ID: 1019726564

View in Genome Browser
Species Human (GRCh38)
Location 7:2606102-2606124
Sequence CAGCGCCTGCCGCCTGCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 250}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019726559_1019726564 17 Left 1019726559 7:2606062-2606084 CCCGGAGCACTGGGTGCAGGGCA 0: 1
1: 0
2: 2
3: 45
4: 421
Right 1019726564 7:2606102-2606124 CAGCGCCTGCCGCCTGCCAGCGG 0: 1
1: 0
2: 2
3: 19
4: 250
1019726560_1019726564 16 Left 1019726560 7:2606063-2606085 CCGGAGCACTGGGTGCAGGGCAT 0: 1
1: 0
2: 1
3: 23
4: 282
Right 1019726564 7:2606102-2606124 CAGCGCCTGCCGCCTGCCAGCGG 0: 1
1: 0
2: 2
3: 19
4: 250
1019726554_1019726564 27 Left 1019726554 7:2606052-2606074 CCGCACTGGGCCCGGAGCACTGG 0: 1
1: 0
2: 3
3: 17
4: 270
Right 1019726564 7:2606102-2606124 CAGCGCCTGCCGCCTGCCAGCGG 0: 1
1: 0
2: 2
3: 19
4: 250
1019726553_1019726564 30 Left 1019726553 7:2606049-2606071 CCACCGCACTGGGCCCGGAGCAC 0: 1
1: 0
2: 0
3: 26
4: 305
Right 1019726564 7:2606102-2606124 CAGCGCCTGCCGCCTGCCAGCGG 0: 1
1: 0
2: 2
3: 19
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019726564 Original CRISPR CAGCGCCTGCCGCCTGCCAG CGG Intronic
900013644 1:135333-135355 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
900014408 1:138299-138321 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
900043714 1:491316-491338 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
900044273 1:493501-493523 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
900065152 1:726319-726341 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
900065681 1:728407-728429 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
900203151 1:1420226-1420248 CACCGCCAGCCGCCCGCCCGCGG + Exonic
900374123 1:2345548-2345570 CAGCACCTGCCCCTCGCCAGTGG + Intronic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
901008146 1:6181474-6181496 CAGTGCTGGCCGCCTGCAAGGGG + Intronic
901081125 1:6584824-6584846 CAGCTCCTCCCACCTTCCAGAGG - Intronic
901082754 1:6592848-6592870 TAGCTCCTGGCCCCTGCCAGGGG - Exonic
901435900 1:9247326-9247348 CAGCCTCTACCGCGTGCCAGTGG - Intronic
902181015 1:14688384-14688406 CAGCACCTGCTGCCTGGCACAGG - Intronic
902604284 1:17560180-17560202 CAGCCCCTGCCCCCGGACAGTGG - Intronic
902797774 1:18810439-18810461 CAGCGCCCGCCTGCTGCGAGGGG + Intergenic
904402305 1:30264815-30264837 CAGCTCCTGATGCCAGCCAGTGG - Intergenic
904457708 1:30657422-30657444 CTGCCCCTGCCCCATGCCAGGGG - Intergenic
905734608 1:40316757-40316779 CCGCCCCCGCCGCCTCCCAGGGG - Intronic
906537689 1:46560743-46560765 GAGCACCTGCCACATGCCAGAGG - Intronic
906642080 1:47447231-47447253 CAGCCCCTGCAGCCTGCCTGGGG + Intergenic
907160610 1:52366201-52366223 CACTGCCGGCCGCCGGCCAGTGG - Intergenic
907751649 1:57269004-57269026 CAGCCCCAGCCACCTTCCAGTGG - Intronic
908738998 1:67307948-67307970 CACCACGTGTCGCCTGCCAGCGG - Exonic
913655119 1:120952805-120952827 CAGACCCTGCTCCCTGCCAGGGG - Intergenic
