ID: 1019731566

View in Genome Browser
Species Human (GRCh38)
Location 7:2632118-2632140
Sequence CGCAGGCCGCGCGCATCCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 52}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019731560_1019731566 -6 Left 1019731560 7:2632101-2632123 CCAGCAAGGGAGCCCCGCGCAGG 0: 1
1: 0
2: 2
3: 14
4: 155
Right 1019731566 7:2632118-2632140 CGCAGGCCGCGCGCATCCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 52
1019731559_1019731566 -1 Left 1019731559 7:2632096-2632118 CCGGGCCAGCAAGGGAGCCCCGC 0: 1
1: 0
2: 1
3: 12
4: 228
Right 1019731566 7:2632118-2632140 CGCAGGCCGCGCGCATCCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 52
1019731557_1019731566 1 Left 1019731557 7:2632094-2632116 CCCCGGGCCAGCAAGGGAGCCCC 0: 1
1: 0
2: 1
3: 22
4: 202
Right 1019731566 7:2632118-2632140 CGCAGGCCGCGCGCATCCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 52
1019731554_1019731566 7 Left 1019731554 7:2632088-2632110 CCCGCGCCCCGGGCCAGCAAGGG 0: 1
1: 0
2: 2
3: 32
4: 247
Right 1019731566 7:2632118-2632140 CGCAGGCCGCGCGCATCCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 52
1019731558_1019731566 0 Left 1019731558 7:2632095-2632117 CCCGGGCCAGCAAGGGAGCCCCG 0: 1
1: 0
2: 6
3: 38
4: 313
Right 1019731566 7:2632118-2632140 CGCAGGCCGCGCGCATCCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 52
1019731552_1019731566 14 Left 1019731552 7:2632081-2632103 CCTGAAGCCCGCGCCCCGGGCCA 0: 1
1: 0
2: 3
3: 22
4: 207
Right 1019731566 7:2632118-2632140 CGCAGGCCGCGCGCATCCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 52
1019731551_1019731566 15 Left 1019731551 7:2632080-2632102 CCCTGAAGCCCGCGCCCCGGGCC 0: 1
1: 0
2: 1
3: 23
4: 238
Right 1019731566 7:2632118-2632140 CGCAGGCCGCGCGCATCCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 52
1019731556_1019731566 6 Left 1019731556 7:2632089-2632111 CCGCGCCCCGGGCCAGCAAGGGA 0: 1
1: 1
2: 2
3: 18
4: 184
Right 1019731566 7:2632118-2632140 CGCAGGCCGCGCGCATCCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019731566 Original CRISPR CGCAGGCCGCGCGCATCCGG AGG Exonic
902286113 1:15409798-15409820 CGCACGCCGCGCGGGCCCGGGGG + Intergenic
906290572 1:44617105-44617127 CGCAGGGCGCGCACAGACGGAGG - Intronic
921060388 1:211579475-211579497 CGCGGGCCGCGTGCAGCGGGAGG + Intergenic
921671097 1:217925038-217925060 CGCCGGCCGCGGGCACACGGAGG - Intergenic
1069634573 10:69917495-69917517 AGGAGGCCGCCCGCATCAGGGGG - Intronic
1072248924 10:93566725-93566747 CGCTGCCCGCGCGCATTCAGGGG - Exonic
1076733097 10:132447895-132447917 CGGAGGCCGCGGGCGCCCGGAGG - Exonic
1079353454 11:19712616-19712638 CCCCGGCCGCGCGCCTCCCGGGG - Intronic
1083420081 11:62547419-62547441 CGCAGGCCGCGGGCATACGGGGG + Intronic
1090788504 11:130070122-130070144 CGCAGTCCGCGCTCCTCCGGCGG - Intronic
1091381829 12:66852-66874 CGCAGGCAGGGCGCAGGCGGCGG + Exonic
1091903519 12:4164730-4164752 CGCAGGGCGCGCGGCTCCGCTGG - Intergenic
1096472420 12:51888052-51888074 CTCAGGCCCCGCCCACCCGGAGG + Exonic
