAGGATTAGGTGGG + Intergenic
994314501 5:98316608-98316630 GGAGAGAAGCAGAATTAGGCAGG + Intergenic
996225668 5:120992486-120992508 AGAGAGAGGCTGATTTGGGAAGG + Intergenic
997340556 5:133141281-133141303 GGTGAGGGGCATAATCAGGATGG + Intergenic
998005762 5:138655837-138655859 AGTGAGAGGCACAAAAGGGAAGG + Intronic
998185917 5:139980077-139980099 AGTGATAAGCAGAAATAGCATGG - Intronic
998499244 5:142617567-142617589 AGTGAGAGGGAGCATCATGAGGG + Intronic
998726121 5:145016758-145016780 TGAGAAAGGCAGAAATAGGAAGG + Intergenic
999080313 5:148837320-148837342 AGTTACATGCAGAATTAGTAAGG - Intergenic
999470542 5:151850821-151850843 AGTGGGATGAAGAACTAGGAGGG - Intronic
999473251 5:151874916-151874938 AGTGATAGGGAGCATGAGGAGGG + Intronic
1000371411 5:160540086-160540108 AGTGAGTGGCTGAAGTGGGATGG + Intergenic
1000507968 5:162145509-162145531 AGTGAGAGGCAGAGTAGGGATGG - Intronic
1000856074 5:166399878-166399900 AGTGAGTGGCACAAACAGGAAGG - Intergenic
1001034339 5:168286751-168286773 TGAGAGAGTCAGAAATAGGATGG + Intergenic
1001066270 5:168537292-168537314 TGGGAAAGGCAGATTTAGGATGG + Intergenic
1001421322 5:171589428-171589450 TGTGAGAAGCAGAGGTAGGAGGG + Intergenic
1001754929 5:174160959-174160981 AATGAGAGGGAGAATAAGCAGGG + Intronic
1002205246 5:177558321-177558343 GGAGAGAGGAAGAAGTAGGAGGG - Intergenic
1003064598 6:2893006-2893028 AGTGAGAGGCAGTATAGGGCAGG - Intronic
1003905795 6:10698582-10698604 AGTTAGAGACTGAATTGGGAGGG + Intronic
1005222253 6:23599821-23599843 AGTCAGAGGCACAGTTAGCACGG - Intergenic
1005363219 6:25052472-25052494 AGTAGGAGGCAGAATCAGGTGGG - Intergenic
1005519186 6:26583853-26583875 AGTCAGGGGCAGAAGCAGGAAGG - Intergenic
1007407971 6:41645620-41645642 AGTGAGACGCAGCAATAGCACGG - Intronic
1007616335 6:43181899-43181921 TGGGAGAGGGAGGATTAGGAGGG + Intergenic
1008437515 6:51493914-51493936 AGTGTGATGCAGAGTTAGAAAGG - Intergenic
1008467471 6:51846861-51846883 AGAGAGAGGCTGAATTAAGACGG - Intronic
1008996929 6:57669697-57669719 ATTGGGAGGCAGAAGAAGGAGGG + Intergenic
1009929990 6:70165716-70165738 AGTGAGAGTCAGAATGGGTATGG + Intronic
1010866876 6:80986500-80986522 GGAGAGAGGGAGAAATAGGAAGG - Intergenic
1010870501 6:81031405-81031427 AGGGAGTGGCAGAATTAGAGGGG + Intergenic
1011561877 6:88627611-88627633 AGTGACAGGCTGAATAAGAAGGG - Intronic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1016746857 6:147590171-147590193 AGTGAGAGCCAGAATCATGATGG + Intronic
1016821332 6:148349040-148349062 AGTGAGAGGGATAAAAAGGAAGG + Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017436249 6:154418272-154418294 AGAGAAAGGCAGAATGATGACGG - Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1018668389 6:166160531-166160553 AGTAAGTGGCAGAACCAGGATGG + Intronic
1019144841 6:169969959-169969981 AGTGAGAGGTAGAAGGAGGCTGG + Intergenic
1019660773 7:2222882-2222904 AGTCATAGGCAGAACCAGGACGG + Intronic
1019725684 7:2601239-2601261 AGTGAGAGGCAGAATTAGGATGG - Intronic
1020288271 7:6703075-6703097 AGTGAGTGGCAGCATCAGGAAGG - Intronic