914645304 1:149646965-149646987 CAGACCCTGCTCCCTGCCAGGGG - Intergenic
914998302 1:152564007-152564029 TAGAGCCTGCCTCCTGTCAGGGG - Intronic
915320008 1:155051379-155051401 CAGCGCCAGCCGCATGGCAGCGG - Exonic
915334981 1:155135864-155135886 CAGCGCCCGCCGCGAGCCTGCGG - Exonic
916659062 1:166904322-166904344 CTGAACCTGCCCCCTGCCAGTGG + Intergenic
918539738 1:185617805-185617827 CAGCCACTGCAGCCAGCCAGTGG - Intergenic
920224219 1:204426365-204426387 CAGAGCCAGGAGCCTGCCAGGGG - Intronic
920846331 1:209595901-209595923 CAGAGTCTGCAGCCTCCCAGGGG - Intronic
922100057 1:222472328-222472350 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
922100262 1:222473156-222473178 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
922100463 1:222473956-222473978 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
922262081 1:223951794-223951816 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
922734187 1:227970784-227970806 CAGCTCCTCCTGCCTCCCAGTGG + Intergenic
922734983 1:227973920-227973942 CAGCTCCTCCTGCCTCCCAGTGG + Intergenic
923237216 1:232046091-232046113 CAGAGCCTCCTGCCTGCTAGTGG - Intergenic
924343255 1:243053993-243054015 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
924343726 1:243055873-243055895 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
1065328003 10:24567687-24567709 CAGGGCCTGATGCCTGCAAGAGG + Intergenic
1066653515 10:37680478-37680500 CAGGGCGTGCTGCCAGCCAGGGG - Intergenic
1066733237 10:38451599-38451621 CAGCTCCTCCTGCCTCCCAGTGG + Intergenic
1067169959 10:43898360-43898382 CAGCCCCTGCCCCCTGACAAGGG - Intergenic
1072151783 10:92690001-92690023 CGGCGCCCGCCGCCGGCCCGGGG - Exonic
1073135338 10:101217165-101217187 CAGCGCCTGGCGCCCTCGAGCGG + Intergenic
1073871804 10:107873141-107873163 CTTGGCCTTCCGCCTGCCAGGGG + Intergenic
1074291333 10:112139992-112140014 CAGGGCCTGTCTCCTGGCAGGGG + Intergenic
1075693957 10:124419716-124419738 CAGCGCCTGCCCTCTGAGAGGGG - Intergenic
1075756188 10:124813576-124813598 CAGCCCCTGCCTGCTTCCAGAGG + Intronic
1075898620 10:126019888-126019910 CAGGGCCTGCCGCTTGGCACAGG + Intronic
1076738466 10:132468958-132468980 CAGCCCCTGCCCCCTGCCCAGGG + Intergenic
1076850614 10:133090718-133090740 GGGCTCCTGACGCCTGCCAGGGG + Intronic
1076969988 11:127547-127569 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
1076970605 11:129976-129998 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
1077060788 11:617074-617096 CAGTGCCCGCCGCCTTCCCGAGG - Exonic
1077119719 11:901248-901270 CAGAGCCTGTGGCCGGCCAGGGG + Intronic
1077243884 11:1526518-1526540 CAGCGCCTGCTCCCTGCCCTGGG + Intergenic
1080857104 11:36121844-36121866 CAGCACCTCCCACCTGCCATCGG + Intronic
1081675701 11:44967821-44967843 CAGCTCCTGCAGCTTGCCAGAGG + Intergenic
1084558852 11:69891433-69891455 CAGCGTCGGCCGCTTGGCAGGGG + Intergenic
1084719206 11:70893341-70893363 CAGCACCTGGCCCCTGCCAGAGG + Intronic
1084951550 11:72669016-72669038 GAGCACCTGCCGCATGCCAGGGG + Intronic
