ID: 1019728748

View in Genome Browser
Species Human (GRCh38)
Location 7:2617877-2617899
Sequence CGTTCTCACCAGGCCCCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019728739_1019728748 -8 Left 1019728739 7:2617862-2617884 CCCCGTCTCCCTGCCCGTTCTCA No data
Right 1019728748 7:2617877-2617899 CGTTCTCACCAGGCCCCACAGGG No data
1019728734_1019728748 28 Left 1019728734 7:2617826-2617848 CCACATGGTTGTCCCTGCCAGAA No data
Right 1019728748 7:2617877-2617899 CGTTCTCACCAGGCCCCACAGGG No data
1019728737_1019728748 11 Left 1019728737 7:2617843-2617865 CCAGAAACCTAGAGATCATCCCC No data
Right 1019728748 7:2617877-2617899 CGTTCTCACCAGGCCCCACAGGG No data
1019728741_1019728748 -10 Left 1019728741 7:2617864-2617886 CCGTCTCCCTGCCCGTTCTCACC No data
Right 1019728748 7:2617877-2617899 CGTTCTCACCAGGCCCCACAGGG No data
1019728735_1019728748 16 Left 1019728735 7:2617838-2617860 CCCTGCCAGAAACCTAGAGATCA No data
Right 1019728748 7:2617877-2617899 CGTTCTCACCAGGCCCCACAGGG No data
1019728740_1019728748 -9 Left 1019728740 7:2617863-2617885 CCCGTCTCCCTGCCCGTTCTCAC No data
Right 1019728748 7:2617877-2617899 CGTTCTCACCAGGCCCCACAGGG No data
1019728738_1019728748 4 Left 1019728738 7:2617850-2617872 CCTAGAGATCATCCCCGTCTCCC No data
Right 1019728748 7:2617877-2617899 CGTTCTCACCAGGCCCCACAGGG No data
1019728736_1019728748 15 Left 1019728736 7:2617839-2617861 CCTGCCAGAAACCTAGAGATCAT No data
Right 1019728748 7:2617877-2617899 CGTTCTCACCAGGCCCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019728748 Original CRISPR CGTTCTCACCAGGCCCCACA GGG Intergenic
No off target data available for this crispr