ID: 1019726238

View in Genome Browser
Species Human (GRCh38)
Location 7:2604318-2604340
Sequence CCAGGAAATTCAGATCAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48841
Summary {0: 2, 1: 5, 2: 262, 3: 5366, 4: 43206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019726238_1019726246 18 Left 1019726238 7:2604318-2604340 CCGGGCTGATCTGAATTTCCTGG 0: 2
1: 5
2: 262
3: 5366
4: 43206
Right 1019726246 7:2604359-2604381 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
1019726238_1019726244 17 Left 1019726238 7:2604318-2604340 CCGGGCTGATCTGAATTTCCTGG 0: 2
1: 5
2: 262
3: 5366
4: 43206
Right 1019726244 7:2604358-2604380 GCCTCAGCCTCCCAAAGTGCTGG 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
1019726238_1019726248 26 Left 1019726238 7:2604318-2604340 CCGGGCTGATCTGAATTTCCTGG 0: 2
1: 5
2: 262
3: 5366
4: 43206
Right 1019726248 7:2604367-2604389 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019726238 Original CRISPR CCAGGAAATTCAGATCAGCC CGG (reversed) Intronic
Too many off-targets to display for this crispr