1088604456 11:111514675-111514697 CAGCCCCTGCCGGCTGCCCTCGG - Intergenic
1088920935 11:114259410-114259432 CCGTGTCTGCCGCATGCCAGAGG + Intronic
1089192088 11:116660599-116660621 CAGAGCCTGCACCCAGCCAGGGG + Intergenic
1089688153 11:120169857-120169879 CGGCGCCTGCTGCCTTCCACAGG - Exonic
1090607075 11:128432537-128432559 AAGCGTCTGCCCCCTGACAGAGG + Intergenic
1091383627 12:78246-78268 CACCGCCCGCCGCCAGCCCGGGG + Intronic
1094586548 12:31782339-31782361 CACCTCCTCCCGCCTGCCGGTGG - Intergenic
1094851333 12:34383608-34383630 GAGGGACTGCCGCCTGCCGGAGG + Intergenic
1096180676 12:49548889-49548911 CAGCTCCTGCAGCCAGCCTGAGG - Exonic
1103292181 12:119855507-119855529 CAAGGCCTGCCGCCTGGGAGAGG - Intronic
1103700394 12:122846173-122846195 CAGCCCCTGCCTCCTGCCCTGGG + Intronic
1104459702 12:128945279-128945301 CAGCGGTCGCCGCCTGCTAGTGG - Intronic
1104767804 12:131341675-131341697 CGGGGCCTCCCGTCTGCCAGAGG + Intergenic
1104811916 12:131624407-131624429 CAGGGCCTCCCATCTGCCAGAGG - Intergenic
1104977738 12:132559860-132559882 CCGCGCCCGCCGCCGGCCCGGGG - Intronic
1105240894 13:18609246-18609268 CCGCGCCGGCCGCCTCCCGGTGG + Intergenic
1105758513 13:23492043-23492065 CAGAGGCTGCCTCCTGCCACTGG - Intergenic
1110412914 13:75223028-75223050 CAGAGCCTGCCCCATTCCAGTGG + Intergenic
1111348363 13:86994209-86994231 CATCTCCTGCCTCCTGCCACTGG - Intergenic
1114069110 14:19094211-19094233 CACTGCCTGCCGCCTGCCCCTGG - Intergenic
1114093150 14:19305792-19305814 CACTGCCTGCCGCCTGCCCCTGG + Intergenic
1114402440 14:22422369-22422391 CAGGGCCTGCTGCCTGCTAATGG - Intergenic
1116873867 14:50092373-50092395 CAGCCCCTGCTGCATGGCAGTGG - Intronic
1116946499 14:50840281-50840303 CATCCCCTGCCTCCAGCCAGTGG - Intergenic
1119774416 14:77239593-77239615 CATGGCATGGCGCCTGCCAGCGG - Exonic
1120980399 14:90284126-90284148 CAGTGCCTGGCTCCTTCCAGAGG + Intronic
1122129746 14:99598133-99598155 CAGGGGCTGCCACCCGCCAGAGG + Intronic
1122242103 14:100375956-100375978 TAGCGCCTGCCATGTGCCAGAGG - Intronic
1123490463 15:20775893-20775915 CCGCGCCGGCCGCCTCCCGGTGG - Intergenic
1123546964 15:21344980-21345002 CCGCGCCGGCCGCCTCCCGGTGG - Intergenic
1123661865 15:22571699-22571721 GAGCCCCTGCAGCCTTCCAGCGG + Intergenic
1124262345 15:28203846-28203868 GAGCCCCTGCAGCCTTCCAGCGG - Intronic
1124315664 15:28665942-28665964 GAGCCCCTGCAGCCTTCCAGCGG + Intergenic
1126791274 15:52223322-52223344 CAGCGCCTGCAGCCATCCTGTGG + Intronic
1126857863 15:52856445-52856467 CACAGCCTGCAGCCTGCCAATGG - Intergenic
1132231139 15:100185016-100185038 GAGCGCCTGCCTCCTCCCTGAGG + Intronic
1202955295 15_KI270727v1_random:72196-72218 CCGCGCCGGCCGCCTCCCGGTGG - Intergenic
1133072257 16:3254420-3254442 CAGCCCCTGCAGCCTCCCCGCGG + Exonic
1133090596 16:3401130-3401152 CAGGGCCCGCCTCCTGCCAAGGG - Intronic
1134066730 16:11233149-11233171 CAGCGGCTGCCGGGTGCGAGCGG + Intergenic
1135407024 16:22206175-22206197 CAGCGCCTGCAGCCGCCTAGCGG - Intergenic
