ID: 1019726241

View in Genome Browser
Species Human (GRCh38)
Location 7:2604341-2604363
Sequence TGAGGCAGGGTGATCACTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117551
Summary {0: 3, 1: 245, 2: 8760, 3: 33901, 4: 74642}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019726241_1019726248 3 Left 1019726241 7:2604341-2604363 CCTCAAGTGATCACCCTGCCTCA 0: 3
1: 245
2: 8760
3: 33901
4: 74642
Right 1019726248 7:2604367-2604389 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
1019726241_1019726244 -6 Left 1019726241 7:2604341-2604363 CCTCAAGTGATCACCCTGCCTCA 0: 3
1: 245
2: 8760
3: 33901
4: 74642
Right 1019726244 7:2604358-2604380 GCCTCAGCCTCCCAAAGTGCTGG 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
1019726241_1019726246 -5 Left 1019726241 7:2604341-2604363 CCTCAAGTGATCACCCTGCCTCA 0: 3
1: 245
2: 8760
3: 33901
4: 74642
Right 1019726246 7:2604359-2604381 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019726241 Original CRISPR TGAGGCAGGGTGATCACTTG AGG (reversed) Intronic
Too many off-targets to display for this crispr