ID: 1019726237 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:2604317-2604339 |
| Sequence | CAGGAAATTCAGATCAGCCC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 7573 | |||
| Summary | {0: 1, 1: 1, 2: 16, 3: 485, 4: 7070} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1019726237_1019726246 | 19 | Left | 1019726237 | 7:2604317-2604339 | CCCGGGCTGATCTGAATTTCCTG | 0: 1 1: 1 2: 16 3: 485 4: 7070 |
||
| Right | 1019726246 | 7:2604359-2604381 | CCTCAGCCTCCCAAAGTGCTGGG | 0: 90349 1: 212695 2: 235979 3: 260133 4: 296590 |
||||
| 1019726237_1019726244 | 18 | Left | 1019726237 | 7:2604317-2604339 | CCCGGGCTGATCTGAATTTCCTG | 0: 1 1: 1 2: 16 3: 485 4: 7070 |
||
| Right | 1019726244 | 7:2604358-2604380 | GCCTCAGCCTCCCAAAGTGCTGG | 0: 56931 1: 168651 2: 218048 3: 269456 4: 306914 |
||||
| 1019726237_1019726248 | 27 | Left | 1019726237 | 7:2604317-2604339 | CCCGGGCTGATCTGAATTTCCTG | 0: 1 1: 1 2: 16 3: 485 4: 7070 |
||
| Right | 1019726248 | 7:2604367-2604389 | TCCCAAAGTGCTGGGATTACAGG | 0: 284556 1: 262309 2: 153276 3: 130613 4: 189623 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1019726237 | Original CRISPR | CAGGAAATTCAGATCAGCCC GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||