ID: 1019728741

View in Genome Browser
Species Human (GRCh38)
Location 7:2617864-2617886
Sequence GGTGAGAACGGGCAGGGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019728741_1019728748 -10 Left 1019728741 7:2617864-2617886 CCGTCTCCCTGCCCGTTCTCACC No data
Right 1019728748 7:2617877-2617899 CGTTCTCACCAGGCCCCACAGGG No data
1019728741_1019728749 -9 Left 1019728741 7:2617864-2617886 CCGTCTCCCTGCCCGTTCTCACC No data
Right 1019728749 7:2617878-2617900 GTTCTCACCAGGCCCCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019728741 Original CRISPR GGTGAGAACGGGCAGGGAGA CGG (reversed) Intergenic
No off target data available for this crispr