ID: 1019734094

View in Genome Browser
Species Human (GRCh38)
Location 7:2641930-2641952
Sequence GGGACCCGGGCAGCCCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019734082_1019734094 16 Left 1019734082 7:2641891-2641913 CCCTGACACCCAGGCTCTGCATG 0: 1
1: 0
2: 3
3: 43
4: 328
Right 1019734094 7:2641930-2641952 GGGACCCGGGCAGCCCAAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 171
1019734085_1019734094 7 Left 1019734085 7:2641900-2641922 CCAGGCTCTGCATGCTCGCAGTG 0: 1
1: 0
2: 1
3: 10
4: 193
Right 1019734094 7:2641930-2641952 GGGACCCGGGCAGCCCAAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 171
1019734083_1019734094 15 Left 1019734083 7:2641892-2641914 CCTGACACCCAGGCTCTGCATGC 0: 1
1: 0
2: 1
3: 26
4: 278
Right 1019734094 7:2641930-2641952 GGGACCCGGGCAGCCCAAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 171
1019734084_1019734094 8 Left 1019734084 7:2641899-2641921 CCCAGGCTCTGCATGCTCGCAGT 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1019734094 7:2641930-2641952 GGGACCCGGGCAGCCCAAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019734094 Original CRISPR GGGACCCGGGCAGCCCAAGT GGG Intronic
900121101 1:1049077-1049099 GGGGCCGGGGCAGCTCAGGTGGG + Intronic
900121126 1:1049125-1049147 GGGGCCGGGGCAGCTCAGGTGGG + Intronic
900167274 1:1248745-1248767 GGGACACGGGCAGCCCTGGGAGG + Intergenic
900167336 1:1248943-1248965 GGGACACGGGCAGCCCTGGGAGG + Intergenic
900167359 1:1249009-1249031 GGGACACGGGCAGCCCTGGGAGG + Intergenic
900167382 1:1249075-1249097 GGGACACGGGCAGCCCTGGGAGG + Intergenic
900167406 1:1249141-1249163 GGGACACGGGCAGCCCTGGGAGG + Intergenic
900167430 1:1249207-1249229 GGGACACGGGCAGCCCTGGGAGG + Intergenic
900167454 1:1249273-1249295 GGGACACGGGCAGCCCTGGGAGG + Intergenic
900167478 1:1249339-1249361 GGGACACGGGCAGCCCTGGGAGG + Intergenic
900167502 1:1249405-1249427 GGGACACGGGCAGCCCTGGGAGG + Intergenic
900167526 1:1249471-1249493 GGGACACGGGCAGCCCTGGGAGG + Intergenic
900167550 1:1249537-1249559 GGGACACGGGCAGCCCTGGGAGG + Intergenic
900167574 1:1249603-1249625 GGGACACGGGCAGCCCTGGGAGG + Intergenic
900416757 1:2538820-2538842 GGGGCCTGAGCATCCCAAGTGGG + Intergenic
901810810 1:11766004-11766026 GGGACCAGGGCTGGCCAGGTTGG - Exonic
902600965 1:17539933-17539955 CGGGCCCGGGCAGCCGAGGTGGG + Exonic
903044340 1:20554033-20554055 GGGGCCGGGGCAGCCGAAGCGGG - Exonic
904373080 1:30063003-30063025 GCAACCCGGGCAGCCCATCTTGG + Intergenic
904431152 1:30465307-30465329 GGAGGCCTGGCAGCCCAAGTGGG - Intergenic
904771648 1:32884530-32884552 GGGAGCTGAGCAGCCCAAGATGG + Intergenic
906641093 1:47440788-47440810 GGCCCCTGGGCAGCCCAAGCAGG + Intergenic
909433348 1:75615130-75615152 GGAACCCGGGCTTCCAAAGTTGG - Intergenic