1142078017 16:88131690-88131712 CAGCCCCTGCCTTCTGCGAGCGG - Intergenic
1142179253 16:88659389-88659411 CAGCGGCGTCCGCCTGCAAGGGG - Intronic
1142229325 16:88892356-88892378 CAGCACCTGCCCCCAGCCTGCGG - Exonic
1142231324 16:88901538-88901560 CACCGCCTGCCGCATCCCAGGGG - Exonic
1142449643 16:90167506-90167528 CAGCTCCTCCTGCCTCCCAGTGG + Intergenic
1142450691 16:90171585-90171607 CAGCTCCTCCTGCCTCCCAGTGG + Intergenic
1142456874 17:62106-62128 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
1142457444 17:64339-64361 CAGCTCCTCCGGCCTCCCAGTGG - Intergenic
1144671445 17:17134794-17134816 CAGCGCCTGCGGCCTCCCTTGGG + Intronic
1146620117 17:34390655-34390677 AAGCCCCTGCTGTCTGCCAGGGG + Intergenic
1147672419 17:42184287-42184309 CAGCGCCTCCTGCAGGCCAGCGG - Exonic
1148645253 17:49216532-49216554 CAGCGCCTTCCGCTTGTCTGTGG - Exonic
1151216735 17:72582234-72582256 CAGCCCCTGCTGCCTGTCAGTGG - Intergenic
1151293328 17:73165727-73165749 CTGCGCCCGCCGCCTGCCTCTGG - Intronic
1151747858 17:76021439-76021461 CCGCCCCTGCCGCCTGCCCGAGG + Intronic
1152539147 17:80966161-80966183 CACCGCGTGCCGCCTGCACGTGG + Exonic
1152631169 17:81411285-81411307 CAGCTCCTGCTGCCTGTCTGGGG - Intronic
1152800990 17:82330585-82330607 AAGCTCCTCCCGCCTGGCAGTGG + Intronic
1152890097 17:82875540-82875562 CAGAGGCTGCCCCCTGGCAGGGG - Intronic
1154448076 18:14450662-14450684 CCGCGCCGGCCGCCTCCCGGTGG - Intergenic
1160010819 18:75106021-75106043 CAGCCCCTGCCACCTGCCACAGG + Intergenic
1160646786 19:197465-197487 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
1162034683 19:7932583-7932605 CAGGACCTGCCGCCTGGGAGGGG + Intronic
1163369983 19:16896513-16896535 CAGCGCCTGCCGCCTGCGGGAGG - Exonic
1163636819 19:18440888-18440910 CCTCTCCTGCCACCTGCCAGGGG - Intergenic
1164587220 19:29483586-29483608 CAGGGCCTGCCCACTGCCTGGGG + Intergenic
1165476236 19:36032568-36032590 CAGCGCCTGCCACCTCCCCCAGG + Intronic
1165485602 19:36093664-36093686 CAGTGCCTGCCTCATGCCAAGGG + Intronic
1165782996 19:38444581-38444603 CAGCACCTGTCGACCGCCAGTGG + Exonic
1166170428 19:41024475-41024497 CAGTTCCTGCCTCCTGACAGCGG - Intergenic
1166568485 19:43779365-43779387 CAGTGCCCGCCGCCTGCCAGAGG + Intronic
1167067758 19:47199675-47199697 CAGTGGCTGCCGCTTGCCACTGG + Intronic
1167613192 19:50517237-50517259 CCGGGCCCGCCGCCTTCCAGGGG - Exonic
927146577 2:20170067-20170089 CTGTGCCTGCCCCCTGCCATCGG - Intergenic
927658526 2:24972037-24972059 CCGCGCCTGCTGCCAGGCAGCGG - Exonic
927926315 2:27016278-27016300 CAGAGCCTGCCCCCTCCGAGTGG + Intronic
932232646 2:70095261-70095283 CAGCTTCTGCCTCCTGCCACAGG + Intergenic
936010125 2:108920195-108920217 CAGTGCCTGGCGCCTGGCACTGG + Intronic
937205911 2:120237082-120237104 CAGAGCCAGGCGCCTGGCAGAGG + Intergenic
937228007 2:120380817-120380839 CAGGGTCTGTCACCTGCCAGAGG - Intergenic
937956772 2:127426218-127426240 CCTCGCCTCCCACCTGCCAGGGG - Exonic
937991404 2:127664306-127664328 CAGAGCCCGCCGCCAGCCACGGG - Exonic
