ID: 1019726244

View in Genome Browser
Species Human (GRCh38)
Location 7:2604358-2604380
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1020000
Summary {0: 56931, 1: 168651, 2: 218048, 3: 269456, 4: 306914}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019726237_1019726244 18 Left 1019726237 7:2604317-2604339 CCCGGGCTGATCTGAATTTCCTG 0: 1
1: 1
2: 16
3: 485
4: 7070
Right 1019726244 7:2604358-2604380 GCCTCAGCCTCCCAAAGTGCTGG 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
1019726238_1019726244 17 Left 1019726238 7:2604318-2604340 CCGGGCTGATCTGAATTTCCTGG 0: 2
1: 5
2: 262
3: 5366
4: 43206
Right 1019726244 7:2604358-2604380 GCCTCAGCCTCCCAAAGTGCTGG 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
1019726240_1019726244 -1 Left 1019726240 7:2604336-2604358 CCTGGCCTCAAGTGATCACCCTG 0: 3
1: 234
2: 7562
3: 40895
4: 113545
Right 1019726244 7:2604358-2604380 GCCTCAGCCTCCCAAAGTGCTGG 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
1019726241_1019726244 -6 Left 1019726241 7:2604341-2604363 CCTCAAGTGATCACCCTGCCTCA 0: 3
1: 245
2: 8760
3: 33901
4: 74642
Right 1019726244 7:2604358-2604380 GCCTCAGCCTCCCAAAGTGCTGG 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
Too many off-targets to display for this crispr