ID: 1019726240

View in Genome Browser
Species Human (GRCh38)
Location 7:2604336-2604358
Sequence CAGGGTGATCACTTGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162239
Summary {0: 3, 1: 234, 2: 7562, 3: 40895, 4: 113545}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019726240_1019726244 -1 Left 1019726240 7:2604336-2604358 CCTGGCCTCAAGTGATCACCCTG 0: 3
1: 234
2: 7562
3: 40895
4: 113545
Right 1019726244 7:2604358-2604380 GCCTCAGCCTCCCAAAGTGCTGG 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
1019726240_1019726248 8 Left 1019726240 7:2604336-2604358 CCTGGCCTCAAGTGATCACCCTG 0: 3
1: 234
2: 7562
3: 40895
4: 113545
Right 1019726248 7:2604367-2604389 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
1019726240_1019726246 0 Left 1019726240 7:2604336-2604358 CCTGGCCTCAAGTGATCACCCTG 0: 3
1: 234
2: 7562
3: 40895
4: 113545
Right 1019726246 7:2604359-2604381 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019726240 Original CRISPR CAGGGTGATCACTTGAGGCC AGG (reversed) Intronic
Too many off-targets to display for this crispr