940954396 2:159712297-159712319 CAGCCGCTGCCGCTTACCAGTGG + Intergenic
948805937 2:240453459-240453481 CATCGCCTGCCGCCGCCCCGGGG + Intronic
949006681 2:241653430-241653452 GACCGGCTGCCTCCTGCCAGTGG + Intronic
1168948346 20:1779802-1779824 CAGCGCCTGGTGCCTGACAATGG - Intergenic
1169941767 20:10945544-10945566 CAGCGCTTGCCATCTGTCAGAGG - Intergenic
1171266250 20:23774337-23774359 CACCTCCTGCCGGCTGGCAGGGG + Intergenic
1172205420 20:33159849-33159871 CAGCTCCTGCTCGCTGCCAGAGG - Intergenic
1175237485 20:57524912-57524934 CAGCGTCTGCCGCCCGCCCTTGG + Intronic
1175400496 20:58697418-58697440 CCGTCCCTGCCGCCTGTCAGCGG - Intronic
1175442526 20:59001715-59001737 CAGCGCCTGCATCCCGCCTGAGG - Intronic
1175838078 20:62008919-62008941 CTTCGCCTGCAGCCTTCCAGAGG + Intronic
1176059935 20:63168108-63168130 CAGGCCCAGACGCCTGCCAGGGG - Intergenic
1176151955 20:63595991-63596013 CAGCGCTTGCCCCCTTCCTGGGG - Intronic
1176278716 20:64288761-64288783 CAGCTCCTCCTGCCTCCCAGTGG + Intergenic
1178782244 21:35614645-35614667 CAGCACCTCCAGCCTCCCAGTGG - Intronic
1178916010 21:36705935-36705957 CAGCCCCTGCCACCACCCAGAGG + Intronic
1179474170 21:41632829-41632851 CAGCCCCTGCCACCTGCAAAGGG + Intergenic
1180001299 21:44996693-44996715 CAGCCCCTTCCTCCTGCCACAGG - Intergenic
1180086498 21:45510088-45510110 CCCCGCATGCCGCCTGACAGGGG - Exonic
1180155436 21:45975110-45975132 CAGGGCCTGTCCCCTGCCCGTGG + Intergenic
1180487584 22:15816774-15816796 CACTGCCTGCCGCCTGCCCCTGG - Intergenic
1180675246 22:17581954-17581976 CTGCGCCTGGCGCCTGTCACTGG + Intronic
1180982645 22:19886145-19886167 CTGAGCCTGCTGCCTGCCACAGG - Intronic
1181283208 22:21734708-21734730 CAGCTCCTGGCACCTGGCAGGGG + Intronic
1182485592 22:30636751-30636773 CAGCGAGTGCCGCCTGGCATGGG - Exonic
1182652242 22:31861467-31861489 CAGCTCATGGCGTCTGCCAGTGG - Intronic
1184076136 22:42179672-42179694 TGGCGCCTGCCTCCTGGCAGTGG + Exonic
1184684424 22:46089740-46089762 CTGCCCCTGCCTCCTGCCCGAGG + Intronic
1184715337 22:46278812-46278834 GAGCAGCTGCCGCCCGCCAGGGG + Intronic
950441576 3:13013940-13013962 GAGCCCCTGCTGCCTGCCTGGGG - Intronic
951535352 3:23735743-23735765 CAGCCCCTTCCCCCAGCCAGTGG + Intergenic
955759131 3:62259261-62259283 CACCGACTGCTGCCTGCAAGAGG + Intronic
957743069 3:84299743-84299765 AAGCTCCTGCCCCCTGCCACAGG + Intergenic
961138965 3:124539509-124539531 TAGAGCTTGCAGCCTGCCAGGGG - Intronic
962361534 3:134747388-134747410 CAGTGCCTGCCACTTGGCAGTGG - Intronic
963228598 3:142888327-142888349 CAGCTCCTGGGGCCTTCCAGAGG + Intronic
968370895 3:198222057-198222079 CAGCTCCTCCTGCCTCCCAGTGG + Intergenic
969058422 4:4416243-4416265 TAGCGCCGCCCTCCTGCCAGTGG + Intronic
969524858 4:7699253-7699275 AAGAGCCTGCAGCCTGCCAGTGG + Intronic
969756479 4:9153382-9153404 CCCCGCCGGCCACCTGCCAGGGG - Intergenic
973706794 4:53588990-53589012 CAGGGGCTTCCTCCTGCCAGAGG + Intronic
979259349 4:118633684-118633706 CAGCTCCTCCTGCCTCCCAGTGG + Intergenic
