ID: 1019726246

View in Genome Browser
Species Human (GRCh38)
Location 7:2604359-2604381
Sequence CCTCAGCCTCCCAAAGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1095746
Summary {0: 90349, 1: 212695, 2: 235979, 3: 260133, 4: 296590}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019726241_1019726246 -5 Left 1019726241 7:2604341-2604363 CCTCAAGTGATCACCCTGCCTCA 0: 3
1: 245
2: 8760
3: 33901
4: 74642
Right 1019726246 7:2604359-2604381 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
1019726237_1019726246 19 Left 1019726237 7:2604317-2604339 CCCGGGCTGATCTGAATTTCCTG 0: 1
1: 1
2: 16
3: 485
4: 7070
Right 1019726246 7:2604359-2604381 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
1019726240_1019726246 0 Left 1019726240 7:2604336-2604358 CCTGGCCTCAAGTGATCACCCTG 0: 3
1: 234
2: 7562
3: 40895
4: 113545
Right 1019726246 7:2604359-2604381 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
1019726238_1019726246 18 Left 1019726238 7:2604318-2604340 CCGGGCTGATCTGAATTTCCTGG 0: 2
1: 5
2: 262
3: 5366
4: 43206
Right 1019726246 7:2604359-2604381 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019726246 Original CRISPR CCTCAGCCTCCCAAAGTGCT GGG Intronic
Too many off-targets to display for this crispr