910490565 1:87764922-87764944 GGGAGCCTGGAAGACCAAGTAGG - Intergenic
917539938 1:175902388-175902410 GGGACTCCCGAAGCCCAAGTGGG - Intergenic
918809242 1:189094225-189094247 GGGGCCCTGGCAGGCCAAGGTGG - Intergenic
919669931 1:200329341-200329363 GGGACCCTGGCAGGTGAAGTGGG + Intergenic
919760813 1:201097071-201097093 GGGACCCGGGGAGAGCAAGAGGG - Intronic
920570709 1:207015159-207015181 AGGAACTGGGCATCCCAAGTAGG - Intronic
922017643 1:221667527-221667549 GAGACCGAGGCAGCTCAAGTTGG - Intergenic
922821379 1:228487824-228487846 GGGCCCCGAGCCGCCCGAGTGGG + Exonic
1065483802 10:26217681-26217703 GGGACCGGGGCGGCCAAGGTCGG + Intronic
1070167751 10:73911289-73911311 GGAGCCCGGGCAGCCCAGGGCGG - Exonic
1076673000 10:132133451-132133473 GGCACCCGGGCAGCCCCAGACGG + Exonic
1077080377 11:722257-722279 GTGAACCGGGCTGCCCAAGGCGG - Intronic
1077543213 11:3157391-3157413 GAGACCCGGGGAGGCCAAGAGGG + Intronic
1080606523 11:33869258-33869280 GGGACCCGGGCGGCCCGCGAGGG - Intronic
1081758153 11:45559244-45559266 AGGACCAGGGCAGACAAAGTGGG + Intergenic
1083857452 11:65400185-65400207 AGGACACGGTCAGCCCAAGAGGG - Intronic
1084581850 11:70029116-70029138 GGGTCCCTGGCAGCCCCTGTGGG + Intergenic
1084661340 11:70548344-70548366 GGGATCAGGGCAGTCCCAGTAGG - Intronic
1089555089 11:119311764-119311786 GAGACCAGGTCACCCCAAGTGGG - Intronic
1089602884 11:119625995-119626017 GGGACCCTGACATCCCCAGTCGG - Intronic
1089713603 11:120336086-120336108 GGGACCCGTGCAGCCCCGGGAGG - Intergenic
1090330408 11:125926947-125926969 GGGACCCAGGCAGCACAGGAGGG - Intergenic
1090805038 11:130197606-130197628 GGGACCCTGCCAGCCCAGGTTGG + Intronic
1091458951 12:629527-629549 GGGCCCCGTGCAGCCCAGGACGG + Intronic
1092055955 12:5508115-5508137 GGGACCTGGGCGGCCCCACTGGG - Intronic
1093262332 12:16954121-16954143 GGGCCCCAGGCAGCCCAGGAGGG + Intergenic
1100617478 12:96242201-96242223 GTGTCCCGGGCTGCCTAAGTTGG + Intronic
1101327656 12:103730724-103730746 GGGAGCAGAGCAGCCCAAGGAGG + Intronic
1102740140 12:115199708-115199730 GGGACCCCTGCAGCTCAAGGAGG - Intergenic
1103402195 12:120650599-120650621 TGGACCCGGGGATCCCAAGAGGG + Intronic
1103897118 12:124280037-124280059 GGGTCCCGGGCAGCCGGCGTGGG + Intronic
1104224956 12:126822632-126822654 AGGACCCAGGCAGGCCAAGGTGG + Intergenic
1104994644 12:132646121-132646143 GGGATCTGGCCAGCCCAATTTGG + Intronic
1106253689 13:28002757-28002779 TGGAACCGGTCAGCCCAGGTTGG - Intergenic
1113713130 13:112484065-112484087 GGGTCCTGGGCAGCTCAAGCAGG - Intergenic
1115027184 14:28759202-28759224 GGGGCCCAGGAGGCCCAAGTTGG + Intergenic
1117365866 14:55026998-55027020 TGGACGCGGGCAGCCGGAGTGGG + Intronic
1117464185 14:55975823-55975845 GGAAAGCTGGCAGCCCAAGTTGG - Intergenic
1119023774 14:71136722-71136744 GTGACCCCTGAAGCCCAAGTGGG + Intergenic