979259577 4:118634545-118634567 CAGCTCCTCCTGCCTCCCAGTGG + Intergenic
979328797 4:119406079-119406101 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
979329001 4:119406879-119406901 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
985809604 5:2073325-2073347 CTGAGCTTGCCACCTGCCAGTGG - Intergenic
990165377 5:52988937-52988959 CAGCGCCCGGCTCCTGGCAGCGG - Intergenic
990799788 5:59587646-59587668 CAGAGACTGCTGCCTGACAGGGG + Intronic
994164092 5:96590485-96590507 CATCTCCTGCCACCTGCAAGTGG + Intronic
997371557 5:133364433-133364455 CAGGGGCTGCCCCATGCCAGGGG + Intronic
998871161 5:146553589-146553611 CAACCCCTTCCTCCTGCCAGAGG + Intergenic
1001710108 5:173771663-173771685 CAGCACCTGCCACCTGCTAGGGG - Intergenic
1002321532 5:178378791-178378813 CGGCCGCTGCCACCTGCCAGCGG - Intronic
1002729570 5:181325428-181325450 CAGCTCCTCCTGCCTCCCAGTGG + Intergenic
1002730129 5:181327613-181327635 CAGCTCCTCCTGCCTCCCAGTGG + Intergenic
1002754403 6:146486-146508 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
1003879902 6:10470698-10470720 CAGCTCCTCCAGCCTTCCAGTGG + Intergenic
1004098391 6:12582589-12582611 CTGAGCCTGCTGGCTGCCAGGGG + Intergenic
1004456196 6:15793582-15793604 CAGCCCCTGCCTCATGCCTGGGG - Intergenic
1009976097 6:70672707-70672729 CACACCCTGCTGCCTGCCAGGGG - Intronic
1011300143 6:85865176-85865198 CTGCTCCTGCAGCCAGCCAGTGG + Intergenic
1011411844 6:87074437-87074459 CAGTGCCTGCTCCATGCCAGGGG - Intergenic
1012374078 6:98539822-98539844 CACCGGCTGCCTCCTGCCTGTGG - Intergenic
1018727969 6:166627886-166627908 GAGGGACCGCCGCCTGCCAGCGG + Intronic
1019595531 7:1856716-1856738 CAGTCCCTGCTTCCTGCCAGCGG + Intronic
1019657009 7:2201263-2201285 CAGCGCCAGCCGAGGGCCAGAGG - Intronic
1019689791 7:2404047-2404069 CAGCCTCTGCCGCCCGGCAGGGG + Intronic
1019726564 7:2606102-2606124 CAGCGCCTGCCGCCTGCCAGCGG + Intronic
1019738639 7:2662304-2662326 CCCCTCCTGCCGGCTGCCAGAGG + Exonic
1019994525 7:4715476-4715498 CAGCTCCTACCGCCGGCCAGCGG - Intronic
1020035433 7:4960419-4960441 CAGCACCTACCGCCTGCCTGTGG + Intergenic
1020278437 7:6637876-6637898 GAGCGCCTCCCGCCCCCCAGGGG - Exonic
1021106620 7:16645796-16645818 CACCGCCTGCCGCCTGTCATTGG + Exonic
1022008854 7:26291876-26291898 CAGCGCCAGCCGTCCGCCTGTGG - Exonic
1023860547 7:44215602-44215624 CAGTGCCTGCAGCCTTCCTGGGG + Intergenic
1024074259 7:45810730-45810752 CAGCTCCTCCTGCCTCCCAGCGG + Intergenic
1024075288 7:45814813-45814835 CAGCTCCTCCTGCCTCCCAGTGG + Intergenic
1024604447 7:51012676-51012698 CAGTGCCTGCCTCCTGGCACTGG + Intergenic
1024648311 7:51386510-51386532 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
1024648842 7:51388583-51388605 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
1024748179 7:52431353-52431375 CAGGACCTGCAGCCTGCCATGGG - Intergenic
1025053153 7:55744798-55744820 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
