ID: 1019727556

View in Genome Browser
Species Human (GRCh38)
Location 7:2611444-2611466
Sequence GTCCCCGTGGACGGAAGCCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019727556_1019727565 12 Left 1019727556 7:2611444-2611466 CCAAGGCTTCCGTCCACGGGGAC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1019727565 7:2611479-2611501 TGGGCGCCTTTTCTGCAGCATGG 0: 1
1: 0
2: 1
3: 6
4: 95
1019727556_1019727566 15 Left 1019727556 7:2611444-2611466 CCAAGGCTTCCGTCCACGGGGAC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1019727566 7:2611482-2611504 GCGCCTTTTCTGCAGCATGGCGG 0: 1
1: 0
2: 1
3: 10
4: 111
1019727556_1019727561 -7 Left 1019727556 7:2611444-2611466 CCAAGGCTTCCGTCCACGGGGAC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1019727561 7:2611460-2611482 CGGGGACAGGCTTAACCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 69
1019727556_1019727560 -8 Left 1019727556 7:2611444-2611466 CCAAGGCTTCCGTCCACGGGGAC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1019727560 7:2611459-2611481 ACGGGGACAGGCTTAACCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019727556 Original CRISPR GTCCCCGTGGACGGAAGCCT TGG (reversed) Exonic
904244900 1:29181163-29181185 TTCCCCGAGGACTGGAGCCTTGG - Intronic
907185884 1:52608726-52608748 GTCCCAGTTTACAGAAGCCTTGG - Exonic
907544450 1:55247269-55247291 GTCCCTGTGGATGGAAGACTTGG - Intergenic
912450880 1:109766954-109766976 GTCTCAGTGGGGGGAAGCCTTGG - Intronic
920101889 1:203522013-203522035 GCCTCCGTGGAGGGAAGCCCAGG + Intergenic
922302394 1:224313114-224313136 GTGCCAGTGCACTGAAGCCTGGG + Intronic
923006079 1:230051255-230051277 GTCCCTGTGGACATAAGCCGAGG - Intergenic
1063909020 10:10810964-10810986 GTCCCCTTTGAAAGAAGCCTGGG + Intergenic
1066410234 10:35161449-35161471 GTCCCAGTGGACTCCAGCCTGGG + Intronic
1069453609 10:68536549-68536571 GTGCCAGTGGACGCTAGCCTGGG - Intergenic
1075092514 10:119451654-119451676 GTGCACGTGGACGGAAGCAGGGG - Intronic
1077071423 11:675775-675797 GTGCCAGTGGACTCAAGCCTGGG + Intronic
1077154325 11:1084728-1084750 GTCCCCGTGGGCTGCATCCTGGG + Intergenic
1089291561 11:117440511-117440533 GTCCCCTTGGACTCAAGCTTTGG - Intronic
1090286597 11:125505067-125505089 GTCCCCGGGGAGGGGAGGCTGGG + Intergenic
1105004025 12:132710236-132710258 GTCCCCCTGGAAGGAAACCCAGG + Intergenic
1105831713 13:24168226-24168248 GTGCCCTTGGAATGAAGCCTGGG + Intronic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1113568669 13:111337997-111338019 GTCCCCATGGAAAGAATCCTGGG + Intronic
1113619168 13:111701339-111701361 GTCCCTGAGGACGGAAGGCAGGG + Intergenic
1113624697 13:111786600-111786622 GTCCCTGAGGACGGAAGGCAGGG + Intergenic
1113890434 13:113732528-113732550 ACCACGGTGGACGGAAGCCTCGG - Intronic
1118591708 14:67406872-67406894 GTCCAGGTGGAGGGAGGCCTGGG - Intronic
1119519959 14:75278222-75278244 GACCCCGAGGACTTAAGCCTCGG - Intergenic
1121822912 14:96985920-96985942 GTCCACCTGCACGAAAGCCTTGG + Intergenic
1122447613 14:101781278-101781300 GTCCCTGAGGACAGAAGCCAGGG - Intronic
1123042369 14:105495679-105495701 GTCCCAGGGGCCAGAAGCCTGGG - Intronic
1124956077 15:34361345-34361367 GTCAGCCTGGAGGGAAGCCTGGG + Intronic
1125582131 15:40793619-40793641 GTCCAGGTGGAGGGCAGCCTTGG + Intronic
1125888913 15:43251343-43251365 GTGCCCTTGGACAGATGCCTGGG + Intronic
1128558270 15:68646394-68646416 GTGCATGTGGAAGGAAGCCTTGG + Intronic