1122874482 14:104657357-104657379 GGGACCCAGGCAGCCTCAGGAGG - Intergenic
1122875105 14:104660302-104660324 GGCACCCAGGGAGCCCAAATCGG - Intergenic
1128229339 15:66023978-66024000 GGGACCAGGGCAGGAGAAGTTGG + Intronic
1128349968 15:66882029-66882051 GGGTCCCAGGAAGCCCCAGTAGG + Intergenic
1129324701 15:74793935-74793957 GGGGCCCAGCCAGCCCTAGTGGG + Intronic
1130822048 15:87506203-87506225 GAGACCCAGGCAGGCCAGGTTGG - Intergenic
1141659986 16:85436593-85436615 GGGACCTCGGTAGCCCCAGTGGG + Intergenic
1143524264 17:7463207-7463229 GGGCCCCGGCCAGCCCCTGTGGG + Exonic
1145272372 17:21411524-21411546 GGGACCCTGGCAGGCCAACCTGG + Intronic
1148807682 17:50272466-50272488 AGAACCCTGGCAGCCCAAGTTGG + Intronic
1148908001 17:50923391-50923413 GGGGCCCAGGCAGCCCCTGTTGG + Intergenic
1149712369 17:58755487-58755509 GGGATCCAAGCAACCCAAGTGGG + Intergenic
1151642273 17:75405177-75405199 GGGGCCCGGGAAGCCCAGGCGGG - Exonic
1151890522 17:76948403-76948425 GGGACCCAGGCAGACCCAGTAGG - Intronic
1152034439 17:77863548-77863570 GGGACATGGGCAGCCCCAGAAGG - Intergenic
1152200636 17:78943888-78943910 GGGACCCTGGCAGCAGGAGTGGG + Intergenic
1152225550 17:79091064-79091086 GGGGCCCAGGCAGCCCAGGATGG + Intronic
1160548780 18:79680006-79680028 GGGCCCCGGGCAGCGCACCTCGG - Exonic
1160764959 19:803462-803484 GGACCCCAGGCAGCCCAAGTGGG + Intronic
1161050871 19:2163684-2163706 GGGACCCGGGGAGACCCTGTGGG - Intronic
1161399367 19:4060624-4060646 AGGACCCCGGCATCCCAAGAAGG + Intronic
1162100391 19:8335338-8335360 GGGTCCCGCGCAGCCCACGCGGG - Exonic
1162951031 19:14072364-14072386 GGGACCCGGGCAGTCCCGCTTGG - Intergenic
1164520202 19:28973257-28973279 GGGACTCAGGCAGCCCGAGGTGG + Intergenic
1166177042 19:41081644-41081666 AGGACCCAGGCAGTCCATGTTGG + Intergenic
1167001142 19:46746327-46746349 GAGACCGGGGCCGCCCCAGTGGG + Exonic
1167037572 19:47003186-47003208 GGGAAGCGTGCAGCCCAAATGGG + Exonic
1167499284 19:49836312-49836334 GGGCCTGGGGCAGCCCCAGTTGG + Exonic
925231070 2:2234552-2234574 GGAACCCCTGCAGCTCAAGTTGG + Intronic
927471311 2:23379619-23379641 GGGACCCAGGCAGCCTGAGAGGG - Intergenic
927853350 2:26513438-26513460 AGGCCCCGGGCAGCCCAGGCTGG - Intronic
927982744 2:27384815-27384837 GGGACTGAGGCAGGCCAAGTTGG - Exonic
929094909 2:38254288-38254310 TGGCCCCAGGCAGGCCAAGTGGG - Intergenic
933723656 2:85413930-85413952 GGGACCTGGGCTCCCCATGTAGG - Intronic
933747752 2:85583334-85583356 GGGACCCAGGCTGTCCAAGGTGG + Intergenic
933759822 2:85665635-85665657 GGGCCCCGGGCAGCACAGGGAGG + Exonic
938259857 2:129887865-129887887 GGGACAGGGCCAGCCCAAGGAGG + Intergenic
940074000 2:149720389-149720411 GGCAGGAGGGCAGCCCAAGTTGG + Intergenic
940987210 2:160062074-160062096 GGGTGCCGGGCCGCGCAAGTGGG + Intronic
946865511 2:224038826-224038848 GGGACCCGGGCAGGGCAAGGCGG - Intronic
