ID: 1019726237

View in Genome Browser
Species Human (GRCh38)
Location 7:2604317-2604339
Sequence CAGGAAATTCAGATCAGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7573
Summary {0: 1, 1: 1, 2: 16, 3: 485, 4: 7070}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019726237_1019726246 19 Left 1019726237 7:2604317-2604339 CCCGGGCTGATCTGAATTTCCTG 0: 1
1: 1
2: 16
3: 485
4: 7070
Right 1019726246 7:2604359-2604381 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
1019726237_1019726244 18 Left 1019726237 7:2604317-2604339 CCCGGGCTGATCTGAATTTCCTG 0: 1
1: 1
2: 16
3: 485
4: 7070
Right 1019726244 7:2604358-2604380 GCCTCAGCCTCCCAAAGTGCTGG 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
1019726237_1019726248 27 Left 1019726237 7:2604317-2604339 CCCGGGCTGATCTGAATTTCCTG 0: 1
1: 1
2: 16
3: 485
4: 7070
Right 1019726248 7:2604367-2604389 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019726237 Original CRISPR CAGGAAATTCAGATCAGCCC GGG (reversed) Intronic
Too many off-targets to display for this crispr