1025177508 7:56809551-56809573 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic
1025694256 7:63766702-63766724 CAGCTCCTCCTGCCTCCCAGTGG + Intergenic
1028268657 7:88759578-88759600 TCGCGCCTGGCGCCTGCCCGGGG - Exonic
1029123972 7:98285012-98285034 CAGAGCCTGCGTCCTGCAAGCGG + Intronic
1029477281 7:100792489-100792511 CAGCGCCCGCCTCCTGGCAGAGG - Intronic
1029722037 7:102374389-102374411 CAGCTCCTGTGGCCTGCCTGTGG + Intronic
1032051291 7:128652549-128652571 CAGCTCCTCCTGCCTCCCAGTGG + Intergenic
1032075841 7:128835730-128835752 TAGGGCCTGCCACCAGCCAGCGG - Intronic
1032390917 7:131555071-131555093 CAGCGCCTGCCCACTACCAAAGG + Intronic
1033459650 7:141533855-141533877 CAGCCCCTGCCGCCAGGCAGGGG + Intergenic
1035185253 7:157121298-157121320 CAGGGGCTGCCGCGGGCCAGGGG + Intergenic
1036216282 8:6882743-6882765 CAGCTCCTTCCATCTGCCAGTGG - Intergenic
1037805855 8:22057602-22057624 GAGAGCCTGCCCCCAGCCAGTGG + Intronic
1037877260 8:22554254-22554276 CCGTGCCTGCCGGCTCCCAGGGG - Intronic
1037975061 8:23203354-23203376 CAGCCCATGCCACCTGCCATGGG + Intronic
1039562193 8:38521431-38521453 CAGCCACTGCCCCCAGCCAGCGG + Intronic
1040059706 8:43093662-43093684 CAGCCCCGGCCGCCTGCCCGCGG + Intronic
1045098940 8:98825876-98825898 CCGCGCCGGCCGCCAGCCTGCGG + Intronic
1048328072 8:133453736-133453758 CTGCTCCTGCCCCCTGCCACGGG - Intergenic
1048354587 8:133642793-133642815 CAGCCCCTTCCGCCTTCCACAGG - Intergenic
1049922674 9:379889-379911 CTACGTCTTCCGCCTGCCAGAGG + Exonic
1050411648 9:5372592-5372614 CAGCTACTGCCTCCTGCCACAGG + Intronic
1060087343 9:120714466-120714488 CGGGGCCGGCCGCCTGTCAGAGG - Exonic
1060849261 9:126860884-126860906 CCGCGCCGGCCGCCTGCCCGCGG - Intronic
1061012893 9:127965853-127965875 CAGCGTCTGGCTCCTGCCAGGGG + Intronic
1061204540 9:129155370-129155392 CAGCTCCTGCCCTCTGCAAGGGG + Intergenic
1061262923 9:129489943-129489965 CAGGCCCTGCGGCCTCCCAGAGG + Intergenic
1061416409 9:130449484-130449506 CTGCTCCTGCCTCCTCCCAGAGG - Intronic
1061514442 9:131080653-131080675 CAGTGCCTGCCGCTTACCCGGGG + Intronic
1061582519 9:131546381-131546403 CAGCGCCTGACGCCTGGGGGTGG - Intergenic
1061841428 9:133360574-133360596 CACGGCCTTCCGCCAGCCAGCGG - Intronic
1062138576 9:134943192-134943214 CATTGCCTGCCGGCTGCAAGGGG - Intergenic
1062402156 9:136377494-136377516 CAGGGACCGCCGCCTGCCATGGG + Intronic
1062754544 9:138280127-138280149 CAGCTCCTCCTGCCTCCCAGTGG + Intergenic
1203577541 Un_KI270745v1:20697-20719 CAGCTCCTCCTGCCTCCCAGTGG + Intergenic
1203578446 Un_KI270745v1:24287-24309 CAGCTCCTCCTGCCTCCCAGTGG + Intergenic
1186611056 X:11138985-11139007 CAGCGCCAACTCCCTGCCAGCGG - Exonic
1191669987 X:63740066-63740088 CTGTACCTGCCACCTGCCAGAGG - Intronic
1192194828 X:69021278-69021300 CAGCGCCTCCCTCCTGCTACAGG + Intergenic
1200108080 X:153725378-153725400 CAGTGCCTGGCCCCGGCCAGGGG + Exonic
1202381084 Y:24276913-24276935 CAGCTCCTCCTGCCTCCCAGTGG + Intergenic
1202489701 Y:25393213-25393235 CAGCTCCTCCTGCCTCCCAGTGG - Intergenic