948808143 2:240461745-240461767 GGGCCACGGGGAGCACAAGTGGG + Intronic
948854528 2:240723970-240723992 CTGACGCGGGCAGCCCAGGTAGG - Exonic
948992349 2:241561485-241561507 GGGGCCCAGCCAGCCCAGGTGGG + Intronic
948992383 2:241561587-241561609 GGGGCCCAGCCAGCCCAGGTGGG + Intronic
948992417 2:241561689-241561711 GGGGCCCAGCCAGCCCAGGTGGG + Intronic
1168757250 20:325978-326000 GGGACCCGGGCCGGCCGAGGAGG + Exonic
1170362154 20:15558167-15558189 AGTACACGGGCAGCCCAAGATGG - Intronic
1170634612 20:18093549-18093571 GGGACGGGAGCAGCCCAGGTGGG - Intergenic
1173704622 20:45100860-45100882 CGGTCCCGGGCAGCCAGAGTGGG - Intronic
1177212343 21:18086958-18086980 GGGACCCAAGCAGTCCATGTGGG + Intronic
1180699714 22:17774553-17774575 GGGACCCGGGGAGCCCGCGCCGG + Intronic
1181869528 22:25886788-25886810 GGGAATCAGGCAGCCCAAGCTGG + Intronic
1183303404 22:37069521-37069543 GGAACCCAGGCAGGCCGAGTGGG - Intronic
1184280589 22:43435300-43435322 GGGGCCCGGGCAGCGCAGGAGGG - Intronic
949808230 3:7978243-7978265 AGGACTCCGGAAGCCCAAGTGGG + Intergenic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
961659774 3:128462594-128462616 GGAAGACGGGCAGCTCAAGTCGG - Exonic
965354929 3:167662114-167662136 GGTACTCGGGTAGCCCCAGTGGG - Intergenic
967330437 3:188284432-188284454 GGGACCCAGGAGGCCCAAGGGGG + Intronic
968516793 4:1018874-1018896 GGGGTCCGGGGAGCCCAGGTGGG + Intronic
968541045 4:1168603-1168625 GGGCCCCGGGCAGCCCACCTGGG + Intronic
969440302 4:7212980-7213002 AAGACCCGGGCAGCACAAGGTGG - Intronic
969621997 4:8283354-8283376 GGGACCGGGGCAGGCCCTGTGGG - Intronic
970026961 4:11634037-11634059 TGGAATCGAGCAGCCCAAGTAGG - Intergenic
971948003 4:33306263-33306285 GGGACTCCTGAAGCCCAAGTGGG - Intergenic
975736828 4:77389243-77389265 GGGACCCGGGGAGGGCAGGTTGG + Intronic
979547229 4:121951788-121951810 GGGCCCCGGGCGGCCCAGGGCGG + Intergenic
982356364 4:154473857-154473879 TGGACCCAGGAAGCCCAAGAGGG + Intronic
985614763 5:913021-913043 CTGACCCGGGCAGGCCCAGTGGG - Intronic
985760531 5:1746479-1746501 GGTCCCCGGGCAGCCCAGGCAGG - Intergenic
993219306 5:85070073-85070095 GTGGCCTGGGCAGGCCAAGTGGG + Intergenic
995400969 5:111741187-111741209 TGGACCCGTGCTGCCCTAGTCGG - Intronic
996765469 5:127030817-127030839 GGGACCCGAGCAGCTCTAGAGGG + Intergenic
998092666 5:139380320-139380342 GGGCCCCAGGCAGCCCCAGCAGG + Exonic
1001381648 5:171309911-171309933 GGGCCCCGGGCAGCCGTGGTGGG + Intronic
1001898134 5:175398478-175398500 GAGCCCCGGGCAGCCTAACTGGG + Intergenic
1002021916 5:176368892-176368914 GGGCCCAGGGCAGCCGCAGTCGG - Exonic
1002576096 5:180175026-180175048 GGGACCCTGGCAGCTCAGGTGGG + Intronic
1002776680 6:333790-333812 GGGATCCGGGAAGCACACGTGGG - Intronic
1003989709 6:11473498-11473520 AGAACCCGGGCAGCCCACCTGGG - Intergenic