1130682863 15:86011511-86011533 GTGCCCGTGCACTCAAGCCTGGG + Intergenic
1138106472 16:54289578-54289600 GTCCCCGTCGAGGGGAGCCGCGG + Intergenic
1138338199 16:56269338-56269360 GTCCACGGGGAGGGAAGGCTGGG - Intronic
1139549750 16:67666753-67666775 GACCCCGGGGACGGAAGCCACGG - Exonic
1141498525 16:84427031-84427053 GTCCCATTGGAAGGGAGCCTAGG + Intronic
1141705840 16:85664006-85664028 GTCCTGGTGGCCGGAGGCCTGGG + Intronic
1141729505 16:85812283-85812305 CTGCCCGGGGACGGTAGCCTGGG - Intergenic
1142756256 17:2018190-2018212 GTCACCCTGGAGGGAAGCCAGGG + Intronic
1142852551 17:2711341-2711363 GGTCCCGTGGAGGGCAGCCTCGG - Intronic
1148579387 17:48733238-48733260 GTCCCCGTTGCCGGAACCCCCGG - Intergenic
1161254476 19:3299750-3299772 GTGCCCCTGGACTCAAGCCTGGG - Intergenic
1164638915 19:29811347-29811369 GACCCCGCGGCCTGAAGCCTTGG + Intergenic
1165828442 19:38718825-38718847 GTGAGCGTGGACGGAAGGCTGGG + Intronic
926892212 2:17648648-17648670 GTCCCCTTGGACATAAGCCTAGG - Intronic
931779332 2:65565941-65565963 CTCCCCCTGGACGGTAGCCGAGG + Intergenic
934717850 2:96553619-96553641 GTCATCGTGGATGGTAGCCTTGG - Intergenic
934757209 2:96832575-96832597 GTCCCGGTGGAAGGCAGCCCTGG + Exonic
1169197222 20:3689747-3689769 GTCCCCTTGGAAGGAAGCACTGG - Intronic
1169201852 20:3714382-3714404 GTCCCAGTGGACTGAAGGATTGG - Intergenic
1172481394 20:35273974-35273996 GACCCCTTGCACGCAAGCCTGGG - Intronic
1175747127 20:61465081-61465103 GTCCCTGTGGACGGTCACCTGGG - Intronic
1177157464 21:17513388-17513410 GTGCCCGGGGACGGAGCCCTCGG + Intronic
1179489285 21:41729832-41729854 GTCCCCGTGGAAGGAAACGGAGG + Intergenic
1180039168 21:45267059-45267081 GTCCCCGAGGCCGGGAGCGTGGG - Intronic
1180039197 21:45267177-45267199 GTCCCCGAGGCCGGGAGCGTGGG - Intronic
1181535144 22:23538074-23538096 GTCTCAGTGGGGGGAAGCCTTGG - Intergenic
1183477379 22:38042977-38042999 GTCCCAGAAGAAGGAAGCCTTGG + Intergenic
1184789100 22:46688438-46688460 GTCCCTGTGCACGGCTGCCTGGG + Intronic
1185286375 22:50001647-50001669 TTCCCTGTGGACAGAGGCCTGGG - Intronic
963981482 3:151543223-151543245 CTCCCCTTGGACGGCAGCATAGG - Intergenic
967862495 3:194162436-194162458 GTCCCCCTGCACGCCAGCCTGGG + Intergenic
985083538 4:186290939-186290961 GTCCCCGTGGACGGACACTTGGG + Intergenic
998320320 5:141224256-141224278 GTCCCCGAGGACAGACCCCTTGG + Exonic
1002296802 5:178235911-178235933 GTCTCCAAGGACTGAAGCCTAGG - Intergenic
1002304068 5:178273187-178273209 GTGCCCGTGGAAGGGAGCCCAGG + Intronic
1002505641 5:179677564-179677586 GTGCCCCTGCACGGCAGCCTGGG + Intergenic
1003389496 6:5701154-5701176 GTCACCGTGGGCGCCAGCCTTGG + Intronic
1019542953 7:1559706-1559728 GTGCCCGTGGACAGGAGCCGGGG - Intronic
1019727556 7:2611444-2611466 GTCCCCGTGGACGGAAGCCTTGG - Exonic
1022020799 7:26398218-26398240 GTCCCGGTGGCCGCAGGCCTGGG + Intergenic
1035255050 7:157620874-157620896 GTCCCCGGGGAGGGAGGCCTGGG - Intronic
1040338426 8:46427799-46427821 GTCACCCTGCACCGAAGCCTGGG - Intergenic
1051624410 9:19084968-19084990 GTGCCAGTGGACTGTAGCCTGGG - Intronic
1053504481 9:38629896-38629918 GTCCTGGTGGAAGAAAGCCTGGG - Intergenic
1062331406 9:136046414-136046436 GGCCCTGTGGCCGGCAGCCTCGG - Intronic
1186504349 X:10078899-10078921 AACCAGGTGGACGGAAGCCTGGG + Intronic
1195765397 X:108291109-108291131 GTCCTCTTGGACAGAAGCCTAGG - Intronic
1200108655 X:153727719-153727741 GTCCCCGTGGACACTGGCCTAGG + Intronic