1112294790 13:98177119-98177141 CGCAGGCCGGGCGCTTTCTGAGG + Exonic
1112344198 13:98576857-98576879 CGCGGGCCGCGCGCAGCCCTCGG + Intronic
1117424611 14:55580792-55580814 CGGAGGCAGCGCGTCTCCGGCGG + Intronic
1122402068 14:101473467-101473489 AGCAGGCCGGGCGCATCCAGCGG - Intergenic
1128322436 15:66703014-66703036 CGCAGTCCGCGCGCGGCCAGCGG - Exonic
1132466179 16:78303-78325 CGCTGCGCGCGGGCATCCGGCGG - Exonic
1132903065 16:2268686-2268708 CGCCTGCCGCGCCCACCCGGTGG - Intergenic
1136222769 16:28838950-28838972 AGCAGTCCGCCCGCATCTGGGGG + Intergenic
1142374878 16:89701678-89701700 CGCGCGCCGCGCGCTTCCGCCGG + Exonic
1151624915 17:75270741-75270763 CGCAGGCCGGCCCCATCCGGGGG - Intronic
1152719807 17:81917950-81917972 CGCAGGTGTCGCGCATCCTGAGG - Exonic
1152878222 17:82800500-82800522 CGCAGGCCACGGGCATGCTGTGG - Intronic
1152878230 17:82800535-82800557 CACAGGCCACGGGCATCCTGCGG - Intronic
1152938302 17:83153054-83153076 CGGGGGCCGCGCGCATCCTCGGG + Intergenic
1156008466 18:32470545-32470567 CTCCGGCCGCGGGCAGCCGGGGG + Intergenic
1156760050 18:40577763-40577785 CGCAGGACCAGGGCATCCGGTGG + Intergenic
1159370015 18:67517050-67517072 CGGTGGCCGCGCGCTCCCGGAGG + Intergenic
1160023970 18:75204207-75204229 CCCAGGGCGCGCCCATCCCGAGG - Intronic
1160164078 18:76495180-76495202 CGCACGCCCCGCGCATCTGAAGG + Exonic
1160369240 18:78357756-78357778 CGCAGGCCACGTGCAGCTGGAGG + Intergenic
1160930637 19:1568144-1568166 CGCCGGCCGCCTGCATCCAGCGG + Intergenic
1163416204 19:17187993-17188015 TGGAGACCGTGCGCATCCGGAGG + Exonic
1166984112 19:46649466-46649488 CGCGGGTCGCGCGCTGCCGGGGG + Exonic
1167134919 19:47610168-47610190 GCCAGGCCGCGGGCACCCGGAGG + Intronic
931649468 2:64454727-64454749 CACCGGCCGCGCGCAGCCAGCGG - Intronic
937042513 2:118833438-118833460 CGCAGTCCGCGAGCATCCCTGGG - Intergenic
940971954 2:159904737-159904759 GGCAGGCCGCGCTCAGCAGGCGG - Intronic
1172502098 20:35434632-35434654 GGCAGCCCGCCCGCCTCCGGGGG + Exonic
1176283372 20:64327981-64328003 CGCAGGCAGGGCGCAGGCGGCGG - Intergenic
950864507 3:16178526-16178548 CGCAGGCCGCACGCACCAGCCGG - Intronic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
962230447 3:133661464-133661486 CGCAGGCCGTGGGTATCCGCAGG - Intronic
969714073 4:8860138-8860160 GCCACGCCGCGCGCACCCGGGGG - Intronic
994710559 5:103259299-103259321 CGCACGACGCGCGCACACGGGGG - Intronic
1019395423 7:815813-815835 CGCAGGCCGGGCTCCTCCCGCGG - Intergenic
1019473551 7:1233422-1233444 CGCTGGCCGCCTGGATCCGGGGG - Intronic
1019731566 7:2632118-2632140 CGCAGGCCGCGCGCATCCGGAGG + Exonic
1024621222 7:51159126-51159148 CCCCGGCCGCGCGCACCTGGCGG + Intronic
1030659692 7:112206239-112206261 CGCAGCCCGCGCGAAGCCGCTGG - Exonic
1032953026 7:136938457-136938479 TCCAGGCCGTGCGCATCCAGGGG - Intronic
1049257534 8:141621867-141621889 CGCGGGCCACGGGCATGCGGTGG - Intergenic
1051038359 9:12776171-12776193 AGCAGGGGGCGCTCATCCGGAGG + Intronic
1061285466 9:129620175-129620197 CCCTGGCCACGCGCCTCCGGGGG + Exonic
1062696095 9:137877341-137877363 CGCGAGCCGAGCGCACCCGGAGG + Intergenic