ID: 1019731077

View in Genome Browser
Species Human (GRCh38)
Location 7:2630053-2630075
Sequence GGTACCAGCCCACTCCAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019731069_1019731077 30 Left 1019731069 7:2630000-2630022 CCTGTTCACAGTGAGCAATCAGC No data
Right 1019731077 7:2630053-2630075 GGTACCAGCCCACTCCAAGTAGG No data
1019731073_1019731077 2 Left 1019731073 7:2630028-2630050 CCAAAGAAGAGGACTCACCTGGC No data
Right 1019731077 7:2630053-2630075 GGTACCAGCCCACTCCAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019731077 Original CRISPR GGTACCAGCCCACTCCAAGT AGG Intergenic
No off target data available for this crispr