ID: 1019728749

View in Genome Browser
Species Human (GRCh38)
Location 7:2617878-2617900
Sequence GTTCTCACCAGGCCCCACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019728739_1019728749 -7 Left 1019728739 7:2617862-2617884 CCCCGTCTCCCTGCCCGTTCTCA No data
Right 1019728749 7:2617878-2617900 GTTCTCACCAGGCCCCACAGGGG No data
1019728740_1019728749 -8 Left 1019728740 7:2617863-2617885 CCCGTCTCCCTGCCCGTTCTCAC No data
Right 1019728749 7:2617878-2617900 GTTCTCACCAGGCCCCACAGGGG No data
1019728735_1019728749 17 Left 1019728735 7:2617838-2617860 CCCTGCCAGAAACCTAGAGATCA No data
Right 1019728749 7:2617878-2617900 GTTCTCACCAGGCCCCACAGGGG No data
1019728738_1019728749 5 Left 1019728738 7:2617850-2617872 CCTAGAGATCATCCCCGTCTCCC No data
Right 1019728749 7:2617878-2617900 GTTCTCACCAGGCCCCACAGGGG No data
1019728734_1019728749 29 Left 1019728734 7:2617826-2617848 CCACATGGTTGTCCCTGCCAGAA No data
Right 1019728749 7:2617878-2617900 GTTCTCACCAGGCCCCACAGGGG No data
1019728741_1019728749 -9 Left 1019728741 7:2617864-2617886 CCGTCTCCCTGCCCGTTCTCACC No data
Right 1019728749 7:2617878-2617900 GTTCTCACCAGGCCCCACAGGGG No data
1019728736_1019728749 16 Left 1019728736 7:2617839-2617861 CCTGCCAGAAACCTAGAGATCAT No data
Right 1019728749 7:2617878-2617900 GTTCTCACCAGGCCCCACAGGGG No data
1019728737_1019728749 12 Left 1019728737 7:2617843-2617865 CCAGAAACCTAGAGATCATCCCC No data
Right 1019728749 7:2617878-2617900 GTTCTCACCAGGCCCCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019728749 Original CRISPR GTTCTCACCAGGCCCCACAG GGG Intergenic
No off target data available for this crispr