1020646921 7:10825717-10825739 ACTGAGCTACAGAATTAGGAAGG - Intergenic
1022190564 7:28013366-28013388 AGTGGGAGGAAAAAATAGGAGGG + Intronic
1022350889 7:29565450-29565472 AGTAAAAGGAAGAATTAGGATGG + Intronic
1022911389 7:34902173-34902195 ACTGAGGGGCAGATTTAGGCTGG + Intergenic
1023220818 7:37918969-37918991 TGTGAGAAGAAGGATTAGGATGG - Intronic
1023269771 7:38450012-38450034 AGTAAGATGCAGTATTAGGCTGG + Intronic
1023550865 7:41368563-41368585 AGATAGAGACAGAATTGGGAAGG - Intergenic
1024058169 7:45679467-45679489 AGTGGGAGGTAGACTCAGGAGGG + Intronic
1024237677 7:47410182-47410204 AGTGAGAGGGAGGACCAGGAGGG - Intronic
1024809054 7:53185415-53185437 TGTGAGTGGCAGAATTACAATGG - Intergenic
1024824815 7:53379343-53379365 AGTGAGAGGAAGAGTCAGTAGGG + Intergenic
1024961435 7:54980922-54980944 AGAGAGAGGCATAAGGAGGAAGG + Intergenic
1024989925 7:55225138-55225160 AGCAAGATGCAGAATTATGATGG - Intronic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1027050540 7:75018794-75018816 GGTGAGATGGAGAATCAGGACGG + Intronic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1028331303 7:89596453-89596475 AGTGAGAGGGAGAAGTGGTAAGG - Intergenic
1028966201 7:96804461-96804483 CCTGAAAGGCAGAATTAGAAGGG - Intergenic
1029382507 7:100222876-100222898 AGTGAGATGGAGAATCAGGACGG - Intronic
1029871792 7:103702235-103702257 GGTGACAGGCAGAATTATGTAGG + Intronic
1029989045 7:104946388-104946410 AGTGAATGCCAGAATTAGGCAGG + Intergenic
1030175107 7:106644408-106644430 AGTGAGGGGCAGAGACAGGAGGG - Intergenic
1030463625 7:109872410-109872432 AGTGATTGGTAGAACTAGGATGG - Intergenic
1031005641 7:116467922-116467944 AGTGAGGAGCAAAATTAGCAAGG - Intronic
1031107497 7:117563070-117563092 AGTGAGGAGCAGAATTAAGGTGG + Intronic
1031745733 7:125495533-125495555 AGGGAGGTGCAGAATTACGAGGG - Intergenic
1032120325 7:129150486-129150508 ACTGGGAGGCAGAGATAGGAAGG + Intronic
1032211208 7:129915759-129915781 AAAGACAGGCAGAGTTAGGAGGG - Intronic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1034010907 7:147528441-147528463 AGTGAGAGACAGAATGAGTAAGG - Intronic
1034389432 7:150772974-150772996 AGAGAGAGGGAGAATTCAGAGGG - Intergenic
1035339452 7:158151134-158151156 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1035339479 7:158151244-158151266 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1035339519 7:158151391-158151413 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1035339529 7:158151428-158151450 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1035339539 7:158151465-158151487 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1035958886 8:4114806-4114828 AGCGAGAGGTAAAATTAGAAGGG + Intronic
1036546238 8:9771963-9771985 AGTGAGAGGGAGAAAGAGGTGGG + Intronic
1037151249 8:15637831-15637853 GGAGAGAGGAAGAAATAGGAGGG - Intronic
1037824602 8:22153883-22153905 TGTGGGAGTCAGAATTGGGATGG - Intronic
1038070630 8:24008716-24008738 GGTGAGAGGCTAAACTAGGAAGG - Intergenic