1006262512 6:32887111-32887133 GGGATCCAGGGTGCCCAAGTGGG - Intergenic
1010234944 6:73567463-73567485 TGGAACCAGGCAGCCCCAGTTGG - Intergenic
1011129441 6:84038170-84038192 GGGCCCCTGGCAGCAGAAGTAGG + Intronic
1013225373 6:108116930-108116952 CTGGCCCGGGCAGCCCAACTGGG + Intronic
1016245015 6:141970236-141970258 GAGCCCCGAGCAGCCCAACTGGG + Intergenic
1017760137 6:157562282-157562304 GGGACCAGGGATGCCCAACTGGG + Intronic
1018268835 6:162054622-162054644 GGGAACAGAGCAGACCAAGTTGG - Intronic
1019503504 7:1377641-1377663 GGGTCCTGGGCTGCCCAGGTGGG - Intergenic
1019593760 7:1848823-1848845 GGGACCTGGGCTGCCCCTGTGGG - Exonic
1019734094 7:2641930-2641952 GGGACCCGGGCAGCCCAAGTGGG + Intronic
1022113236 7:27243894-27243916 AGCACCCGGGCTGCCCAAGTGGG - Intronic
1025609820 7:63068259-63068281 AGGAGGCGGGCAGCCCAAGAGGG - Intergenic
1026841296 7:73671218-73671240 GGCCCCCGGGCGGCCCCAGTGGG - Exonic
1027701181 7:81471852-81471874 GTGACCCATGCAGGCCAAGTTGG + Intergenic
1028752316 7:94394772-94394794 GGGGCCCGGGCAGCCACAGCTGG - Exonic
1031693018 7:124814151-124814173 GGCACCAGCCCAGCCCAAGTTGG - Intergenic
1038575764 8:28701961-28701983 GGGTCCCGAGCAGCCCAAACTGG - Intronic
1039796447 8:40919462-40919484 GGGACCTGGGCACCACAAATGGG + Intergenic
1043550286 8:81363818-81363840 GGGAAGCAGGCAGGCCAAGTAGG + Intergenic
1046236451 8:111429545-111429567 GAGAAATGGGCAGCCCAAGTAGG - Intergenic
1049612273 8:143561178-143561200 GGGCCCACGGCAGCCCAAGCTGG - Intronic
1053464736 9:38297473-38297495 GGGATCCGGCCAGGCCAAATTGG - Intergenic
1056326153 9:85480492-85480514 GCGAGCCAGGCAGCCCAGGTGGG - Intergenic
1056935741 9:90913807-90913829 GGGACCCGGGGAGGCCAGGAGGG + Intergenic
1057230308 9:93317718-93317740 GGGCCCTGGGCAGGCCAGGTGGG + Intronic
1060547874 9:124471307-124471329 GGGACCCGGGCTGGGCAAGCAGG - Intronic
1060794879 9:126506761-126506783 GGGTGCCAGGCAGCCCAAGCAGG - Exonic
1061374845 9:130217749-130217771 GGGCCCCGGGCAGGCGATGTTGG + Intronic
1062094544 9:134696023-134696045 TGGACCCTGGCAGCCCAGGAGGG - Intronic
1062110242 9:134778302-134778324 TGGGCCCGGGCAGCCCAGGAAGG - Intronic
1062207481 9:135345173-135345195 GGGAGCCTGGGAGCCCAAGCAGG - Intronic
1186898271 X:14027235-14027257 GGGGGCAGGGCTGCCCAAGTAGG - Intronic
1192214611 X:69150035-69150057 GGGAGCCGGGCTCCCCACGTGGG + Intergenic
1192224968 X:69221728-69221750 GGGAGCCGGGCTCCCCACGTGGG - Intergenic
1196933510 X:120705552-120705574 GGGAGTCGGACAACCCAAGTAGG + Intergenic
1200110449 X:153738143-153738165 TGGCCCCGGGCAGCACAAGCAGG + Intronic
1200213235 X:154356166-154356188 GGGAGCCGGGCAGGGAAAGTGGG - Intronic
1201073296 Y:10169301-10169323 GGGATCAGGGCCGCCCACGTGGG - Intergenic
1202089262 Y:21172186-21172208 GGGTCCCGAGCAGCCTAACTGGG - Intergenic