ID: 1019726248

View in Genome Browser
Species Human (GRCh38)
Location 7:2604367-2604389
Sequence TCCCAAAGTGCTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1020377
Summary {0: 284556, 1: 262309, 2: 153276, 3: 130613, 4: 189623}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019726241_1019726248 3 Left 1019726241 7:2604341-2604363 CCTCAAGTGATCACCCTGCCTCA 0: 3
1: 245
2: 8760
3: 33901
4: 74642
Right 1019726248 7:2604367-2604389 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
1019726242_1019726248 -10 Left 1019726242 7:2604354-2604376 CCCTGCCTCAGCCTCCCAAAGTG 0: 614
1: 1788
2: 3610
3: 7080
4: 9550
Right 1019726248 7:2604367-2604389 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
1019726237_1019726248 27 Left 1019726237 7:2604317-2604339 CCCGGGCTGATCTGAATTTCCTG 0: 1
1: 1
2: 16
3: 485
4: 7070
Right 1019726248 7:2604367-2604389 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
1019726238_1019726248 26 Left 1019726238 7:2604318-2604340 CCGGGCTGATCTGAATTTCCTGG 0: 2
1: 5
2: 262
3: 5366
4: 43206
Right 1019726248 7:2604367-2604389 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
1019726240_1019726248 8 Left 1019726240 7:2604336-2604358 CCTGGCCTCAAGTGATCACCCTG 0: 3
1: 234
2: 7562
3: 40895
4: 113545
Right 1019726248 7:2604367-2604389 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019726248 Original CRISPR TCCCAAAGTGCTGGGATTAC AGG Intronic
Too many off-targets to display for this crispr