1038419427 8:27422881-27422903 AATACGAGGCAGAATGAGGATGG + Intronic
1039569442 8:38575395-38575417 AATGAGAGGCAGAGCCAGGAGGG - Intergenic
1040505671 8:48045676-48045698 AGTGCCAGGCAGAGGTAGGAGGG + Intronic
1041871691 8:62641679-62641701 AGTGAGAGGCAAGATTAGGAAGG + Intronic
1044218062 8:89636102-89636124 AGGGGAAGGCAGAATTAGGTAGG - Intergenic
1044608996 8:94073515-94073537 AGTGAGAGACAGAACCAGGGTGG + Intergenic
1045699907 8:104853665-104853687 AGAGAGAGACTGAAATAGGAAGG + Intronic
1046061434 8:109144595-109144617 AGTGACAGGTAAAATTAGGAAGG + Intergenic
1048261067 8:132945431-132945453 TGGGAGAGGGAGATTTAGGAAGG + Intronic
1051910415 9:22148722-22148744 AGTGAGAGACAGAAGAGGGAGGG - Intergenic
1052280411 9:26726681-26726703 AGTAAGTGACAGAATGAGGATGG + Intergenic
1052434859 9:28413489-28413511 ACTGAGAGGGAGAAGTTGGAGGG - Intronic
1052444424 9:28542069-28542091 GGTAAGAAGCAGGATTAGGAAGG + Intronic
1052493720 9:29199197-29199219 AGTGATAGGCTGAACTGGGATGG - Intergenic
1053046078 9:34918323-34918345 AGTGGGATGAAGAACTAGGAGGG - Intergenic
1055379382 9:75689498-75689520 AGTGGGAGGAAGAATAAGGAGGG + Intergenic
1056431732 9:86534932-86534954 AGTGAGATGCAGTACTACGAGGG - Intergenic
1057745495 9:97747697-97747719 GGTGAAAAGCAGAATTAGAATGG - Intergenic
1059054101 9:110960688-110960710 AGAGAGAGGAAGAAATGGGAGGG + Intronic
1059405287 9:114095339-114095361 AGGGAGAGCAAGAGTTAGGAAGG + Intronic
1059974999 9:119706714-119706736 AGTGGGAGAAGGAATTAGGATGG - Intergenic
1060830896 9:126715574-126715596 AGAGAGAGGCAGAGAGAGGAAGG + Intergenic
1061650389 9:132043405-132043427 GGAGAGAGGGAGAATGAGGAGGG + Intronic
1062158177 9:135065654-135065676 AGAGAGAGGCAGGGTAAGGAAGG - Intergenic
1186320714 X:8421411-8421433 AGTGAGTGGCAGAACTGTGAAGG + Intergenic
1186903704 X:14087848-14087870 AATGAGGGTCAGAAATAGGAAGG - Intergenic
1186949010 X:14602072-14602094 AGTTTGAGGCAGTACTAGGAAGG + Intronic
1187029369 X:15469925-15469947 AGTGAGTGGCAGAAGGAGTATGG + Intronic
1188748405 X:33875006-33875028 GGCAAAAGGCAGAATTAGGAGGG - Intergenic
1189169864 X:38898505-38898527 AGTCAAAGGCAGAAAGAGGAAGG + Intergenic
1190626511 X:52343068-52343090 AGAGAGAGGCAGAAAGGGGAAGG + Intergenic
1193672028 X:84398656-84398678 ATTGAGAGACAAAATTAGCAGGG + Intronic
1195557202 X:106240810-106240832 AGAGAGAGGAAGAAGTGGGAGGG + Intergenic
1196026843 X:111050265-111050287 AGTGAGAGGCATAAATATGGGGG - Intronic
1198146791 X:133865757-133865779 AGTCTGAAGCACAATTAGGAGGG + Intronic
1198757405 X:139995856-139995878 AGGGAGAGGTAGATTTAGAATGG + Intergenic
1199124724 X:144102986-144103008 AGTGAGTGGCTGAAGTGGGATGG - Intergenic
1199168419 X:144705543-144705565 AGAGAAAGTCAGAATAAGGAAGG - Intergenic
1199598883 X:149528751-149528773 AGAGAGAGGGAGAAAGAGGACGG - Intronic
1199675146 X:150182322-150182344 AGCCAGAGGCAGAGTGAGGAAGG + Intergenic
1199765979 X:150941955-150941977 AGTGTGGGGCAGAAAAAGGAGGG + Intergenic
1201741493 Y:17328598-17328620 GGTGATAGGCAGAGGTAGGATGG + Intergenic